ID: 1183735552

View in Genome Browser
Species Human (GRCh38)
Location 22:39642973-39642995
Sequence CTGGCTCTGAGGGGCTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 361}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183735552_1183735563 4 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735563 22:39643000-39643022 GCCGGGATGAGGGAGCAGGAAGG 0: 1
1: 0
2: 2
3: 78
4: 599
1183735552_1183735562 0 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735562 22:39642996-39643018 GACAGCCGGGATGAGGGAGCAGG 0: 1
1: 0
2: 2
3: 36
4: 304
1183735552_1183735565 5 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735565 22:39643001-39643023 CCGGGATGAGGGAGCAGGAAGGG 0: 1
1: 0
2: 4
3: 68
4: 454
1183735552_1183735566 25 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735566 22:39643021-39643043 GGGCTGTTTCTCAGCACCACCGG 0: 1
1: 0
2: 3
3: 17
4: 198
1183735552_1183735560 -6 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735560 22:39642990-39643012 AGCCAGGACAGCCGGGATGAGGG 0: 1
1: 0
2: 2
3: 24
4: 305
1183735552_1183735567 26 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735567 22:39643022-39643044 GGCTGTTTCTCAGCACCACCGGG 0: 1
1: 0
2: 1
3: 21
4: 249
1183735552_1183735559 -7 Left 1183735552 22:39642973-39642995 CCTAGGGAGCCCCTCAGAGCCAG 0: 1
1: 0
2: 6
3: 40
4: 361
Right 1183735559 22:39642989-39643011 GAGCCAGGACAGCCGGGATGAGG 0: 1
1: 0
2: 2
3: 42
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183735552 Original CRISPR CTGGCTCTGAGGGGCTCCCT AGG (reversed) Intronic
900403543 1:2482691-2482713 CTGGCTCAGAGGGGATCCCAGGG + Intronic
900415240 1:2531696-2531718 CCGGCTCTGAGTGACTCGCTTGG + Intergenic
900677415 1:3896471-3896493 CTGGCTCAGAGGCTCTGCCTGGG + Intronic
900883957 1:5402369-5402391 CTGGCTCTGAGGGACTGCTTAGG + Intergenic
901005619 1:6170359-6170381 CTGGGTCTCTGGGGCTCCCATGG + Intronic
901037489 1:6345028-6345050 CTGGCCTTCAGGGACTCCCTGGG - Intronic
901641879 1:10696776-10696798 CTGGCTCTGAATGTCTTCCTGGG + Intronic
902637931 1:17747198-17747220 CTGGGACTGAGGGGGTGCCTGGG + Intergenic
902718258 1:18287664-18287686 TGGGCTCTGAGAGGCTCCCATGG - Intronic
902810700 1:18886299-18886321 CTGACACTGAGGGAGTCCCTGGG - Intronic
903423668 1:23237029-23237051 CTGGTTCTTAGTGGCTTCCTTGG + Intergenic
905175191 1:36130921-36130943 CTGGCTCTGGGGGGCTTCCTGGG + Intergenic
905856366 1:41317281-41317303 CTGGCTCTGAGTCTCTTCCTTGG - Intergenic
905916661 1:41689337-41689359 TAGGCGCTGAGGGGCTCTCTCGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
908229147 1:62086871-62086893 CAGGCTCTGTGGGGTCCCCTCGG + Intronic
908791585 1:67787919-67787941 ATGGCACTGAGGGGATTCCTGGG - Intronic
909789638 1:79659694-79659716 CTGGCTCTGGGTGTCTCCTTTGG - Intergenic
912528114 1:110299837-110299859 CCAGCTCTGAGGGGCACCCAGGG - Intergenic
915748326 1:158182056-158182078 CTGGCTGTGAGGTGCACCCTGGG + Exonic
916726431 1:167527632-167527654 ATGGCTCTGATGGACTCCTTGGG + Intergenic
917653620 1:177103926-177103948 CTAGCTCTGAGCAGATCCCTAGG + Intronic
918490096 1:185072151-185072173 CTGACTCTGAGGTGCTGGCTAGG + Intronic
918518330 1:185386916-185386938 CTGGGACTGAGGGGTTACCTGGG + Intergenic
920907773 1:210188036-210188058 CTGGGTCAGAGGGACTCCTTCGG + Intergenic
921075660 1:211698567-211698589 GTGGTTCTGAGGGGCACCCAGGG + Intergenic
922898885 1:229121283-229121305 GTGGCTCTGAGGCGCGGCCTAGG - Intergenic
923432834 1:233939711-233939733 CTGGCACTTATGGGCTCACTTGG + Intronic
924643202 1:245853199-245853221 CTGGCTCTGAGTTGTTCTCTAGG + Intronic
1062852199 10:753265-753287 CTGGCTTTCCAGGGCTCCCTTGG - Intergenic
1063093165 10:2885970-2885992 CTGGGACTCAGGGGCACCCTAGG + Intergenic
1063262729 10:4408519-4408541 CTGACCCTCAGGGTCTCCCTGGG - Intergenic
1067131919 10:43573373-43573395 CAGGCTTTGAGAGGCTCCCCAGG + Intronic
1067437890 10:46291818-46291840 CTGGGACTGAGGAGCTTCCTGGG - Intronic
1067807712 10:49404634-49404656 CCGGGGCTGAGGGGCTGCCTTGG - Intergenic
1067849289 10:49744612-49744634 GTGGCTCAGAGGGACTCCCCTGG - Intronic
1069357050 10:67598367-67598389 CTGGCCCTGAGAGGCTCCCAGGG - Intronic
1069634695 10:69918055-69918077 CTCAGTCTGCGGGGCTCCCTGGG - Intronic
1069635546 10:69922757-69922779 CTGGCCCTCCAGGGCTCCCTGGG + Exonic
1069906680 10:71736232-71736254 CTTCCTCTGAGAGGCTCCCAGGG + Intronic
1070437035 10:76403471-76403493 CTGGCCCTGAGGGGTTTCCTGGG - Intronic
1070644553 10:78192580-78192602 CAGGCTGGGAGGGGCTCTCTAGG + Intergenic
1072805922 10:98424041-98424063 CTGGGAGTGAGGGGCTCCCCAGG - Intronic
1074759405 10:116655077-116655099 CTGGCTCTGAAGGGCTCCTAAGG - Intergenic
1075588218 10:123672486-123672508 CTGGCTCTGTGACCCTCCCTGGG - Intronic
1075977000 10:126704811-126704833 TTGGCTCAGAAGGGCTCCATGGG - Intergenic
1076593578 10:131609277-131609299 CTGGGACCGAGGGGCTTCCTGGG - Intergenic
1076747719 10:132522766-132522788 CTGGCTCTGCTGGACTTCCTAGG + Intergenic
1077177805 11:1198512-1198534 CTGGCTCCGGGGGGCTCCGGGGG + Intronic
1077183777 11:1227627-1227649 GTGGCTCTGAGGGGCTCCTGGGG - Intronic
1077294718 11:1820782-1820804 ACAGCTCTGAGGGGCTCCCCTGG - Intergenic
1077362865 11:2148423-2148445 CTGGCACAGAGAGGCGCCCTGGG - Intronic
1077980463 11:7294680-7294702 CTGGGACTGAGGGCCTGCCTGGG + Intronic
1080386207 11:31812583-31812605 CAGGCTCCGAGGGGCGCCTTTGG - Intronic
1081292884 11:41348747-41348769 CTGGCCCTGAGTGGCTCCTGGGG + Intronic
1082084141 11:48035223-48035245 CTGACTCTGCTGGCCTCCCTGGG - Intronic
1082794411 11:57369318-57369340 CGGGCTCCGAGGGGTGCCCTGGG - Intronic
1083325572 11:61871352-61871374 CTGGCTCCGAGGCGCTCGCCAGG - Intergenic
1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG + Intergenic
1083406877 11:62463660-62463682 CTGGAACTGAGGGGGTTCCTGGG + Intronic
1083629415 11:64088048-64088070 CTGGCTCTCTGGGCCTCCCCTGG + Intronic
1083698102 11:64456011-64456033 CTGTCTTTGAGGGCCTCCCTGGG - Intergenic
1084657247 11:70526866-70526888 TGGGCTCAGAGGGGCTCCCCCGG - Intronic
1084684828 11:70687413-70687435 CTGGCTCTTAGGAGCTGCCAGGG + Intronic
1085189239 11:74603537-74603559 CTGGGTCTGAGGGGTTTCTTGGG - Intronic
1085529745 11:77184286-77184308 CTGGCTGAGAGGACCTCCCTGGG + Intronic
1086044463 11:82516744-82516766 GTGGCTCTGAGGGGCTCCATGGG + Intergenic
1086279632 11:85171289-85171311 CTGGCTCTGTGCTGCTCCGTGGG - Intronic
1088723895 11:112617997-112618019 TTGGCTCTGAGGGGCATCCAGGG - Intergenic
1088775544 11:113078948-113078970 CCGGCTCGGAGGAACTCCCTGGG - Intronic
1089054714 11:115576365-115576387 GTGGCTCTGGAGGGCTCCATGGG - Intergenic
1089697372 11:120224536-120224558 CAGGCTCTGAGTGGCCCCCTTGG - Intronic
1089800663 11:121024311-121024333 CTGGCTCTGCCGGGCTCTCGAGG + Intronic
1090274671 11:125410845-125410867 CTGGATCTGGATGGCTCCCTGGG - Exonic
1090350399 11:126104406-126104428 CTTCCCCTCAGGGGCTCCCTGGG + Intergenic
1090653556 11:128825907-128825929 CTGGCTCTAAGGGGCTGGCCTGG - Intergenic
1090663877 11:128902119-128902141 CTGGCTGTCATGGGCTCCCAGGG - Exonic
1091999568 12:5021178-5021200 CTGGACCTGAGGGGCTAACTAGG - Intergenic
1092164965 12:6336901-6336923 CTGGGTTTGGGGGCCTCCCTGGG + Intronic
1092233762 12:6792806-6792828 CTGGCTCTCCCGGGCTCCCCTGG - Intronic
1092523895 12:9297984-9298006 CTGGTCCTGAGTTGCTCCCTTGG + Intergenic
1092543403 12:9433915-9433937 CTGGTCCTGAGTTGCTCCCTTGG - Intergenic
1095944605 12:47746773-47746795 CTGACCCTGAGGGGCTCTGTGGG - Intronic
1096022874 12:48336890-48336912 CTGCCGCTGAAGTGCTCCCTGGG + Intergenic
1096100882 12:48969939-48969961 CTGGCTCAGAGCGGCTCCGGGGG + Intronic
1096464800 12:51842394-51842416 CTGGAGCAAAGGGGCTCCCTGGG - Intergenic
1096609766 12:52793443-52793465 CTGGGACTGAGGGGTTTCCTGGG - Intronic
1096741319 12:53695918-53695940 CTGGATCTGGAGGGCACCCTTGG + Intergenic
1097572765 12:61355254-61355276 AGGGCTCTGGGGGGCTCCCAGGG - Intergenic
1101842795 12:108340177-108340199 CTGGCTCGGAGGCCCACCCTTGG + Intergenic
1102262830 12:111455233-111455255 CTGGCCTTGAGGCCCTCCCTGGG - Intronic
1102969504 12:117155316-117155338 CGGGCTCTCAGGTGCTCCCAGGG + Intronic
1103601254 12:122055993-122056015 CTAGCTCTAAGGGGCTGCTTAGG + Intronic
1103847342 12:123910706-123910728 CTGACTCTGAATGGGTCCCTTGG - Intronic
1103958496 12:124593058-124593080 CATCCTCTGAGGGGCTTCCTGGG - Intergenic
1103964801 12:124631969-124631991 CTGGAGCTAAGGGGCTGCCTGGG + Intergenic
1104813792 12:131634236-131634258 CTGCATGGGAGGGGCTCCCTGGG + Intergenic
1105545535 13:21348092-21348114 GTGGCTCTGAGGCGCTCCTGTGG + Intergenic
1105822916 13:24095995-24096017 CTGCCTCTGAGAGGCTGCCTGGG + Intronic
1106370672 13:29129754-29129776 CTGGTTCTCAGGGGCAGCCTTGG + Intronic
1107128764 13:36872679-36872701 CTGGCTCAGAAGGACTTCCTGGG + Exonic
1107332794 13:39319719-39319741 ATGGCTCTGAGGCTCTCCCAGGG + Intergenic
1107988404 13:45796089-45796111 CCAGCCCTCAGGGGCTCCCTCGG - Intronic
1108592765 13:51925571-51925593 CTGGAACTGAGGGGCTGTCTGGG - Intergenic
1110621441 13:77600177-77600199 CTTGCTCTGAGGCCCTACCTTGG + Intronic
1110706982 13:78608007-78608029 TTGGCACTGCGGAGCTCCCTCGG + Intergenic
1113453309 13:110428555-110428577 CCGGCTCTGAGGGGTTCACCGGG + Exonic
1113504861 13:110808596-110808618 CTTGATCTCAGGGGGTCCCTGGG + Intergenic
1114234427 14:20812219-20812241 CTGTCTCTGAGGAGGTTCCTTGG - Intergenic
1114645054 14:24250994-24251016 CTGGTTCTGAGGGGTTTCCCTGG + Intronic
1118473274 14:66094321-66094343 TGGGCTCTGAGGGACTCCCAGGG + Intergenic
1118947160 14:70398864-70398886 CTGGCGCTGAGGGGTGGCCTGGG + Intronic
1119182330 14:72613604-72613626 CTGGCTGTGAGGGGGTCCTGAGG - Intergenic
1119437288 14:74605708-74605730 CTGGCTCAGGGGGCCTCCTTGGG - Intronic
1120450836 14:84665416-84665438 CTCCCACTGAGGTGCTCCCTTGG + Intergenic
1121242747 14:92441783-92441805 CTAGCTCTGAGTGGATGCCTAGG + Intronic
1121569459 14:94936627-94936649 CAGCCTCGGAGGAGCTCCCTTGG - Intergenic
1122198986 14:100110627-100110649 CTGACCCTGGGGGTCTCCCTCGG + Intronic
1122239761 14:100355181-100355203 ATGGATCTGAGGTGCTCTCTGGG + Intronic
1122790100 14:104180672-104180694 CTCCCTCTGGGGGGCACCCTGGG + Intronic
1122843660 14:104478948-104478970 CTGGCTCTGGGGCACTTCCTGGG - Intronic
1122937046 14:104964707-104964729 CTGGATGTGACGGGCTCCCCCGG - Intronic
1123112508 14:105879971-105879993 CTGGCAGTGGGCGGCTCCCTGGG + Intergenic
1124214048 15:27791972-27791994 TGGGCTCTGATGGGCTCCCAAGG + Intronic
1125181672 15:36886353-36886375 CTGGCGCTGGTGGGCTTCCTTGG + Intergenic
1127669947 15:61185785-61185807 ATGGCTCTGAGGGTCTCCTCAGG + Intronic
1127961073 15:63891382-63891404 CTGCCTCTGGGTGGCTCCTTGGG - Intergenic
1127961085 15:63891435-63891457 CTGCCTCTGGGTGGCTCCTTGGG - Intergenic
1128525879 15:68411987-68412009 GTGGCTCTGCTGGGCTCACTGGG - Intronic
1128709094 15:69858479-69858501 CAGGCTCGGAGGGGCTCTCGAGG - Intergenic
1129296345 15:74602329-74602351 CTGCATCTGAGGGGCTCTTTGGG - Intronic
1129660376 15:77549781-77549803 CTGGGTCTGAGAGGATACCTTGG + Intergenic
1129677970 15:77642630-77642652 GGGGCTCTGAAGGGCTTCCTAGG - Intronic
1130815921 15:87432682-87432704 CAGGCTGTGAGGGGCTCCAGGGG + Intergenic
1132760576 16:1506851-1506873 GGGGCTGTGTGGGGCTCCCTCGG + Intronic
1132827255 16:1911577-1911599 CTGGGGCTGAGCGGCACCCTGGG - Exonic
1133099492 16:3470534-3470556 CTGGCTATGAGGGCCACGCTGGG - Intronic
1133144437 16:3773838-3773860 CTGGCTCTGAGCGGGCGCCTGGG + Exonic
1133316315 16:4886142-4886164 CTGGCACTGAGGGAGTCCCTTGG - Intronic
1134009165 16:10838526-10838548 CTGCTTCTGAGGGGCAGCCTGGG + Intergenic
1137476138 16:48811295-48811317 CGGGCTCTGGGGGACTCCCTGGG + Intergenic
1137499464 16:48999145-48999167 CTGGCTCTGTGGAGCCACCTGGG + Intergenic
1137618831 16:49862615-49862637 CTGCCTCTCTGGGGCTCTCTGGG + Intergenic
1137765395 16:50973875-50973897 TTGGCTCTGAGGGGCTGTCTGGG + Intergenic
1138537554 16:57668011-57668033 CTGGCTCAGAGCGGATCCCTGGG - Intergenic
1138554197 16:57762569-57762591 CTGGCCCTGTGGGGCCACCTGGG + Intronic
1138554432 16:57763507-57763529 CTGGCTCTGAGGGGTGCTGTGGG - Intronic
1139672906 16:68503946-68503968 CTGGGTCTCAGGGGTTTCCTGGG - Intergenic
1140124537 16:72108621-72108643 CAGGCTGGGAGGGGCTCACTGGG - Intronic
1140201294 16:72896998-72897020 CTGGCTCAGAGGGGCTGCTCTGG - Intronic
1140899577 16:79355431-79355453 GTGGCTCTGAGGTCCTCCCATGG + Intergenic
1141570891 16:84933036-84933058 CTGGCACTGAGGGGTTGTCTGGG - Intergenic
1141824943 16:86472308-86472330 CTGGCACTGAGCTGCACCCTAGG + Intergenic
1141924667 16:87160318-87160340 CCGGCTCTGAGCGGCTCCCGAGG - Intronic
1142135120 16:88448429-88448451 CTGGCTCTGGGATGCTGCCTGGG - Intergenic
1143536193 17:7541446-7541468 CTGGCTCTTGGTGCCTCCCTCGG - Intergenic
1143712683 17:8745085-8745107 CCTGCTCTTAGGGCCTCCCTGGG + Intronic
1144658944 17:17056081-17056103 CTGGCTGTGTGTGGCCCCCTTGG + Intronic
1144719941 17:17462271-17462293 CTGGGGCTGAGGGTGTCCCTGGG - Intergenic
1145786673 17:27598181-27598203 CTGACTCTGAGGAGCTGCCAGGG - Intronic
1146633452 17:34487096-34487118 CTGGCTCTGCGGGGGTCTCAGGG - Intergenic
1146716256 17:35089219-35089241 CTGGGGCTGAGGGGCACCCGGGG + Exonic
1147182577 17:38695927-38695949 GTGGGTCTGAGAGGCCCCCTTGG + Intergenic
1147427176 17:40351468-40351490 CTGGCTCTGAGCAGCTCCTGGGG - Intronic
1147771613 17:42872135-42872157 CTCCCTCTGAGGGGCTGCATGGG - Intergenic
1148444980 17:47732248-47732270 CATGCTCTGAAGGGCTGCCTCGG - Intergenic
1148644887 17:49214177-49214199 CAGGCCCTGAGGGGCACCCGAGG + Intronic
1148967168 17:51446009-51446031 CTGGCTCTGAGTGTCTTCTTTGG - Intergenic
1150641716 17:66953894-66953916 CTGGCTCTGTGATGCTCCCAGGG + Intergenic
1151536338 17:74740963-74740985 CTGGCTCCCAGGGACTCCCGAGG + Intronic
1152025705 17:77807609-77807631 TTGGCTCTGAGGGTCTGGCTTGG + Intergenic
1152236516 17:79141877-79141899 CTGGCTCTCCAGAGCTCCCTTGG - Intronic
1152327249 17:79648660-79648682 ATGGCTCTGAGGGGTGTCCTTGG - Intergenic
1152345465 17:79748273-79748295 CGGGCCCTGCGGGGCACCCTGGG + Intergenic
1154273268 18:12938038-12938060 CTAGCTCTGAGTGGGGCCCTTGG - Intergenic
1157521305 18:48347432-48347454 CTGCCTCTGGAGGGCTTCCTAGG - Intronic
1159731311 18:72032347-72032369 CTGGCTCTGGGTGGGTCCATAGG + Intergenic
1160407008 18:78652974-78652996 CCGGGACTGAGGGGCTCCCGGGG - Intergenic
1160407786 18:78655073-78655095 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407876 18:78655317-78655339 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160407901 18:78655388-78655410 CTGGGACTGAGGGGTTTCCTGGG - Intergenic
1160424884 18:78772957-78772979 CTGGCTCTGGGCGGCTGCCCAGG - Intergenic
1160434810 18:78841591-78841613 CTGGCTCCGTGGTGCTTCCTGGG + Intergenic
1160501370 18:79402507-79402529 CCAGCTCTGCGGGGCTCCCGGGG - Intronic
1160569931 18:79809380-79809402 CTCGCTCTGAGGAGCTGCCGGGG + Intergenic
1160898268 19:1413035-1413057 CTGCCTCTGAGGGGCCCGCTGGG - Intronic
1161366691 19:3883975-3883997 CTTGTTCTGAGGAGCTCACTGGG - Intronic
1161408051 19:4101402-4101424 CAGGCTGTGAGGAGCTCGCTGGG + Intronic
1161526949 19:4762054-4762076 GAGCCTCTGAGGGGCTCCCCTGG + Intergenic
1161741381 19:6022980-6023002 ATGTCTGTGAGGGGTTCCCTAGG + Intronic
1161992780 19:7694481-7694503 CTGGCTCTGAGGTTGTCTCTGGG - Intronic
1162207371 19:9065827-9065849 CAGGCCCTGATTGGCTCCCTGGG + Intergenic
1162320640 19:9969299-9969321 CTGGCTCTGAGGACCACTCTGGG - Intronic
1163379070 19:16952288-16952310 ATGGCTCAGAGAGGCACCCTAGG + Intronic
1165342606 19:35223668-35223690 CAGGCATTGGGGGGCTCCCTGGG + Intergenic
1165358501 19:35319012-35319034 CTGTCCCTGAGGGCCTCCCTGGG - Intergenic
1165798970 19:38536176-38536198 CTGGTTCCCAAGGGCTCCCTCGG + Intronic
1165844425 19:38809066-38809088 CCAGCTCTGAGGGGCAACCTTGG + Intronic
1165893481 19:39128299-39128321 CTGTCTCTGAGGCCCTCCCCAGG - Intronic
1166118341 19:40669410-40669432 CTGGCTCTAAGATGATCCCTGGG + Intronic
1166122035 19:40691936-40691958 CTGGGTCAGAGGAGCCCCCTTGG - Exonic
1166223972 19:41383667-41383689 CTGGGACTGAGGGGATGCCTGGG + Intronic
1166415628 19:42593194-42593216 CCTGACCTGAGGGGCTCCCTGGG - Intronic
1166745552 19:45140344-45140366 CTGGGTCTGAGGACCTGCCTGGG + Intronic
1167233340 19:48298577-48298599 CTGGCTCTGCTGGGGTCACTGGG - Intronic
1167350156 19:48969316-48969338 GTGGGGCTGAGGGGCTCGCTCGG + Exonic
924986015 2:270702-270724 ATGGCTCTGAGGAGCTTCCTGGG + Intronic
925349760 2:3192648-3192670 CCGGCTCTGAGGGCCCCACTAGG + Intronic
925798021 2:7567870-7567892 CCAGCTCTGAGGGGCTCCCTGGG + Intergenic
925911533 2:8576680-8576702 CTAGGTCTGAGGGCCTCTCTGGG - Intergenic
926622492 2:15059570-15059592 CTGGCTGTGTTGGGCTCCCAGGG - Intergenic
927091437 2:19715670-19715692 CTGGATTTGAGGAGCTCCCCGGG + Intergenic
927193892 2:20534723-20534745 CTGGGACTGAGGGGCTGCCCAGG + Intergenic
927502036 2:23589410-23589432 CTGGGCCTGTGGGGCACCCTTGG + Intronic
928833711 2:35518717-35518739 TTGGCTTTGACTGGCTCCCTTGG + Intergenic
929584146 2:43102844-43102866 CTGGCTGTTGGGGGCTGCCTAGG - Intergenic
929765088 2:44837614-44837636 TTGGGTCTGAGGGGCTGTCTGGG + Intergenic
931690941 2:64834402-64834424 CTGGGACTGAGGGACTTCCTGGG - Intergenic
932421593 2:71604503-71604525 CTGACTCTCATGGGCTCCCATGG - Intronic
933603736 2:84360074-84360096 CTGGCTCTGTGTTGCTCCCAGGG - Intergenic
933805414 2:85995533-85995555 CTGGCTCTCAGGGTCTCCAAAGG - Intergenic
933975598 2:87506913-87506935 CTGGCTCTGCTGGGCTCCTGAGG - Intergenic
934539129 2:95159794-95159816 CTGGCTCTGAAGGGCCCCGGCGG - Intronic
934736711 2:96693357-96693379 CTGACTCTGAGGGGGCCTCTGGG + Intergenic
935963340 2:108448805-108448827 CTGGTTCCGGGGGGCTCCTTAGG - Exonic
936318226 2:111443900-111443922 CTGGCTCTGCTGGGCTCCCAAGG + Intergenic
936470190 2:112791774-112791796 CTGCCTCTGTGGGCTTCCCTGGG - Intergenic
937098405 2:119250509-119250531 GAGGCTCTGCGGGGCTCCCTGGG + Intronic
937244856 2:120486085-120486107 CTGGCTCTCAGGGGGTCCTTAGG + Intergenic
938392474 2:130916426-130916448 CAGGCCCCGAGGGGCTCCCCAGG + Intronic
938828402 2:135029994-135030016 CTTGCTCAGAGGAGTTCCCTTGG - Intronic
939725549 2:145716691-145716713 CTGGGACGGAGGGGCTTCCTAGG + Intergenic
941844787 2:170121992-170122014 CAGGCTGTGAGGGGCCCTCTGGG - Intergenic
942451802 2:176112750-176112772 CTGGCTGTGCGGGGGCCCCTTGG + Intronic
944580248 2:201125917-201125939 CTGGGACTGAGGGGTTTCCTGGG + Intronic
945088682 2:206159186-206159208 CCGGCTCTCAGGGGCTTCCGAGG + Exonic
945294815 2:208160205-208160227 CTGACACTGAGGGGCTTTCTGGG + Intergenic
946250094 2:218406433-218406455 CTGGCTCTGCCGGGCGGCCTGGG + Intergenic
947546514 2:231014545-231014567 CTGGCTTTGAGGGGCATCCTGGG + Intronic
947805486 2:232964896-232964918 CGGGCCCTGAGGGGCCCTCTTGG + Intronic
948884417 2:240875656-240875678 CTGGGACTGAGGGGCTCCGCAGG + Intronic
948913427 2:241017999-241018021 CTGGAACTGAGGGGGTCCCCGGG - Intronic
1171369286 20:24650786-24650808 CTGGCTCCCAAGGGCTCCCAAGG + Intronic
1173416577 20:42862245-42862267 CTGGCTCACAAGGCCTCCCTTGG + Intronic
1174727190 20:52875335-52875357 CAGGTTCTGAGAGGCTGCCTTGG + Intergenic
1175237480 20:57524898-57524920 CAGACGCTGAGGGGCTGCCTGGG - Intronic
1175541057 20:59747906-59747928 CTGTTTCTGATGGGCTTCCTGGG - Intronic
1175725568 20:61316024-61316046 CAGGCACTGAGGGGCTCTCCAGG + Intronic
1175772039 20:61630046-61630068 CTGCCTCTGCCAGGCTCCCTGGG - Intronic
1175895687 20:62334669-62334691 CTGGCTGTGAGGGGCCCCTGAGG - Intronic
1175978109 20:62723708-62723730 CTGTGTCTGAGGAGGTCCCTGGG - Intronic
1176654335 21:9576381-9576403 CTGGCTCTGCTGGGAGCCCTGGG - Intergenic
1176990321 21:15488485-15488507 CTGGCTCTGAGTTGCTTACTAGG + Intergenic
1178943803 21:36929386-36929408 CTGGGTGTGATGGGCTCACTTGG - Intronic
1179359828 21:40695354-40695376 CTGGGACTGAGGGGTTTCCTAGG - Intronic
1179573479 21:42292054-42292076 CTGCCTCTGTGGGGTTCCCTCGG + Intronic
1180060613 21:45383151-45383173 TGGGCTGTGCGGGGCTCCCTTGG + Intergenic
1180088850 21:45523760-45523782 AGGGCCCTGAGGGTCTCCCTGGG + Intronic
1180126089 21:45791131-45791153 CTTGTTGTGAGGGGCTTCCTGGG - Intronic
1181039894 22:20187088-20187110 CTGGCCCTGCTGAGCTCCCTGGG + Intergenic
1181050616 22:20236685-20236707 GTGGCCTTGGGGGGCTCCCTTGG + Intergenic
1181116273 22:20634265-20634287 CTTTCTCTGTGAGGCTCCCTGGG + Intergenic
1182504022 22:30769113-30769135 TGGGCTCTGAGGGGGCCCCTCGG + Intronic
1182583099 22:31327045-31327067 CGGGCTCTCGGGGGCCCCCTGGG - Exonic
1183063146 22:35347565-35347587 TGGGCTCTGAAGGGCTCCTTGGG - Exonic
1183377943 22:37475920-37475942 CTGGCTGGGAGGGGCGCCCCAGG - Intronic
1183391803 22:37549636-37549658 TTTGCTCTGAGGTGGTCCCTTGG + Intergenic
1183451633 22:37899084-37899106 TTGGCTCTGAGCTGCTCCCTGGG - Intergenic
1183735552 22:39642973-39642995 CTGGCTCTGAGGGGCTCCCTAGG - Intronic
1184167053 22:42735845-42735867 CTGGGACTCAGGGGCTCCCGGGG - Intergenic
1184775475 22:46620850-46620872 CAGGTTCTGAGGGGCTTCCTGGG - Intronic
1185366577 22:50439602-50439624 CAACCTCTGAGGGGCTCCCGGGG + Intronic
950224845 3:11225102-11225124 TTGGCTTTGAAGGGGTCCCTTGG - Intronic
950419000 3:12885750-12885772 CTGGCCATGTGGGGCTCCCCAGG + Intergenic
950498293 3:13347576-13347598 GTGTCTCTGGGGGGCTCTCTGGG - Intronic
950583637 3:13878771-13878793 CTGGCGCTGAAGGGCCCGCTTGG - Intronic
950720784 3:14881241-14881263 CTGGTGGTGAGGGGCTCCTTTGG + Intronic
951855202 3:27188198-27188220 TTGGCTCTGAGATCCTCCCTAGG + Intronic
953105087 3:39869988-39870010 CTGGCTCTGGGGAGTTGCCTAGG + Intronic
953192330 3:40699652-40699674 CTGGGACTGAGGGGTTCCCTGGG - Intergenic
953557489 3:43958296-43958318 CTGGCAATGAGTGTCTCCCTGGG + Intergenic
953789572 3:45937065-45937087 CTGCCTCTGAGGAACTGCCTGGG - Intronic
953926536 3:46985531-46985553 CTGGGGGTGAGGGGCTCCCGAGG - Intronic
954111337 3:48435049-48435071 CTGGTTCGGAGGGGCCTCCTTGG - Exonic
954794577 3:53155021-53155043 CGGGCCCTGAGGGGCTGCCCTGG + Intergenic
954902993 3:54035741-54035763 CTGGATCTGGGGTGTTCCCTGGG + Intergenic
955037643 3:55284386-55284408 CTAGCCCTGATGGGGTCCCTGGG - Intergenic
961787164 3:129354113-129354135 CGTGCTCTGAGGGGCAGCCTGGG - Intergenic
962459066 3:135591975-135591997 GTGGGTCTGAGGCACTCCCTGGG - Intergenic
964038504 3:152229243-152229265 TTGGCTCTGAAGGGCTCTCATGG + Intergenic
964549704 3:157873059-157873081 CTGGCTGTGTGGGGCAGCCTTGG - Intergenic
965822731 3:172701004-172701026 GTGTCCCTGAGGGGCACCCTTGG + Intronic
967723748 3:192842275-192842297 CTGGCTCTGACGGGCAGCCGTGG - Intronic
967877710 3:194278004-194278026 TTGGCTCAGACAGGCTCCCTTGG + Intergenic
968144718 3:196288301-196288323 CTGGCTCCCAGTGGATCCCTAGG - Intronic
968607640 4:1543026-1543048 CCCCATCTGAGGGGCTCCCTGGG - Intergenic
968613169 4:1566217-1566239 GTGGCTCTGCGGGGCCCGCTTGG - Intergenic
968653922 4:1770608-1770630 CTGGCTCTGAGAGGGTGACTTGG + Intergenic
969429864 4:7147802-7147824 CTGGCTCTGCAGGGCTGTCTTGG + Intergenic
969622278 4:8284587-8284609 CTGGCCCTGTGAGGCACCCTGGG + Intronic
969700214 4:8763949-8763971 CAGCCTGTGCGGGGCTCCCTCGG - Intergenic
969829208 4:9781619-9781641 CTGGCACTGAGGCGCTGCCGCGG - Intronic
971325131 4:25637371-25637393 CTGGGTCTGAGGGGTTTCCTGGG - Intergenic
972071366 4:35021786-35021808 CTGGGTCAGAGGGACTCCTTCGG - Intergenic
974894835 4:67926701-67926723 CAGGCTCTGGGGGGCTCCCAGGG - Intronic
976375310 4:84339164-84339186 CTGGCTCTGAGCTGCTCCTAGGG - Intergenic
984119867 4:175728976-175728998 CTGGCTCTAAGTGGTTCCCCAGG + Intronic
985371409 4:189289228-189289250 CTGACTCTGAAGGGCCCCCGGGG + Intergenic
985520726 5:372956-372978 CTGGAGCAGAGTGGCTCCCTTGG - Intronic
985781966 5:1876348-1876370 CGGGCCCTGAGGGGGACCCTCGG - Intergenic
986717893 5:10537453-10537475 CTGGCTCTGAGGGCCTCACCAGG - Intergenic
987326623 5:16817566-16817588 CTGGCTCTGAAGCCCACCCTAGG - Intronic
987999429 5:25330461-25330483 CTGGCATTCAGGGGCTGCCTGGG - Intergenic
989279352 5:39622583-39622605 CGGGTTCTGGGGGGCTCCCAAGG + Intergenic
990349294 5:54899754-54899776 CTGGTTCTGAGGGGCCCCCTGGG + Intergenic
990761664 5:59136982-59137004 CTGGCACTGAGGGATTTCCTGGG - Intronic
991419887 5:66429994-66430016 CTGGCTCAGAGATACTCCCTGGG + Intergenic
992169851 5:74090691-74090713 GTGGCTCTGAGGGCCTGTCTTGG + Intergenic
992761456 5:79954250-79954272 CTGGCTCTGGAGGGCTGGCTGGG - Intergenic
994245644 5:97472170-97472192 CAGGCTCTGCGGGGCTCCCAAGG + Intergenic
997747304 5:136310488-136310510 CTGGCTCTGCCAGGCTCCCTGGG - Intronic
998080942 5:139274359-139274381 CAGGCTCTATGGGACTCCCTAGG - Intronic
999907864 5:156163348-156163370 ATGGCTCTGATGGGCTCCTACGG - Intronic
1001278250 5:170366556-170366578 CAGGCTCTCAGAAGCTCCCTTGG - Intronic
1001834951 5:174824100-174824122 CAGGCTCTGAGGGGCTCCTGAGG - Intergenic
1001913647 5:175541594-175541616 CTGGCTGAGGGGGGCTTCCTGGG - Intergenic
1001938813 5:175726951-175726973 CTGGGTCTGAGGGGGGTCCTGGG - Intergenic
1001940402 5:175736003-175736025 GGGGCTGTGAGGGGCACCCTGGG - Intergenic
1002095825 5:176830152-176830174 ACCGCTCTAAGGGGCTCCCTAGG + Intronic
1002202364 5:177537016-177537038 CTGTCTCTGAGGGTCTCTCTAGG + Intronic
1003328765 6:5112268-5112290 CTGCCTTTGAGGGGCTCTCAGGG - Intronic
1003406093 6:5828395-5828417 GTGGCTCTGAGGCGCTCCTGTGG - Intergenic
1004191340 6:13466468-13466490 CTGCCACTGACAGGCTCCCTCGG - Intronic
1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG + Intergenic
1006116079 6:31776850-31776872 CCGGCTCTGCGGGTCTCCATGGG + Intronic
1006455536 6:34129885-34129907 TTGGCTCAGAGGGGAGCCCTGGG - Intronic
1006473575 6:34241610-34241632 CTGGCGCTGTGGGGCACCCTAGG + Intronic
1007344994 6:41222747-41222769 CTGCCTCCCAGGGGCTCCCCAGG + Intergenic
1009428775 6:63543233-63543255 CTGGGACTGAGGGGTTTCCTGGG - Intronic
1010569978 6:77464154-77464176 ATGGCTCCGAGTGGCTCCCGTGG - Intergenic
1011055823 6:83202352-83202374 CTGGGACTGAGGGGTTTCCTGGG + Intergenic
1011254369 6:85405793-85405815 CTGCCTCTCAGAGGCACCCTGGG - Intergenic
1011557630 6:88586910-88586932 CTTTCCCTGAGTGGCTCCCTGGG - Intergenic
1012444931 6:99297615-99297637 CTGGCTCTGAGCCGCCCCCTTGG + Intronic
1013365443 6:109434194-109434216 CTGGGACTGAGGGGTTTCCTAGG - Intronic
1017607208 6:156147055-156147077 CTGGCTGCGGGGGGCTCCCATGG + Intergenic
1017981196 6:159402181-159402203 CTGGCTCTCCTGGGCTCCCGTGG + Intergenic
1018429800 6:163713760-163713782 CTGCCTGCGAGGGTCTCCCTGGG + Intergenic
1019541609 7:1554249-1554271 CTGTCACTGAGATGCTCCCTCGG + Intronic
1019595584 7:1856900-1856922 CTCGGTCTGAAGGCCTCCCTGGG - Intronic
1020085565 7:5308360-5308382 GTGGCTCCCTGGGGCTCCCTCGG - Intronic
1021477253 7:21076336-21076358 CAGGCTCTGCGGTGCTCTCTCGG - Intergenic
1022443715 7:30453194-30453216 CTGGCTCTGTGACGCTCCCCAGG - Intronic
1022445255 7:30465116-30465138 GTGGCTCTCAAGGGCTTCCTTGG + Intronic
1022472301 7:30689267-30689289 CTGGCTCTGCCCGGCTGCCTAGG + Exonic
1024301268 7:47889471-47889493 CGGGGCCTGTGGGGCTCCCTGGG + Intronic
1025208742 7:57008875-57008897 GTGGCTCCCTGGGGCTCCCTCGG + Intergenic
1025663203 7:63567994-63568016 GTGGCTCCCTGGGGCTCCCTCGG - Intergenic
1026441861 7:70451936-70451958 CTGGTTCTGAGGGGCTCTGTGGG + Intronic
1026916166 7:74121398-74121420 CTGGCTCTGAGGAGAAGCCTGGG - Exonic
1029080775 7:97972271-97972293 CTGGCTGTGGGAGGCTCCCGAGG - Intergenic
1032440776 7:131941442-131941464 CTGGCAATGAGAAGCTCCCTTGG + Intergenic
1034210574 7:149358888-149358910 CAGGCTCCGGGGGGCTCCCAGGG + Intergenic
1035076424 7:156180655-156180677 CTGCCTCTGCGGGGCTGCCCTGG - Intergenic
1035308808 7:157952171-157952193 GGGGCTCTGGGGGGCTCCCAGGG - Intronic
1035382466 7:158448565-158448587 CTCCCGCTGAGGGGCTCCCCTGG - Intronic
1035732401 8:1862242-1862264 CTGGCTCTGCAGGGCTTCCCCGG + Intronic
1037733784 8:21550617-21550639 CTGCCTCTGAGTGCCTTCCTGGG + Intergenic
1038019952 8:23544501-23544523 CTGCCACAGAGGGGCTCCCATGG - Intronic
1038268027 8:26050948-26050970 CTGGCTCTGAGGTTTTCCGTGGG - Intergenic
1039606352 8:38884046-38884068 CAGACCCTCAGGGGCTCCCTCGG + Intergenic
1043471395 8:80566400-80566422 CTACCTCTCAGGGGCTCCCCGGG + Intergenic
1044409387 8:91867528-91867550 CTGGCACTCAGGGGCAGCCTGGG - Intergenic
1048444629 8:134484147-134484169 CTGGCTCCTCGGGGCACCCTTGG - Intronic
1048469846 8:134696269-134696291 CTGGGACTCAGGGGCTGCCTTGG - Intronic
1049057327 8:140248427-140248449 CTGGCTGTGTGGGGATTCCTGGG + Intronic
1049438149 8:142597165-142597187 CAGGCCCTCAGGGGCTCTCTGGG - Intergenic
1051102396 9:13535922-13535944 CTGGCCCTGAGGAGCTCCCAGGG - Intergenic
1051889801 9:21930184-21930206 TTGGCTCTGATTAGCTCCCTTGG - Intronic
1057355182 9:94326179-94326201 CTGTCTCTGAGGGTCTCCCTCGG + Intronic
1057652570 9:96931455-96931477 CTGTCTCTGAGGGTCTCCCTCGG - Intronic
1057748287 9:97769959-97769981 TTGTCTCTGAGGGGCTACCCTGG - Intergenic
1058108652 9:101004520-101004542 CTGTCTCTGTGAGGCACCCTCGG - Intergenic
1059833979 9:118129330-118129352 ATGGCTCTCAGGGGCTCCAAAGG + Intergenic
1060424298 9:123491996-123492018 CTTGCTCTGAAGGAGTCCCTCGG - Intronic
1061038664 9:128127506-128127528 CTGGCCCTGGGGGGAGCCCTGGG - Exonic
1061359884 9:130134382-130134404 CTGGCTCTGAGGAGGCCCCATGG - Intronic
1061420304 9:130469942-130469964 CTGGCTCTGAGGGGCTGGGTGGG + Intronic
1061451063 9:130667177-130667199 CTGGCCTTGAGGGGCTTCCCAGG - Intronic
1062048712 9:134436391-134436413 CTGGCACTGGAGGCCTCCCTGGG - Intronic
1062282841 9:135759647-135759669 CTGGCAGTGAGGGGCGGCCTGGG - Intronic
1062437149 9:136551367-136551389 CAGGCTCTGCAGGGGTCCCTGGG - Intergenic
1062528660 9:136989868-136989890 ATGGCACTGAGGGCCTCCCTGGG + Intergenic
1203632056 Un_KI270750v1:79839-79861 CTGGCTCTGCTGGGAGCCCTGGG - Intergenic
1187847674 X:23557479-23557501 CTTGCTCTGAGGGGGTGTCTGGG + Intergenic
1189074410 X:37901161-37901183 CTGATTTTGAGGGGATCCCTTGG + Intronic
1189854830 X:45213985-45214007 CTGGGTGGGAGGGGTTCCCTTGG - Intergenic
1190053551 X:47169526-47169548 CTGGCTGGGATGGGCTCCCAAGG + Intronic
1190413070 X:50156204-50156226 CTGGCTCTGCTGGTCTGCCTGGG + Intergenic
1191033214 X:55997492-55997514 CTGGCCCTGAGTGGCTCCTAGGG - Intergenic
1194494424 X:94594338-94594360 CTCCCTCTGAGAGGTTCCCTTGG - Intergenic
1194872677 X:99152777-99152799 CTGGCCCTGAGTGGCTCCTGGGG + Intergenic
1195615997 X:106912234-106912256 CTGAATTTTAGGGGCTCCCTGGG - Intronic
1195736508 X:108018056-108018078 ATGGCTCTGGTGGCCTCCCTAGG + Intergenic
1196458434 X:115906087-115906109 CAGGCCCTGAGAGACTCCCTTGG - Intergenic
1197313136 X:124930771-124930793 ATTCCTCTGTGGGGCTCCCTTGG - Intronic
1198129386 X:133678531-133678553 CTGGGACTGAGGGGTTTCCTAGG + Intronic
1202197236 Y:22307997-22308019 TGGGCCCTGAGGGGCTCCCCGGG - Intergenic