ID: 1183735616

View in Genome Browser
Species Human (GRCh38)
Location 22:39643328-39643350
Sequence GAATTCCAGGGAGCTCCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183735616_1183735631 28 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735631 22:39643379-39643401 CCTGCCTTGTTGGGGTAACCTGG 0: 1
1: 0
2: 1
3: 11
4: 93
1183735616_1183735623 1 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735623 22:39643352-39643374 CAGAGGGACTCCCATCTCTTGGG 0: 1
1: 0
2: 1
3: 17
4: 183
1183735616_1183735626 18 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735626 22:39643369-39643391 CTTGGGCAGCCCTGCCTTGTTGG 0: 1
1: 0
2: 2
3: 43
4: 464
1183735616_1183735627 19 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735627 22:39643370-39643392 TTGGGCAGCCCTGCCTTGTTGGG 0: 1
1: 0
2: 0
3: 12
4: 180
1183735616_1183735622 0 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735622 22:39643351-39643373 TCAGAGGGACTCCCATCTCTTGG 0: 1
1: 0
2: 0
3: 17
4: 133
1183735616_1183735628 20 Left 1183735616 22:39643328-39643350 CCCGGTGGAGCTCCCTGGAATTC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1183735628 22:39643371-39643393 TGGGCAGCCCTGCCTTGTTGGGG 0: 1
1: 0
2: 0
3: 28
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183735616 Original CRISPR GAATTCCAGGGAGCTCCACC GGG (reversed) Intronic
900402630 1:2478815-2478837 GAGTCCCAGGGAGCTCTGCCAGG - Intronic
902165719 1:14569815-14569837 GAAATCCAGGATGCCCCACCAGG + Intergenic
904888721 1:33761859-33761881 GTCTTGCAGGGAGCTCCCCCAGG - Intronic
908874352 1:68653478-68653500 GAATGCCAGAGAGCTCCTCAGGG + Intergenic
920513684 1:206568603-206568625 GTCCTCCAGGGAGCTCCAGCTGG + Intronic
1063164887 10:3452380-3452402 GATTTACAGGGAGCTACAGCAGG + Intergenic
1065299736 10:24310620-24310642 GAACTCCATGGAACTCCACTGGG - Intronic
1065544972 10:26809799-26809821 ACCATCCAGGGAGCTCCACCAGG - Intronic
1070900251 10:80022336-80022358 GACTTCCAGGGAGAGCCGCCTGG + Intergenic
1070902004 10:80038206-80038228 GACTTCCAGGGAGAGCCGCCTGG + Intergenic
1072450549 10:95536353-95536375 GAATACCAGTGAGTTCCACCAGG + Intronic
1076305653 10:129464232-129464254 GAAATCCAGGGAGCTCCTTGAGG + Intergenic
1077669856 11:4147220-4147242 GAAGTCCAGGGAAACCCACCAGG + Intergenic
1083669221 11:64291239-64291261 CAATTCCAGGTGGCCCCACCGGG + Intergenic
1086133855 11:83427292-83427314 GAAGTCCAGGGAGCCCCAGTTGG - Intergenic
1089536098 11:119161558-119161580 GACTTCCAGTGGACTCCACCAGG - Exonic
1089564452 11:119363636-119363658 GACTTCCTCGGACCTCCACCCGG + Intronic
1090071307 11:123546862-123546884 GACTTCCAGGAAGCTGCACAGGG + Intronic
1090332867 11:125944931-125944953 GAATTCCAGGTGGCTCCTCCAGG - Intergenic
1090903770 11:131055815-131055837 GCCTTCCAGGGAGATGCACCTGG - Intergenic
1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG + Intronic
1100393087 12:94161060-94161082 TTATTCCAGGGAGCTCTAACTGG - Intronic
1103702216 12:122853780-122853802 GGCTTCCAGAGACCTCCACCTGG - Intronic
1104807608 12:131599446-131599468 GAATCACAGGGAGCTCGAGCTGG + Intergenic
1109152046 13:58858818-58858840 GACTAGCAGGCAGCTCCACCTGG - Intergenic
1109713377 13:66187827-66187849 GAATTCCAGTGGGCTCCAGTGGG - Intergenic
1110081457 13:71319162-71319184 GAATTCCAGGGAATTTCCCCTGG - Intergenic
1113459677 13:110473048-110473070 GAAGTCCTGGGAGCTCAGCCCGG + Exonic
1118916098 14:70107746-70107768 GGATTGCAGGGAGCTCCTGCTGG - Intronic
1120828424 14:88975999-88976021 AAATTCTAGGCAGCTCAACCAGG - Intergenic
1121251706 14:92504672-92504694 GAATTCCAAGTAGCTCAAACCGG + Intergenic
1123937211 15:25199791-25199813 GAATGCCAGGGTGCCCCGCCTGG - Intergenic
1129823016 15:78617433-78617455 GAAGTCCAGGAGTCTCCACCTGG - Intronic
1130894267 15:88158296-88158318 GAATTCAAGGGGTCACCACCTGG - Intronic
1132371178 15:101300444-101300466 TAATTCCAGAGAGGACCACCAGG + Intronic
1133262352 16:4559178-4559200 GACTCCCAGGGAGATCCAGCTGG - Intronic
1134683847 16:16145304-16145326 CAGTCCCAGAGAGCTCCACCTGG + Intergenic
1136619160 16:31416519-31416541 GAGCTCCAGGGAGCTCCCCACGG - Exonic
1137609179 16:49807685-49807707 GGACCCCAGGCAGCTCCACCTGG + Intronic
1139697858 16:68687891-68687913 GAATTTCAAAGACCTCCACCAGG - Intronic
1139697903 16:68688180-68688202 GAATTCCAAAGACCTCCACCAGG + Intronic
1139921748 16:70464924-70464946 GGATCCCAGGGCCCTCCACCTGG - Intronic
1141295309 16:82762687-82762709 GCATTCCAGGGAACCCCTCCAGG - Intronic
1144347471 17:14362469-14362491 AATTTCCAGGGAGCTGAACCAGG + Intergenic
1144353088 17:14417563-14417585 GAGGTTCAGAGAGCTCCACCTGG + Intergenic
1144439085 17:15265305-15265327 CAGTTACAGGGAGCACCACCAGG - Intronic
1147356984 17:39905949-39905971 GATTTCCGGGGAGCTACACATGG - Exonic
1148194652 17:45704648-45704670 GAGTTCCAGTGGGCTCCAGCGGG + Intergenic
1149923811 17:60682657-60682679 AAATTACAGGGTGCACCACCAGG + Intronic
1150293298 17:63993797-63993819 GATTTCCTGGGAGCTGCATCAGG + Intergenic
1157526557 18:48387296-48387318 GCATTCCAGGAAGCCCCACTGGG + Intronic
1158627563 18:59084820-59084842 GAATGCCAGAGACCTCCACACGG - Intergenic
1161236007 19:3198630-3198652 GAGCCCCAGGGAGCTCCTCCAGG - Intronic
1164415206 19:28041357-28041379 GATTAGCAGAGAGCTCCACCAGG - Intergenic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168562971 19:57398581-57398603 GAATTCCATTGTGCTCAACCAGG - Exonic
933044568 2:77519232-77519254 GAAGTTAAAGGAGCTCCACCTGG - Exonic
938708960 2:133958775-133958797 GAATTCCAGGTGACTCAACCTGG - Intergenic
938803725 2:134787074-134787096 GAGTTCCAGGGAGGTCTGCCAGG - Intergenic
939232476 2:139447619-139447641 GAATTCCAGTGGGCTCTGCCTGG + Intergenic
946862596 2:224014400-224014422 AAATTCCAGGGAGAACCACTAGG + Intronic
947668009 2:231919159-231919181 GGACTCCAGCGAGCCCCACCTGG + Intergenic
947992477 2:234497682-234497704 GGGTTCCAGGGGGCTGCACCCGG + Intergenic
948082098 2:235214775-235214797 GAATTAGAGGGACCCCCACCTGG - Intergenic
948599481 2:239100186-239100208 GAATTCCAGACACCTCCTCCTGG + Intronic
1171414186 20:24966412-24966434 GAATGCCAGGTGTCTCCACCTGG - Intronic
1176350726 21:5794001-5794023 CATTTCCAGGGTGATCCACCAGG - Intergenic
1176357540 21:5914585-5914607 CATTTCCAGGGTGATCCACCAGG - Intergenic
1176545047 21:8192071-8192093 CATTTCCAGGGTGATCCACCAGG - Intergenic
1176563998 21:8375116-8375138 CATTTCCAGGGTGATCCACCAGG - Intergenic
1176709132 21:10134914-10134936 GAATTCCACCCAGATCCACCTGG - Intergenic
1177449745 21:21250578-21250600 GATTTGCAGGGGTCTCCACCTGG - Intronic
1182851393 22:33477632-33477654 AAATGCCAGTGAGCTCCGCCAGG + Intronic
1183217322 22:36489470-36489492 TAATTCCAGGGACCCCCAGCTGG - Exonic
1183364791 22:37401121-37401143 GAAGACCAGGCAGCCCCACCTGG - Intronic
1183735616 22:39643328-39643350 GAATTCCAGGGAGCTCCACCGGG - Intronic
1184419177 22:44369621-44369643 GGATTGCAGGCAGCTACACCAGG - Intergenic
1184483864 22:44764693-44764715 GAATTCCAGAGAGTGGCACCAGG - Intronic
1203249917 22_KI270733v1_random:108309-108331 CATTTCCAGGGTGATCCACCAGG - Intergenic
949444513 3:4119496-4119518 GAATTCCAGGCAGTTGGACCAGG - Intronic
952872731 3:37916169-37916191 GAAATCCAGAGAGGTCCGCCTGG - Intronic
955407953 3:58637369-58637391 GGGCTACAGGGAGCTCCACCTGG - Intronic
955870715 3:63435620-63435642 GAATTCCATGGAGATGCTCCAGG - Intronic
956308498 3:67852898-67852920 GATTTACAGGGAGCTCCTCTAGG - Intergenic
961005038 3:123399129-123399151 GCATTGCAGAGAGCTCCACTGGG - Intronic
961635470 3:128330181-128330203 GCCTACCAGGGAGCTTCACCAGG - Intronic
961658577 3:128456588-128456610 GCCTTCCAGGGAGCCCTACCCGG - Intergenic
961746652 3:129068268-129068290 GACTGGCAGGCAGCTCCACCTGG - Intergenic
962050003 3:131803157-131803179 GAATTCCAAGGTTATCCACCTGG - Intronic
967211199 3:187171059-187171081 GATTACCAGTGTGCTCCACCAGG + Intronic
969116384 4:4872959-4872981 GAAATCCAGGGCTCTCCTCCTGG - Intergenic
969709890 4:8836705-8836727 GAATTCCAGGGCGCTCCTCAAGG + Intergenic
972780729 4:42284992-42285014 GGATTACAGGCAGCACCACCAGG + Intergenic
979550840 4:121989118-121989140 GAATTTCAGAGAGCTCCACTGGG + Intergenic
979562669 4:122118022-122118044 GTATTCCAGAGCTCTCCACCAGG + Intergenic
983513502 4:168633137-168633159 GCATTCCATTGAGCTCCACTTGG - Intronic
986232963 5:5883799-5883821 GGAGACCAGGGAGCTCCCCCTGG - Intergenic
988942635 5:36161520-36161542 GAATTACAGGTAGCTCCAAATGG + Intronic
990514183 5:56516839-56516861 GAAGTCCAGGGAGCCCCGACAGG + Intronic
992336716 5:75777914-75777936 GCGTTCCTGGGAGCTCCACCCGG + Intergenic
996396233 5:123016832-123016854 GAAGCTCAGGGAGCTCCACGTGG + Intronic
996433346 5:123405319-123405341 TACCTCCAGGGAGCTCTACCAGG + Intronic
999258397 5:150222612-150222634 GAATTCCAGCAAAATCCACCTGG + Intronic
1002888668 6:1316674-1316696 GAATTCCGCGGAGCCGCACCTGG + Intergenic
1003081983 6:3028100-3028122 GACTGGCAGGCAGCTCCACCTGG + Intergenic
1004906868 6:20244731-20244753 GACTGGCAGGCAGCTCCACCTGG - Intergenic
1011186803 6:84686181-84686203 CAATTCCAGGCATTTCCACCAGG - Intergenic
1015909523 6:138155164-138155186 GAATTTGTGGGAGCTACACCTGG - Intergenic
1018751859 6:166813319-166813341 TGCTTCCAGGGAGCTCCACATGG - Intronic
1020029933 7:4925548-4925570 GAATTCCAGGAAGCTCCGCTGGG + Intronic
1021789626 7:24191633-24191655 GAATTCCAGGGATCTACACAGGG - Intergenic
1022527109 7:31045274-31045296 ACATTCCAGGGAGCTCCTCAGGG + Intergenic
1023725105 7:43135264-43135286 GCATTCTCAGGAGCTCCACCTGG - Intronic
1028759589 7:94480589-94480611 GGATACCAGGGAGCTGTACCAGG - Intergenic
1029601456 7:101565869-101565891 GGATCCCAGGGAGGACCACCGGG + Intergenic
1030093950 7:105881254-105881276 CAGTTCCAGGGAGCACCAACTGG - Intronic
1038563496 8:28600442-28600464 GAGTTCCAGGGAGTTCCATCAGG + Intergenic
1039013271 8:33118856-33118878 GCATTTCAGTGACCTCCACCCGG + Intergenic
1039203730 8:35125577-35125599 AAATTCCAGGGAGCTAAAACAGG - Intergenic
1039568795 8:38570111-38570133 GAATGGCAAGGAGCTCCTCCTGG - Intergenic
1047410995 8:124624571-124624593 GAAGCCCAGGTACCTCCACCTGG + Intronic
1048636368 8:136300329-136300351 GGAGTGCAGGGAGCTCCAGCAGG - Intergenic
1049266411 8:141670213-141670235 GCATTTCTGAGAGCTCCACCGGG - Intergenic
1050913225 9:11100817-11100839 GAATTCCTGGTGGCTCCACCCGG + Intergenic
1057313219 9:93954422-93954444 GAGTCCCCGGGAGCTCCAGCGGG - Intronic
1060399334 9:123339031-123339053 GAGTTCCAGCAAGCTCCACCTGG - Intergenic
1060998372 9:127887661-127887683 GAGTTCCAGGGAACTCCACGTGG - Intronic
1062368599 9:136224457-136224479 GCAGGCCAGGCAGCTCCACCGGG + Intronic
1202793892 9_KI270719v1_random:103884-103906 GAATTCCACCCAGATCCACCTGG - Intergenic
1203466313 Un_GL000220v1:91570-91592 CATTTCCAGGGTGATCCACCAGG - Intergenic
1186965928 X:14786054-14786076 GAGCTCCAGAGTGCTCCACCTGG - Intergenic
1199720657 X:150540902-150540924 GAATGCCAGGGGTCTCCAGCTGG - Intergenic