ID: 1183736391

View in Genome Browser
Species Human (GRCh38)
Location 22:39647059-39647081
Sequence GGCCCAGCGCAGGCTCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 352}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183736391_1183736403 16 Left 1183736391 22:39647059-39647081 CCTGTCAGAGCCTGCGCTGGGCC 0: 1
1: 0
2: 5
3: 82
4: 352
Right 1183736403 22:39647098-39647120 GAACTCAGCCTTTGCCCTGGAGG 0: 1
1: 0
2: 1
3: 24
4: 204
1183736391_1183736398 -7 Left 1183736391 22:39647059-39647081 CCTGTCAGAGCCTGCGCTGGGCC 0: 1
1: 0
2: 5
3: 82
4: 352
Right 1183736398 22:39647075-39647097 CTGGGCCGGGCCTGGGGCTGAGG 0: 1
1: 2
2: 57
3: 313
4: 1880
1183736391_1183736399 -6 Left 1183736391 22:39647059-39647081 CCTGTCAGAGCCTGCGCTGGGCC 0: 1
1: 0
2: 5
3: 82
4: 352
Right 1183736399 22:39647076-39647098 TGGGCCGGGCCTGGGGCTGAGGG 0: 1
1: 0
2: 10
3: 95
4: 772
1183736391_1183736402 13 Left 1183736391 22:39647059-39647081 CCTGTCAGAGCCTGCGCTGGGCC 0: 1
1: 0
2: 5
3: 82
4: 352
Right 1183736402 22:39647095-39647117 AGGGAACTCAGCCTTTGCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183736391 Original CRISPR GGCCCAGCGCAGGCTCTGAC AGG (reversed) Intronic
900409350 1:2505841-2505863 GGCCTGGCGCAGGCTCCGACGGG - Intergenic
900580685 1:3407219-3407241 GGCACAGCCCAGGTGCTGACAGG - Intronic
900927681 1:5716420-5716442 AGCCCAAGGCAGGCTCTGCCAGG - Intergenic
900963914 1:5944380-5944402 GGCCCAGGGCGGGCTGTGGCAGG - Intronic
901078383 1:6569778-6569800 GGCCCAGCGCTGGGTCTTTCGGG + Intronic
901629789 1:10642534-10642556 GGCCCAGCGCCGGTCCTGCCCGG - Intronic
901768661 1:11519543-11519565 GACCCAGCGCTGCCTCTGCCAGG + Intronic
901797778 1:11690839-11690861 GCCCCAGCGCTGGCTTTGTCCGG + Intronic
901988358 1:13092895-13092917 GGCCCAGTGCAGGGTCTGCTAGG + Intergenic
901993454 1:13133872-13133894 GGCCCAGTGCAGGGTCTGCTAGG - Intergenic
902245847 1:15119928-15119950 GGCCCAGCAGAGGATCTGCCTGG - Intergenic
903602767 1:24554584-24554606 GGGCCAGAGCAGGCTCCCACTGG + Intergenic
904298414 1:29538790-29538812 GTCCCAGGGAGGGCTCTGACTGG - Intergenic
905028386 1:34866079-34866101 GGCCCAGACCAGGCTGTGACCGG - Exonic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905819667 1:40979786-40979808 GGCCCAGCTCTGTCGCTGACGGG + Exonic
905860991 1:41351268-41351290 GGCCCAGTGCAGGACCTGAATGG - Intergenic
906239842 1:44236063-44236085 GCCCCAGTGGAGGCACTGACTGG + Intronic
906320790 1:44813970-44813992 GGCCCAGCCCAAGCCCTGCCCGG - Exonic
906725879 1:48043928-48043950 GGCCCAGCTGGGGCTCTGCCTGG + Intergenic
909957587 1:81799998-81800020 GGTCCATCGTAGGCTCTGCCTGG + Intronic
912006171 1:104903869-104903891 GGCCCAGTGGAGACTCTGACTGG + Intergenic
913078949 1:115364210-115364232 GGCCCAGCTGTGGCTCTGAAGGG - Intergenic
916549885 1:165839992-165840014 GGCCCACTGCAGCCTCTGCCGGG + Intronic
917494502 1:175527933-175527955 GGCCCAGTGCAGGCACAGGCAGG + Intronic
920851489 1:209631026-209631048 TGCCAAGCGCTGCCTCTGACTGG - Intronic
924953519 1:248906646-248906668 GGACCAGGGCAGGCTCGGGCGGG + Intronic
1063958672 10:11288139-11288161 GGAGAAGCGCAGGCTCTGCCAGG + Intronic
1065559342 10:26946425-26946447 AGCCCTGCGCAGGCCCTGCCTGG + Intergenic
1067720802 10:48726343-48726365 GGCCCAGCACAGTGTCTGATTGG - Intronic
1069629246 10:69887908-69887930 GGCCTAAGGCAGGTTCTGACAGG + Intronic
1073330956 10:102669557-102669579 GGCCCAGGGAAGGGTCTGGCTGG + Intergenic
1076626857 10:131826400-131826422 GGCCCAGCACAGGCTGGGGCCGG - Intergenic
1077250089 11:1557093-1557115 GGCCCAGCGCGGCCCCCGACGGG + Exonic
1077318102 11:1928213-1928235 GGCCCAGAGCAGGGACTGAAGGG + Intronic
1077917623 11:6621700-6621722 TGCCCAGGGCAGGCTCAGAGTGG + Exonic
1078143408 11:8707530-8707552 GGCCCAGGGTGGGCTGTGACAGG + Intronic
1079332119 11:19542131-19542153 GGCCCAGCACAGCCACAGACGGG + Intronic
1079346677 11:19658657-19658679 ATCCCCGTGCAGGCTCTGACTGG + Intronic
1079375197 11:19886317-19886339 GACCCAGGTCAGGCTCTGCCTGG + Intronic
1083033606 11:59615908-59615930 GTCCCACCCCAGGCTCTCACTGG - Exonic
1083325584 11:61871414-61871436 GAGCCAGCGCAGGCTCCGAATGG - Intergenic
1083684520 11:64368500-64368522 GGCCCAGCGCAGGCTCCCGCAGG - Exonic
1083723034 11:64612768-64612790 GGCCCTGCCCAGGCTGTGAGGGG + Intronic
1083749132 11:64751711-64751733 GTCCCAGCCCAGCCTCTGTCAGG - Intronic
1083811154 11:65107738-65107760 GGCCCACTGCAGGCCCTGCCCGG - Intronic
1084310410 11:68313109-68313131 GGCCCAGCGCGGGCTCGGCTCGG - Intronic
1084666798 11:70580721-70580743 GCCCCAGCCCTGGCTCTGGCTGG - Intronic
1084692342 11:70734642-70734664 GGGCCAGGGCAGCCTCTGGCTGG - Intronic
1084972176 11:72777917-72777939 GGCCCAGAGCAGGCTGAGGCAGG + Intronic
1090047796 11:123351287-123351309 GGCCTACCGCAGGCTCTGAAAGG - Intergenic
1091855106 12:3733075-3733097 TGCCCAGTGGAGGCTCTGGCTGG + Exonic
1094819248 12:34211704-34211726 GGCCCAGCGCAGGCGCTGCCGGG + Intergenic
1094829754 12:34294704-34294726 GGCCCTGCGCAGGTTCTGCTGGG + Intergenic
1095096885 12:38153789-38153811 GGCCCGGCGCAGGGACTGCCAGG - Intergenic
1095097635 12:38156815-38156837 GGCCCAGCGCAGGGGCTGTCGGG - Intergenic
1095097997 12:38158223-38158245 GGCCCAGCGCAGGGACTGCCAGG - Intergenic
1095098050 12:38158429-38158451 GGCCCAGCGAAGGGGCTGCCAGG - Intergenic
1100611155 12:96193391-96193413 GGCTCAGGCCAGGCTCTGATGGG - Intergenic
1104799779 12:131546774-131546796 ATCCCAGGGAAGGCTCTGACTGG - Intergenic
1105858182 13:24389428-24389450 GGGTCAGGGCAGGCTCTGGCAGG - Intergenic
1106107756 13:26748757-26748779 GGCCCCGGACAAGCTCTGACCGG - Intergenic
1113850321 13:113414055-113414077 AGCCCAGCACAGCCACTGACTGG - Intergenic
1114074955 14:19157034-19157056 GGCCCAGCGAAGGGGCTGATGGG - Intergenic
1114075016 14:19157257-19157279 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1114075067 14:19157454-19157476 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1114075116 14:19157704-19157726 GGCCCAGCGCAGGGGTTGATGGG - Intergenic
1114075322 14:19158529-19158551 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1114075428 14:19158951-19158973 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1114086841 14:19241029-19241051 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1114086948 14:19241454-19241476 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1114087153 14:19242278-19242300 GGCCCAGCGCAGGGGTTGATGGG + Intergenic
1114087202 14:19242523-19242545 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1114087252 14:19242719-19242741 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1114087312 14:19242944-19242966 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1114559089 14:23578101-23578123 GGCCCAGGGGAGGCTCTGCAGGG + Intronic
1118723322 14:68609267-68609289 GGCCCAGCACAGGCTGAGTCTGG + Intronic
1118786063 14:69046180-69046202 GGCCAAGCCCAGCCTCTCACTGG + Intergenic
1119663251 14:76466080-76466102 CGCCCACCTCAGACTCTGACGGG + Intronic
1121277863 14:92679849-92679871 GGCCCAGTTCTGCCTCTGACTGG + Intronic
1121931941 14:97980066-97980088 GGTCCTGATCAGGCTCTGACAGG + Intergenic
1122666603 14:103334391-103334413 CGCCCAGCTCCGGCGCTGACGGG + Exonic
1122691407 14:103533612-103533634 GCCCCAGGGGAGGCTCTGCCGGG - Intronic
1123109901 14:105861490-105861512 GGCCTAGCGGAGGCTCTGGGAGG - Intergenic
1202898371 14_GL000194v1_random:22623-22645 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1202898419 14_GL000194v1_random:22821-22843 AGCCCAGCGCAGGGGCTGATGGG + Intergenic
1202898475 14_GL000194v1_random:23038-23060 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1202898529 14_GL000194v1_random:23230-23252 GGCCCAGCGCAGGGGCTCATCGG + Intergenic
1202898683 14_GL000194v1_random:23838-23860 AGCCCAGCACAGGCGCTGATGGG + Intergenic
1202898778 14_GL000194v1_random:24221-24243 GGCCCAGCACAGGGTCTGATGGG + Intergenic
1202899025 14_GL000194v1_random:25251-25273 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1202899216 14_GL000194v1_random:26032-26054 GGCCCAGCGCAAGAGCTGATGGG + Intergenic
1202899269 14_GL000194v1_random:26249-26271 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1202899324 14_GL000194v1_random:26479-26501 GGCCCAGCACAGGGGCTGATGGG + Intergenic
1202899470 14_GL000194v1_random:27115-27137 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1202899635 14_GL000194v1_random:27753-27775 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1123477431 15:20599420-20599442 GACCCAGGGCTGTCTCTGACAGG - Intergenic
1123640585 15:22400962-22400984 GACCCAGGGCTGTCTCTGACAGG + Intergenic
1130546059 15:84858165-84858187 TTCCCAGGGGAGGCTCTGACAGG + Exonic
1131512435 15:93056694-93056716 GGGCCAGCACAGGCCCTGAAGGG + Intronic
1132471327 16:105127-105149 GGCCCAGCCCAGTCTGTGACAGG + Intronic
1132482307 16:172740-172762 GGCCCCGCGCAGGCCCCGCCCGG + Intergenic
1132483155 16:176544-176566 GGCCCCGCGCAGGCCCCGCCCGG + Intergenic
1132805703 16:1774141-1774163 AGCCAAGCCCAGGCCCTGACAGG - Intronic
1135179137 16:20257702-20257724 GACCAAGCTCAGGCTCTGCCTGG - Intergenic
1136175637 16:28514495-28514517 GGCCCTGCCCAGGGTCTGAGAGG + Intergenic
1138675164 16:58646069-58646091 GGACCACAGCAGGCCCTGACTGG + Intergenic
1139465300 16:67150911-67150933 GGCTCAGCGCAGGGTCCGAGGGG + Exonic
1139573952 16:67829736-67829758 GGCCCAGTGCAGGGAGTGACTGG - Intronic
1139650466 16:68359660-68359682 GGCCCAGGGCCGGCTTTGCCTGG - Exonic
1139805982 16:69565926-69565948 GGCACAGCGCAGGCGCGGAGGGG - Intronic
1139954761 16:70687820-70687842 GGCCCAGCCCTGGTCCTGACAGG + Exonic
1142002743 16:87672615-87672637 GGGCCAGTGAAGGCTCTGATTGG + Intronic
1142428954 16:90016135-90016157 GCCCCAGAGCAGGCTGGGACTGG + Intronic
1143034461 17:3986431-3986453 GGCCCAGAGCCGGCTCTGGCAGG - Intergenic
1143317895 17:6046590-6046612 GGCCCAGAGGTGGCTCTGGCTGG - Intronic
1143370223 17:6434879-6434901 GGCCCAGCGCTGGGGCTGCCTGG + Intronic
1144563753 17:16343265-16343287 AGCCCAGAGCAATCTCTGACTGG + Intronic
1145270637 17:21402906-21402928 GGCCCAGCTCTGGCTCAGACTGG + Intronic
1145308842 17:21690296-21690318 GGCCCAGCTCTGGCTCAGACTGG + Intergenic
1146003894 17:29148932-29148954 GGCCCCGCCCAGGCTCCGGCTGG - Intronic
1147720524 17:42536809-42536831 GGGCCAGCCGAGGCTCTGAAAGG - Intronic
1147942910 17:44062513-44062535 GGGACAGCACAGGCTATGACAGG + Intronic
1148092148 17:45029176-45029198 GGCCCAGTGCAGGAGCTGAGAGG + Intronic
1148262368 17:46194091-46194113 GGCCCGGCGCGGGCCCTGGCTGG - Intronic
1148936349 17:51166779-51166801 GCCCGGGCGCAGGCTCTGGCGGG - Exonic
1149598963 17:57881046-57881068 GGCCCAGCCCAGGCTTATACAGG - Intronic
1149623927 17:58066330-58066352 GGCCCAGCGCTAGCACAGACAGG + Intergenic
1151448190 17:74180941-74180963 GGCCCACCAAAGGCACTGACAGG - Intergenic
1152032493 17:77853050-77853072 GGCCCAGGCCAGGTGCTGACTGG + Intergenic
1152295648 17:79465700-79465722 GGTCCAGGGCAGGCCCCGACGGG - Intronic
1152518044 17:80837515-80837537 GTCCCTGCGCAGGCTCTGATGGG - Intronic
1203162551 17_GL000205v2_random:64300-64322 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1203162603 17_GL000205v2_random:64523-64545 GGCCCAGTGCAGGGACTGATGGG + Intergenic
1154085628 18:11302949-11302971 GGCCCAGCACAGGGGCTGCCCGG + Intergenic
1154121962 18:11659353-11659375 GGCTCAACGCATGCTCTGATGGG + Intergenic
1158498860 18:57982345-57982367 GACCCAGGGCAGGCTCTGGCAGG - Intergenic
1160589396 18:79934595-79934617 GGCCCAGCACTGGCAATGACAGG + Intronic
1160920345 19:1516613-1516635 GTCCCAGGGCAGGCTCTCATTGG - Intergenic
1161012813 19:1968418-1968440 GTCTCAGCGCAGGCCCCGACGGG - Intronic
1162039322 19:7960273-7960295 GGCCAAGCGCAGACTCTCAGAGG + Exonic
1162144553 19:8605678-8605700 GGCCCAGCGGAGGATCTGGCAGG + Exonic
1162357279 19:10194275-10194297 AGCCCAGCCCAGGCCCCGACGGG + Intronic
1162395841 19:10417739-10417761 GGCCCAGCCCAGGCCAGGACCGG - Intronic
1162427303 19:10604019-10604041 AGCCCAGCAAAGGCTCTGTCTGG - Intronic
1162494194 19:11014000-11014022 GCCCCAGGGCCGGCTCTTACTGG + Intronic
1163612928 19:18310360-18310382 CACCCAGCGCAGGCCCTGTCAGG - Intronic
1167024206 19:46903046-46903068 GGCAAAGCTAAGGCTCTGACAGG + Intergenic
1167306723 19:48714019-48714041 AGCCCAGCGCAGCATCTCACAGG - Exonic
1167590408 19:50401777-50401799 GGCCCAGCGCAGCCTGTGCCTGG + Exonic
1202647718 1_KI270706v1_random:157460-157482 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1202647820 1_KI270706v1_random:157876-157898 GGCCCAGCGAAGGGGCTGATGGG - Intergenic
1202647931 1_KI270706v1_random:158303-158325 GGCCCAGTGCAGGGGCTGATGGG - Intergenic
1202647982 1_KI270706v1_random:158520-158542 GGCCCAGCTCAGGGACTGATGGG - Intergenic
1202648081 1_KI270706v1_random:159006-159028 GGGCTAGCGCAGGGGCTGACAGG - Intergenic
1202648130 1_KI270706v1_random:159195-159217 GGCCTAGCGCAGGCGCTGATGGG - Intergenic
1202648181 1_KI270706v1_random:159418-159440 GGCCCAGCGCAGGGACTGATGGG - Intergenic
1202648230 1_KI270706v1_random:159631-159653 GGCCCAGCGCAAGTGCTGATGGG - Intergenic
925750303 2:7083883-7083905 GCCCCAGCGCAGGCCCTTGCGGG - Intergenic
926541064 2:14182423-14182445 GGCCTGGGGCAGGTTCTGACCGG - Intergenic
927492181 2:23527892-23527914 GGAGCAGCCCAGGCTCTGCCAGG + Intronic
929086855 2:38176527-38176549 TGGCCAGAGCAGGCTCTGAGAGG + Intergenic
932456053 2:71850730-71850752 GGCCCATGGCAGGCTTGGACTGG + Intergenic
934522884 2:95030963-95030985 GGCCCAGTCCCGGCTCTGTCGGG - Intronic
936151942 2:110026799-110026821 GGCTCAGCACAGGCTCAGCCCGG - Intergenic
936278659 2:111120542-111120564 GGGCCAGCGGAGGCTGTGACCGG + Intronic
937872672 2:126797419-126797441 GGCCCCGCTGAGGCTCTCACTGG + Intergenic
938489279 2:131753584-131753606 GGCCCAGCGCAGGGGCTGATGGG - Intronic
938489337 2:131753800-131753822 GGCCCAGCGCAGGGGCTGATGGG - Intronic
938489394 2:131753995-131754017 GGCCAAGCGCAGGGCCTGATGGG - Intronic
938489438 2:131754186-131754208 GGCCCAGCGCAAGGGCTGATGGG - Intronic
938489547 2:131754598-131754620 GGCCCAGCGCAGGGGCTGATGGG - Intronic
938489714 2:131755238-131755260 GGCCCAGTGCAGGGGCTGATGGG - Intronic
938489773 2:131755437-131755459 GGCCCAGTGCAGGGGCTGATGGG - Intronic
938489826 2:131755636-131755658 GGCCCAGTGCAGGGGCTGATGGG - Intronic
938489877 2:131755861-131755883 GGCCCAGCGCAAGGGCTGATGGG - Intronic
948859561 2:240746269-240746291 GCCCCAGCCCAGGCTCTGGGTGG - Intronic
1170770572 20:19328891-19328913 AGCCCAGCCCAGGCTCTGCGAGG + Intronic
1171036242 20:21714722-21714744 GGCCCAGCCCTGCCTCTGGCCGG + Exonic
1172271217 20:33656807-33656829 GGCCCAGAGGAGGCTCTGTGTGG + Intergenic
1173009429 20:39168263-39168285 GTCCCAGCAAAGGCTCTGATTGG - Intergenic
1173208385 20:41012750-41012772 GGCCCAGAGCAGGCTCACAGAGG + Intergenic
1173268060 20:41504984-41505006 GACCCAACTCAGTCTCTGACTGG - Intronic
1173424735 20:42932692-42932714 GCACCAGCCCAGGCTCTGGCGGG + Intronic
1173764726 20:45597018-45597040 GACCCAGCCCAGGCTCTCTCTGG - Intergenic
1174375217 20:50122057-50122079 GTCCCAGGGCAGGCTCTCATTGG - Intronic
1176261179 20:64181544-64181566 GGCCCAGCCCAGACAGTGACAGG - Intronic
1176603618 21:8813063-8813085 GGCCCAGCGCAAGTGCTGATGGG + Intergenic
1176603669 21:8813277-8813299 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1176603720 21:8813499-8813521 GGCCTAGCGCAGGCGCTGATGGG + Intergenic
1176603864 21:8814209-8814231 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1176603918 21:8814426-8814448 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1176604031 21:8814853-8814875 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1176604133 21:8815271-8815293 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1176604776 21:8820006-8820028 GGGCCAGGGCAGGGTCTGGCAGG + Intergenic
1176618103 21:9038812-9038834 AGCCCAGCGCAGGGGCTGATGGG + Intergenic
1176618211 21:9039220-9039242 GGCCCAGCGCAGGGGCTCATCGG + Intergenic
1176618366 21:9039827-9039849 GGCCCAGCACAGGCGCTGATGGG + Intergenic
1176618651 21:9041019-9041041 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1176618705 21:9041242-9041264 GGCCCAGCACAGGGGCTGATCGG + Intergenic
1176618846 21:9041887-9041909 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1176619011 21:9042527-9042549 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1176706203 21:10121318-10121340 GGCCCAGAGCAGGAGCTGATGGG - Intergenic
1176706531 21:10122847-10122869 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1176706579 21:10123042-10123064 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1176706629 21:10123238-10123260 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1176706771 21:10123839-10123861 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1176706825 21:10124053-10124075 GGCTCAGCGCAGGGCCTGATGGG - Intergenic
1176707144 21:10125272-10125294 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1176869030 21:14072267-14072289 GGCCCAGGGCAGGGGCTGCCAGG + Intergenic
1178270212 21:31182544-31182566 GGCCCAGCGAGGGCTGTGAGAGG + Exonic
1178579738 21:33828347-33828369 GGCCCAGCCTAGGCTCTGACTGG - Intronic
1179962320 21:44775179-44775201 GGCCCAGCGCAGGAAGTGACGGG - Intronic
1180093974 21:45546158-45546180 GGCCCGGCTCAGCCTCTGAGAGG - Intergenic
1180176610 21:46093570-46093592 GGCACAGAGCAGGCCCTGACTGG - Intergenic
1180235767 21:46458694-46458716 GGCCCAGCGCAGAGCCTGTCGGG + Intergenic
1180290606 22:10849957-10849979 GGCCCAGCGAAGGGGCTGATGGG - Intergenic
1180290666 22:10850172-10850194 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1180290715 22:10850368-10850390 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1180290765 22:10850613-10850635 GGCCCAGCGCAGGGGTTGATGGG - Intergenic
1180290967 22:10851441-10851463 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1180291023 22:10851703-10851725 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1180345902 22:11704614-11704636 GGCCCAGCGCAAGTGCTGATGGG + Intergenic
1180345952 22:11704828-11704850 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1180346003 22:11705050-11705072 GGCCTAGCGCAGGCGCTGATGGG + Intergenic
1180346149 22:11705786-11705808 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1180346202 22:11706003-11706025 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1180346315 22:11706430-11706452 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1180346417 22:11706849-11706871 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1180347066 22:11711611-11711633 GGGCCAGGGCAGGGTCTGGCAGG + Intergenic
1180353488 22:11822081-11822103 GGCCCAGCGCAAGGCCTGATGGG + Intergenic
1180353672 22:11822867-11822889 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1180353723 22:11823083-11823105 CGCCCAGCGCAGGGACTGATGGG + Intergenic
1180353775 22:11823307-11823329 GGCCTAGCGCAGGGGCTGATGGG + Intergenic
1180353921 22:11823943-11823965 GGCCCAGTGCAGGGACTGATGGG + Intergenic
1180353971 22:11824160-11824182 GGCCCAGTGCAGGGCCTGATGGG + Intergenic
1180354187 22:11825002-11825024 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1180384057 22:12167324-12167346 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1180384274 22:12168165-12168187 GGCCCAGTGCAGGGCCTGATGGG - Intergenic
1180384325 22:12168382-12168404 GGCCCAGTGCAGGGACTGATGGG - Intergenic
1180384470 22:12169052-12169074 GGCCTAGCGCAGGGGCTGATGGG - Intergenic
1180384522 22:12169276-12169298 GGCCCAGCGCAGGGACTGATGGG - Intergenic
1180384571 22:12169491-12169513 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1180384753 22:12170276-12170298 GGCCCAGCGCAAGGCCTGATGGG - Intergenic
1180493407 22:15879378-15879400 GGCCCAGCGAAGGGGCTGATGGG - Intergenic
1180493467 22:15879593-15879615 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1180493516 22:15879790-15879812 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1180493566 22:15880040-15880062 GGCCCAGCGCAGGGGTTGATGGG - Intergenic
1180493769 22:15880867-15880889 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1180493825 22:15881128-15881150 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1181049656 22:20232511-20232533 GGCCCAGCTCTGGCTCTGGCTGG + Intergenic
1181669445 22:24419348-24419370 GGCCCAGAGCAGGTGCTGAAAGG + Intronic
1181873596 22:25922633-25922655 GGCCCAGCTCAGCCTCTGACTGG - Intronic
1181967740 22:26668538-26668560 GGCCCAGGCCAGGCTCTGTCTGG - Intergenic
1182380425 22:29883272-29883294 TGCCCAGCGCCGGCCCTGGCAGG + Exonic
1182577848 22:31285173-31285195 GGCACAGCACTGCCTCTGACTGG - Intronic
1182620237 22:31614834-31614856 GGCTCTGCGCAGGCTCCAACAGG - Exonic
1183311460 22:37112147-37112169 GGCCCAGCCCTGGCTCTGCCTGG - Intergenic
1183380272 22:37487168-37487190 GAGCCAGTGCAGGCTCTGAGTGG - Intergenic
1183736391 22:39647059-39647081 GGCCCAGCGCAGGCTCTGACAGG - Intronic
1184512699 22:44942704-44942726 GGCCCAGCGCACGAGCTGTCGGG + Intronic
1184669941 22:46007199-46007221 CGCCCAGCGCAGGGCCTGGCAGG + Intergenic
949711336 3:6874388-6874410 TGCCCGGAGCTGGCTCTGACTGG - Intronic
952905371 3:38136560-38136582 GGCCCAGCGCAGGGCCTGAGTGG + Intronic
953004907 3:38969201-38969223 GGCCCAGCGAAGGGACTGGCTGG + Intergenic
960496132 3:118377435-118377457 GCCCCAGGGAGGGCTCTGACTGG + Intergenic
961587665 3:127947281-127947303 GGCCCATCCCAGGCCCTGATTGG - Intronic
963500091 3:146114877-146114899 GGAACAGCACAGGCTCTGAGAGG + Intronic
964451293 3:156816129-156816151 AGCTCAGCGCTGGCTCTGGCCGG - Intergenic
965080505 3:164025473-164025495 GGCCCAGCGCTGGGTCTTTCCGG + Intergenic
966871279 3:184291837-184291859 TGCCCAGCGGAGGCTCTGCCTGG - Intronic
968956204 4:3721133-3721155 GGCCCAGCCCAAGCTCTGGTGGG + Intergenic
969597867 4:8159013-8159035 CGGCCAGCGCAGGCGCAGACGGG + Intergenic
972277388 4:37569865-37569887 GGTCTAGCGCTGGCTTTGACGGG - Intronic
972277657 4:37571976-37571998 GTCCCAGCCCAGGTTGTGACAGG + Intronic
973373983 4:49275649-49275671 GGCCCAGCGCAAGGCCTGATGGG - Intergenic
973374086 4:49276065-49276087 GGCCCAGCGAAGGGGCTGATGGG - Intergenic
973374199 4:49276489-49276511 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
973374252 4:49276706-49276728 GGCCCAGCTCAGGGACTGATGGG - Intergenic
973374401 4:49277345-49277367 GGCCTAGCGCAGGGGCTGATGGG - Intergenic
973374454 4:49277568-49277590 GGCCCAGCGCAGGGACTGATGGG - Intergenic
973382957 4:49332673-49332695 GGCCCAGCGCAGGGACTGATGGG + Intergenic
973383010 4:49332896-49332918 GGCCTAGCGCAGGGGCTGATGGG + Intergenic
973383160 4:49333533-49333555 GGCCCAGCTCAGGGACTGATGGG + Intergenic
973383213 4:49333750-49333772 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
973383326 4:49334174-49334196 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
973383429 4:49334590-49334612 GGCCCAGCGCAAGGCCTGATGGG + Intergenic
973386583 4:49517715-49517737 GGCCCAGCGCAGGGACTGATGGG + Intergenic
973386633 4:49517939-49517961 GGCCTAGCGCAGGGGCTGATGGG + Intergenic
973386769 4:49518548-49518570 GGCCCAGCTCAGGGACTGATGGG + Intergenic
973387037 4:49519604-49519626 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
976184401 4:82430210-82430232 GGCCCCGCGCGGCCTCTGGCGGG + Exonic
976246703 4:83012515-83012537 GGCCGAGCGCTGGCCCTGCCGGG + Intronic
983249352 4:165327328-165327350 CGCACAGCGCAGGCTCTCACTGG + Intergenic
985236570 4:187881597-187881619 GCCCCAGCTCAGGCACTGTCAGG - Intergenic
988297962 5:29390680-29390702 GGCCCAGCGCTGGGTCTTTCAGG - Intergenic
988949505 5:36242308-36242330 GGCCCCGCGCCGCCTCAGACCGG - Intergenic
997485382 5:134226396-134226418 GGCCGCGCGCAGGCGCAGACCGG + Intergenic
997675371 5:135708713-135708735 GGCCCAGCTCAGGTCTTGACTGG - Intergenic
999285294 5:150391022-150391044 GGCCCAGCTCATCCTGTGACTGG - Intronic
1001546479 5:172573688-172573710 GTCCCAGGGAAGGCTCTGATTGG + Intergenic
1002621387 5:180491073-180491095 GACCCAGGGCAGGCTCTCACTGG - Intergenic
1003052480 6:2792600-2792622 GGCTCAGCGCAGGCTTTGAGAGG - Intergenic
1005911737 6:30316191-30316213 GGCCCACCACAGGGTCTGACAGG + Intergenic
1006816189 6:36851842-36851864 GCCCCAGTGATGGCTCTGACTGG + Intergenic
1009530282 6:64803784-64803806 GGCCAAGCCCAGGCACTGTCAGG - Intronic
1010570744 6:77471226-77471248 GACTCAGCTCAGTCTCTGACCGG + Intergenic
1010758791 6:79698577-79698599 GGTGCAGTGTAGGCTCTGACTGG + Intronic
1010905885 6:81487688-81487710 TGCCCAGTGCAGCCTCTGATTGG + Intergenic
1017545914 6:155450610-155450632 CCCCCAGCGCAGCCTCTGAGGGG - Intronic
1018889088 6:167968830-167968852 GGCCCAGCTCTGCCTCTGACTGG - Intronic
1019278851 7:190394-190416 GGCACAGCGCAGGCTCTCAGAGG - Intergenic
1019285834 7:222492-222514 GGCCCAGGGCTGGCACTGAGAGG + Intronic
1019325683 7:437048-437070 GGCCTGGCTCAGGCTCTGAGTGG - Intergenic
1019522757 7:1468082-1468104 GGCTCAGAGCAGCCTGTGACAGG - Intergenic
1019524960 7:1476714-1476736 CTCCCAGCGCCGGCTCTGACTGG - Intronic
1019619660 7:1985372-1985394 GGCACAGCACAGGCTCTTCCAGG + Intronic
1019746444 7:2702851-2702873 GGCCCAGCCGGGACTCTGACAGG + Exonic
1021107131 7:16650480-16650502 GGCCCAGGACAGGGTGTGACTGG + Intronic
1025095398 7:56092162-56092184 GCCCCAGCCCCAGCTCTGACTGG + Intronic
1025190665 7:56893314-56893336 GTGCCAGAGCAGGCTCTGGCTGG + Intergenic
1025681278 7:63683610-63683632 GTGCCAGAGCAGGCTCTGGCTGG - Intergenic
1027250776 7:76397564-76397586 ACCCCAGCCCAGGCTCTGGCAGG + Exonic
1029331085 7:99856207-99856229 TGCCCAGTCCAGGCTATGACAGG - Intronic
1029403108 7:100357491-100357513 AGGCCAGCGCAGGCTCTTTCAGG - Intronic
1029405724 7:100373232-100373254 GGGCCAGCGCAGGCTCTTTCAGG - Intronic
1029686171 7:102149589-102149611 GGCCCAGCTCAGACTGAGACAGG - Intronic
1029732269 7:102446421-102446443 GGCCCAGCCCCTGCTCTGCCTGG + Intronic
1034546890 7:151795054-151795076 GCCCCAGGGCAGCCTCTTACAGG + Intronic
1035662179 8:1356441-1356463 CGCCCACTGCAGCCTCTGACGGG - Intergenic
1037302563 8:17468313-17468335 GCCCCATCACAGTCTCTGACTGG - Intergenic
1038444350 8:27593062-27593084 GGCCCCGCGCAGGGGCCGACAGG - Intergenic
1040106424 8:43544815-43544837 GGCCCAGCGCAGGGCCTGTTGGG + Intergenic
1040106605 8:43545507-43545529 GGTCCAGCGCAGGGCCTGCCGGG + Intergenic
1040106786 8:43546148-43546170 GGCCCGGCGCAGGGCCTGCCGGG + Intergenic
1040107019 8:43547023-43547045 GGTCCAGCGCAGAATCTGATGGG + Intergenic
1040275895 8:46013491-46013513 GGCCCAGTGCAGGGTCTGCCGGG + Intergenic
1040277392 8:46020990-46021012 GGCCCAGTGCAGGGGCTGCCAGG + Intergenic
1040278371 8:46025339-46025361 GGCCCAGCCCAGGGGCTGCCGGG + Intergenic
1040444029 8:47475306-47475328 GGCCCAGAGCATGCTCGGATTGG + Intronic
1041009832 8:53530851-53530873 GGCCCAGCGCAGGCTCTGTGAGG + Intergenic
1045564349 8:103298737-103298759 GGCGCAGCGCAGGCGGTGCCCGG + Intronic
1049272160 8:141701551-141701573 GGGCCAGCGCAGGGGCTGAAAGG - Intergenic
1049411230 8:142474857-142474879 GGTCCAGGGCAGGCTCCGTCAGG + Intronic
1049785937 8:144450847-144450869 GGCCGAGGGCAGGCTCAGCCGGG + Intronic
1050394908 9:5185662-5185684 GGCCTGGCGCAGGCGCAGACAGG - Exonic
1053643488 9:40108435-40108457 GGCCCAGAGCAGGAGCTGATGGG - Intergenic
1053643628 9:40109139-40109161 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1053643823 9:40109965-40109987 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1053643872 9:40110161-40110183 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1053643924 9:40110358-40110380 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1053644069 9:40110986-40111008 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1053644124 9:40111198-40111220 GGCTCAGCGCAGGGCCTGATGGG - Intergenic
1053644446 9:40112428-40112450 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1053678370 9:40461442-40461464 GCCCCAGCGCAGGATCTGCTAGG + Intergenic
1053761714 9:41353061-41353083 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1053762032 9:41354287-41354309 GGCTCAGCGCAGGGCCTGATGGG + Intergenic
1053762085 9:41354499-41354521 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1053762228 9:41355131-41355153 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1053762280 9:41355328-41355350 GGCCCAGGGCAGGGGCTGATGGG + Intergenic
1053762328 9:41355524-41355546 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1053762663 9:41357055-41357077 GGCCCAGAGCAGGAGCTGATGGG + Intergenic
1054324343 9:63705663-63705685 GGCCCAGAGCAGGAGCTGATGGG - Intergenic
1054324678 9:63707193-63707215 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1054324727 9:63707389-63707411 GGCCCAGGGCAGGGGCTGATGGG - Intergenic
1054324780 9:63707587-63707609 GGCCCAGCGCAGGGGCTGATGGG - Intergenic
1054324923 9:63708212-63708234 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1054325294 9:63709675-63709697 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1054350371 9:64014187-64014209 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1054350475 9:64014577-64014599 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1054350577 9:64014984-64015006 GGCCCAGCACAGGCGCTGATGGG + Intergenic
1054350620 9:64015175-64015197 GGTCCAGCGCAAGCCCTGATGGG + Intergenic
1054350676 9:64015367-64015389 GGCCCAGCGCAGGGTCTGATGGG + Intergenic
1054350732 9:64015583-64015605 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1054350845 9:64016007-64016029 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1054350945 9:64016421-64016443 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1054540307 9:66264179-66264201 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1054540626 9:66265404-66265426 GGCTCAGCGCAGGGCCTGATGGG + Intergenic
1054540679 9:66265615-66265637 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1054540825 9:66266251-66266273 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1054540923 9:66266643-66266665 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1054541123 9:66267466-66267488 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1054541264 9:66268169-66268191 GGCCCAGAGCAGGAGCTGATGGG + Intergenic
1056054419 9:82806088-82806110 AGCCCAGGGCAGCCTCTGCCAGG + Intergenic
1059354158 9:113686782-113686804 GGCCCAGCGCAGACCCTGTCAGG + Intergenic
1060402855 9:123358233-123358255 GGCCCAGCTCAGGGCCTGGCAGG - Intronic
1061074467 9:128332709-128332731 GGCCCAGCACAGGCCAGGACTGG + Intronic
1061404317 9:130385157-130385179 GGCCTAGCGCAGTGTCTGGCTGG - Intronic
1061557948 9:131383499-131383521 GGCCCAGCTTAGGCTGTGTCTGG + Intergenic
1061708109 9:132468473-132468495 GGCCCAGGGCAGGGGCTGGCAGG - Intronic
1061997387 9:134193416-134193438 TGCCCAGCCCAGGCCCTGGCAGG - Intergenic
1062351564 9:136142204-136142226 GGCCCAGGGCAGGCTCACAGTGG + Intergenic
1062439593 9:136563774-136563796 GGCTCAGCGCAGGGACTGCCAGG - Intergenic
1202791238 9_KI270719v1_random:91406-91428 GGCCCAGAGCAGGAGCTGATGGG - Intergenic
1202791569 9_KI270719v1_random:92928-92950 GGCTCAGCGCAGGGCCTGATGGG - Intergenic
1202791890 9_KI270719v1_random:94146-94168 GGCCCAGCTCAGGGGCTGATGGG - Intergenic
1203697664 Un_GL000214v1:113561-113583 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1203697873 Un_GL000214v1:114401-114423 GGCCCAGTGCAGGGGCTGATGGG - Intergenic
1203697925 Un_GL000214v1:114617-114639 GGCCCAGCTCAGGGACTGATGGG - Intergenic
1203698069 Un_GL000214v1:115253-115275 GGCCTAGCGCAGGGGCTGATGGG - Intergenic
1203698120 Un_GL000214v1:115476-115498 GGCCCAGCGCAGTGACTGATGGG - Intergenic
1203698169 Un_GL000214v1:115690-115712 GGCCCAGCGCAAGGGCTGATGGG - Intergenic
1203551082 Un_KI270743v1:165504-165526 GGCCCAGCGCAGGGACTGATGGG + Intergenic
1203551136 Un_KI270743v1:165728-165750 GGCCTAGCGCAGGGGCTGATGGG + Intergenic
1203551281 Un_KI270743v1:166369-166391 GGCCCAGCTCAGGGACTGATGGG + Intergenic
1203551332 Un_KI270743v1:166586-166608 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1203551441 Un_KI270743v1:167009-167031 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1203551542 Un_KI270743v1:167425-167447 GGCCCAGCGCAAGGTCTGATGGG + Intergenic
1186310981 X:8318920-8318942 GGCCCTGCGGAAGCTCAGACAGG + Intergenic
1186667962 X:11737827-11737849 GGTCAAGAGAAGGCTCTGACTGG + Intergenic
1191252783 X:58267360-58267382 GGCCCAGCACAGGGGCTGCCGGG + Intergenic
1191253325 X:58269482-58269504 GGCCCTGCGCAGGGGCTGCCGGG + Intergenic
1191257848 X:58287502-58287524 GGCCCAGCGCAGGGGCTGCCCGG - Intergenic
1195672917 X:107484280-107484302 GGCCCAGTGCTGGTTCTGACCGG - Intergenic
1196828468 X:119758723-119758745 GGCGCACCGCAGGCTCTGCGAGG - Exonic
1199607256 X:149586669-149586691 GGCTGGGCCCAGGCTCTGACTGG - Intronic
1199631867 X:149782698-149782720 GGCTGGGCCCAGGCTCTGACTGG + Intronic
1200163047 X:154019037-154019059 GGCCGAGCTCAGGCCCTGAATGG + Exonic
1201151437 Y:11097451-11097473 GGCCCAGCTCAGGGGCTGATGGG + Intergenic
1201151487 Y:11097648-11097670 GGCCCAGCGCAGGGGCTGATGGG + Intergenic
1201151547 Y:11097865-11097887 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1201151600 Y:11098057-11098079 GGCCCAGCGCAGGGGCTCATCGG + Intergenic
1201151753 Y:11098669-11098691 GGCCCAGCACAGGCGCTGATGGG + Intergenic
1201151848 Y:11099048-11099070 GGCCCAGCACAGCATCTGATGGG + Intergenic
1201152301 Y:11100887-11100909 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1201152353 Y:11101106-11101128 GGCCCAGCGAAGGGACTGATGGG + Intergenic
1201152405 Y:11101331-11101353 GGCCCAGTGCAGGGGCTGATGGG + Intergenic
1201152554 Y:11101976-11101998 GGCCCAGCGCAGGGACGGATGGG + Intergenic
1201152609 Y:11102193-11102215 TGCCCAGCGCAGGGGCTGATGGG + Intergenic
1201152716 Y:11102612-11102634 GGCCCAGCGAAGGGGCTGATGGG + Intergenic
1201152818 Y:11103033-11103055 GGCCCAGCGCAAGGGCTGATGGG + Intergenic
1201274861 Y:12287436-12287458 GGCCCAGCGCTGGGTCTTTCGGG + Intergenic
1201763534 Y:17561293-17561315 GGCCCAGCGCAGGGGTTGCCGGG + Intergenic
1201764153 Y:17563801-17563823 GGCCCAGCGTAGGGGCTGCCGGG + Intergenic
1201764322 Y:17564608-17564630 AGCCCGGCGCAGGGTCTGCCGGG + Intergenic
1201764803 Y:17566693-17566715 GGCCCGGAGCAGGGTCTGCCAGG + Intergenic
1201836749 Y:18339296-18339318 GGCCCGGAGCAGGGTCTGCCAGG - Intergenic
1201837231 Y:18341382-18341404 AGCCCGGCGCAGGGTCTGCCGGG - Intergenic
1201837400 Y:18342189-18342211 GGCCCAGCGTAGGGGCTGCCGGG - Intergenic
1201838019 Y:18344697-18344719 GGCCCAGCGCAGGGGTTGCCGGG - Intergenic