ID: 1183736630

View in Genome Browser
Species Human (GRCh38)
Location 22:39648239-39648261
Sequence CCATCCAGGCGTGGGCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183736624_1183736630 -10 Left 1183736624 22:39648226-39648248 CCTCGGGTGCCAGCCATCCAGGC 0: 1
1: 0
2: 0
3: 14
4: 175
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data
1183736622_1183736630 -6 Left 1183736622 22:39648222-39648244 CCGTCCTCGGGTGCCAGCCATCC 0: 1
1: 0
2: 1
3: 13
4: 193
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data
1183736618_1183736630 2 Left 1183736618 22:39648214-39648236 CCGCCCACCCGTCCTCGGGTGCC 0: 1
1: 0
2: 0
3: 17
4: 182
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data
1183736621_1183736630 -5 Left 1183736621 22:39648221-39648243 CCCGTCCTCGGGTGCCAGCCATC 0: 1
1: 0
2: 1
3: 11
4: 101
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data
1183736620_1183736630 -2 Left 1183736620 22:39648218-39648240 CCACCCGTCCTCGGGTGCCAGCC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data
1183736619_1183736630 -1 Left 1183736619 22:39648217-39648239 CCCACCCGTCCTCGGGTGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1183736630 22:39648239-39648261 CCATCCAGGCGTGGGCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183736630 Original CRISPR CCATCCAGGCGTGGGCTCGG AGG Intronic
No off target data available for this crispr