ID: 1183737674

View in Genome Browser
Species Human (GRCh38)
Location 22:39652943-39652965
Sequence ATCCTGGTTCTGCTATTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183737670_1183737674 -2 Left 1183737670 22:39652922-39652944 CCAAATCAGCCAAACAAACCAAT 0: 1
1: 0
2: 1
3: 20
4: 421
Right 1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG 0: 1
1: 0
2: 6
3: 72
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183737674 Original CRISPR ATCCTGGTTCTGCTATTGAC TGG Intronic
902556807 1:17251642-17251664 ATCCTGGCTCTGCCACTCACTGG - Intronic
903001135 1:20266698-20266720 ATCCTGGCCCTGCTGTTCACTGG - Intergenic
903447867 1:23433792-23433814 ATCCTGGCTCTGCCATTTTCTGG + Intronic
903927703 1:26842586-26842608 ACCCTGGTTTTGTCATTGACTGG - Intronic
903934988 1:26889532-26889554 AATCTGGCTCTGCTACTGACTGG - Intronic
904279831 1:29411121-29411143 ATCCTGGCTCTGCTACTCCCTGG - Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904694739 1:32322816-32322838 ATTCTGGTTCTGCTACTGCCTGG + Intronic
905224453 1:36469915-36469937 ATCCTGGCTTTGCTATTTACAGG + Intronic
905586652 1:39124872-39124894 ATCCTGATTCTGCCACTGACTGG - Intronic
906113596 1:43340432-43340454 GTCCTGTTGCTGCCATTGACAGG - Exonic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907487591 1:54788236-54788258 GTCCTGGTTCTGCCCCTGACTGG + Intronic
907759600 1:57344145-57344167 AACTTGGTTCTGCCATTTACTGG - Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908449324 1:64236058-64236080 ATCCTGGGTCTGCCATTTACTGG + Intronic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
909494133 1:76259361-76259383 ATCCTGGTTCTGTCACTGAGTGG + Intronic
909956099 1:81780906-81780928 ATCCTTGTTCTGTTATTCAAGGG + Intronic
910706368 1:90133816-90133838 ATCCTGGTTCTGCTTCTCCCTGG + Intergenic
910719176 1:90266647-90266669 ATCCTGACTCTGCTATTTACTGG + Intergenic
911922169 1:103778993-103779015 CTCCTGGCTCTGATACTGACTGG + Intergenic
912823946 1:112888497-112888519 AGCCTGGTTCTACCACTGACTGG - Intergenic
913174243 1:116259453-116259475 ATCCTGGCTCTGCTACTCTCTGG - Intergenic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918458129 1:184747268-184747290 ATCCTGTCTCAGCTATTTACAGG - Intronic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
921061768 1:211591314-211591336 ATCCTGGCTTTCCTATTTACTGG + Intergenic
921781580 1:219171800-219171822 ATCCAGGTTCTACAATTGACTGG + Intergenic
1063799725 10:9560731-9560753 ATCTTGGCTCTGAAATTGACTGG + Intergenic
1063873544 10:10446281-10446303 ATCTGGGCTCTGCTACTGACAGG - Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1070390534 10:75966751-75966773 ATCATGGCTCTGCTATTTATTGG + Intronic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070642052 10:78177319-78177341 ATCCTTGGGCTGCTTTTGACGGG + Intergenic
1070904030 10:80055926-80055948 ATCCTGGCTCTGAGACTGACAGG + Intergenic
1071708467 10:88025350-88025372 ACCCTGGCTCTGCTATTTGCTGG - Intergenic
1073044811 10:100630669-100630691 ATCCTTTCTCTGCCATTGACTGG + Intergenic
1073084760 10:100881025-100881047 ATCCTGGCTCTGCCACTCACTGG - Intergenic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1075594503 10:123718522-123718544 ATCCTGGTGTTGCTCTTCACAGG - Intronic
1075674182 10:124284422-124284444 ATCCTGGTTCTGTTGTTGATTGG - Intergenic
1076029288 10:127143807-127143829 GTCCTGGTTCTTCTATTGCCTGG - Intronic
1076276100 10:129200052-129200074 ATCCTGGTCCTTCTCTTTACAGG + Intergenic
1076986311 11:238400-238422 TTCCTGGCTCTGCTATTGAATGG - Intronic
1078483555 11:11701414-11701436 GTCCTGGCTCTGCCATTTACAGG - Intergenic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079259266 11:18862633-18862655 ATCTTGCTTCTGATAGTGACTGG + Intergenic
1080438186 11:32265521-32265543 GCCTTGGTTCTGCCATTGACTGG - Intergenic
1080857142 11:36122052-36122074 ATCCTGGCTCTGCCATTTACTGG - Intronic
1081637866 11:44732766-44732788 ATCCCGATTCTGCAATTTACTGG + Intronic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1082864351 11:57884982-57885004 ATCCTGGTTCTGATATTTATTGG + Intergenic
1082922649 11:58512207-58512229 GTCCTGGTTCTCCTAGTCACAGG + Intergenic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085762759 11:79256448-79256470 ATTCTGGTTCTGCCAGTGCCTGG - Intronic
1085770416 11:79320588-79320610 AACCTGGCTCTGCCATTTACTGG - Intronic
1087296923 11:96389080-96389102 ATCATAGTTCTTCTATTGGCAGG + Intronic
1087515568 11:99154961-99154983 AGCCTGATTCTGCTACTGTCTGG - Intronic
1088935767 11:114399013-114399035 ATCCTGGTTCTTCTCTTACCTGG - Intronic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1092593103 12:9968934-9968956 CTCCTGTTTCTGCAAATGACAGG - Intronic
1092791824 12:12076857-12076879 CCCCTGGTTCTGCTATTGGAAGG - Intronic
1093987782 12:25556387-25556409 ATCTTGGCTCTGCCATTTACTGG - Intronic
1094365068 12:29671666-29671688 ATCCCAGTTCTGCTAATGGCTGG - Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1095225582 12:39673094-39673116 CTCCTGGCTCTGCTATTGTAGGG + Intronic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097535595 12:60866170-60866192 ATCCTTGTTCTTCTAGTCACTGG + Intergenic
1097897566 12:64841074-64841096 GTCCCAGTTCTGCTATTCACTGG - Intronic
1098286405 12:68911833-68911855 ATCCTGGTTCTGCTGTTCAGTGG - Intronic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1102522317 12:113486138-113486160 ATCTTGGCTTTGCTAATGACTGG - Intergenic
1103217810 12:119216254-119216276 ATCCTATTTCTGCTGCTGACTGG + Intronic
1104659112 12:130596442-130596464 ATCCTGGTTTTGCAATTGATGGG - Intronic
1106272043 13:28164329-28164351 GTCTTGGTTCTGCCATTTACTGG - Intronic
1106453946 13:29910370-29910392 ATCCTGGTTCTGTTCTGGACTGG - Intergenic
1106911412 13:34467074-34467096 CTACTGGTTCTGCTGTTGTCTGG + Intergenic
1107479611 13:40774750-40774772 ATCCTGGTTCTGTGGTGGACGGG + Intergenic
1107619731 13:42213947-42213969 ATCCTGGCTCTACGATTTACTGG + Intronic
1107829344 13:44360509-44360531 ATCTTATTTCTGCTATTGAATGG + Intergenic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1109205889 13:59482319-59482341 AGCCTGGTTCTCCCATTTACTGG + Intergenic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1112481294 13:99777900-99777922 ATCTTGGTTCTGCTATTTAATGG - Intronic
1113284160 13:108828380-108828402 ATCCTGGCTCTGCCATTTACTGG + Intronic
1114730355 14:24986524-24986546 AGCCTGGATCAGCTGTTGACAGG + Intronic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115650088 14:35396914-35396936 AGCCTGGCTCTGCCATTTACTGG + Intergenic
1117601998 14:57385728-57385750 ATCCTGGCTCTGCCAATTACTGG - Intergenic
1118334471 14:64841240-64841262 ATCCTGGCTCTGTCATTTACAGG - Intronic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120133788 14:80839594-80839616 TTCCTGGTTTTGATATTGAATGG + Intronic
1120329599 14:83074375-83074397 TTCATGTTTCTGCTAATGACAGG - Intergenic
1120806698 14:88759270-88759292 ATTCTGGCTCTGCTCTTCACAGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121829265 14:97035497-97035519 ATCCTGGCTCTGCCATTTACCGG - Intergenic
1121977085 14:98415028-98415050 ATTCTGATTCTGATATTTACTGG - Intergenic
1122046536 14:99028010-99028032 ATACTGGTTCTGCTATGGTCAGG - Intergenic
1124193342 15:27599161-27599183 ATGCTGGTCCTGCTTCTGACTGG - Intergenic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125823220 15:42651681-42651703 AACTTGGTCCTGCTATTAACAGG - Intronic
1126669033 15:51099540-51099562 ATCCTGGTGCTGCTATTTAAAGG - Intronic
1127635435 15:60865074-60865096 ATCCTGGTTCTCCCATTGCCTGG + Intronic
1127838987 15:62813631-62813653 ATCACGGTAATGCTATTGACAGG + Intronic
1128569074 15:68720201-68720223 ATCCTGGCTCTGCCATTTCCTGG + Intronic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128796960 15:70473112-70473134 ATCCTGGCCCTGCCATTCACTGG + Intergenic
1129344845 15:74910647-74910669 ATTCTGGTTCTGCTGTTGACTGG + Intergenic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129794484 15:78365806-78365828 CTCCTGGCTCTGCCACTGACCGG + Intergenic
1131031608 15:89190799-89190821 ATCCTGCTTCGGTTATTTACTGG - Intronic
1131955816 15:97734973-97734995 ATCTTGGTTCTGCCATTTACAGG - Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1135122241 16:19776246-19776268 ATCCTGCCTCTGCTATGCACTGG - Intronic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1138206614 16:55130277-55130299 ATCCTAGTTGTGCCATTGGCTGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138349203 16:56337558-56337580 GTCCTGGCTCTGCTACTCACTGG + Intronic
1139230803 16:65280669-65280691 ATCCTGGTTCTGATCTTCACAGG - Intergenic
1139231059 16:65282995-65283017 ATCCTGGCTCTGATCTTCACAGG + Intergenic
1139907077 16:70373659-70373681 CTCCTGGTTCCTCTAGTGACAGG + Intergenic
1141098324 16:81178759-81178781 ATCCTGGTTCTGGTCTTTCCTGG - Intergenic
1141552852 16:84817727-84817749 ATCCTGGCTCTTCTATTCAGAGG + Intergenic
1141977546 16:87527468-87527490 ATCCTGGCTCTCCCATAGACTGG + Intergenic
1142903715 17:3028725-3028747 ATCCTGGTTGTAGCATTGACAGG + Intronic
1143883521 17:10048971-10048993 ATCCTGGTTCTGGGATGGACAGG - Intronic
1143893800 17:10121439-10121461 GGCCTGGTTCTGCTACTCACTGG + Intronic
1145866488 17:28245343-28245365 ATCCTGGCTCCGCCATTGGCTGG - Intergenic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146583254 17:34058952-34058974 ATCTTGGTTCTGCCATTTGCTGG - Intronic
1146944018 17:36862164-36862186 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147430241 17:40366518-40366540 GGCCTGGATCTGCTATTTACCGG - Intergenic
1149502665 17:57166319-57166341 ATCCTGCTTCTGCAATTTACTGG - Intergenic
1150186992 17:63192618-63192640 ATCCTGGCTCTGCCATTTACTGG + Intronic
1150225801 17:63523838-63523860 ATCCTGGTTCTGGTCTTCCCAGG + Intronic
1151388887 17:73772321-73772343 ATTCTAGTTCTGTTATTGAGGGG - Intergenic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1156378892 18:36539593-36539615 AGCCTGGGTCTGCCATTGAAAGG - Intronic
1157931788 18:51831801-51831823 ATCCTGGATCTGTCATTTACTGG - Intergenic
1158514576 18:58120317-58120339 GTCCTGGTTCTGCTATTCATTGG + Intronic
1160475333 18:79179754-79179776 ATGTTTGTTCTGCTATTGCCTGG + Intronic
1160582888 18:79897714-79897736 ATCCTGGGCCTGTTATTCACTGG + Intronic
1161070142 19:2255893-2255915 ATCCTGGCTCTGGTCGTGACAGG + Intronic
1161602849 19:5195392-5195414 ATCCTGGCTCTGCTATTTCCTGG + Intronic
1164503655 19:28840329-28840351 ACCCTGGTTCTGTGATTTACTGG + Intergenic
1165921966 19:39304851-39304873 ATCATGGCTCTGCTGTTAACTGG + Intergenic
1166566049 19:43766305-43766327 ATCCTGGTTCTACCATCCACTGG - Intergenic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1167135926 19:47615508-47615530 ATCCCAGTTCTGCTATTTGCTGG + Intronic
1168667481 19:58215341-58215363 ATCCTGGCTCTGCTCCTCACTGG + Intergenic
925775453 2:7330862-7330884 CACCTGGTTCTGTTAATGACAGG + Intergenic
927219363 2:20693041-20693063 ATCTTGGTTCTGCCATTTATTGG + Intronic
927375112 2:22404358-22404380 ATCTTGGTTCTGCTGATGGCTGG - Intergenic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
931980264 2:67686783-67686805 AACCTGGTTCTTCTCTTGACAGG + Intergenic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932347084 2:71002443-71002465 ATCCGCGTTATGCTAATGACAGG - Intergenic
934131915 2:88956478-88956500 GCCCTGGTTCTGCTAGTGCCAGG + Intergenic
934952811 2:98590391-98590413 ATCCTGGTTCTGCCCCTGACTGG + Exonic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
936797511 2:116224693-116224715 ATCCTGGGTCTGCTAGAGCCTGG - Intergenic
937029310 2:118724843-118724865 ATCCTGATTCTGCCATGTACTGG + Intergenic
937241206 2:120463694-120463716 AGCCTGGTCCTGCCATTGGCAGG + Intergenic
942441937 2:176045990-176046012 ATCTTGGCTCTGCCATTAACTGG - Intergenic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
944946754 2:204696436-204696458 ATGCTGGTTCTCCTATTTCCAGG + Intronic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
945685575 2:212965465-212965487 ATCCTGCTTCTCTTTTTGACAGG - Intergenic
946616488 2:221516097-221516119 TTCCTGGTTGTGTTTTTGACAGG - Intronic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
946915702 2:224518623-224518645 ATCCTGGCTCTACTGTTAACTGG + Intronic
947205013 2:227652703-227652725 ATCCTAGTGTTGCTATAGACAGG + Intergenic
1170477764 20:16733140-16733162 ATTCTGGTTGTACTATTAACTGG + Intronic
1170800698 20:19587691-19587713 ATCCTGATTCTGCCATTTTCTGG + Intronic
1172995181 20:39065037-39065059 ATCCTGGATTTGCTACTCACTGG + Intergenic
1173833106 20:46105389-46105411 ATCCTGGCTCTACCATTTACTGG + Intergenic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1175312677 20:58022845-58022867 ATCCTGGTTCTGTTTTTTTCTGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1177898317 21:26882117-26882139 ACCCAGGATCTGCCATTGACAGG - Intergenic
1178331132 21:31692754-31692776 ATCCTAGTTCTGCTGTTCATTGG - Intronic
1179078916 21:38152035-38152057 ATCCTGTTTCAGCCCTTGACAGG + Intronic
1179486891 21:41716214-41716236 TTCCTGCCTCTGCCATTGACTGG - Intergenic
1179819347 21:43927714-43927736 GTCCTGATTCTGCTACTGACTGG + Intronic
1182827877 22:33281472-33281494 ATCCAGGCTCTGCTATTTACTGG + Intronic
1182865193 22:33598208-33598230 ATCCTGGCTCTGCCATGTACCGG + Intronic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1184349891 22:43936593-43936615 ATCCTGGCTCTGCTATGTATTGG + Intronic
1184650590 22:45917851-45917873 ATCCTGGTTCTGCCTTTCACTGG + Intergenic
1184861346 22:47174757-47174779 ATACTGGTTCTGCCCTGGACTGG + Exonic
1184899266 22:47434180-47434202 TTCCAGCTTCTGCTGTTGACTGG - Intergenic
949290508 3:2460146-2460168 ATCCAGGTTCTTCTATTGTCAGG - Intronic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950275882 3:11660221-11660243 ATCTTGGTTCTGCCACAGACTGG + Intronic
950408787 3:12820876-12820898 ATCCTGGCCCTGCTATTCCCTGG + Intronic
950521366 3:13499880-13499902 ATCCTGGTTCTGCCATTACCTGG + Intronic
950808856 3:15632381-15632403 TTCCTGGTTCTGCTGTTCCCTGG + Intronic
951158955 3:19392369-19392391 ATACTTGTTCTGCTTTTCACAGG + Intronic
951743701 3:25953242-25953264 ATCCAGGATCTGCCATTTACTGG + Intergenic
953036944 3:39220467-39220489 ATCCCAGATCTGCTGTTGACAGG - Intergenic
954702421 3:52457194-52457216 AACCTGGTTCTGCCATTTCCTGG - Intronic
955638102 3:61052379-61052401 GTCCTGGATATGCTATTTACCGG - Intronic
956425385 3:69129081-69129103 ATCCTGGTTGTGCCACTGACTGG + Intergenic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
958794759 3:98695182-98695204 ATCCTGGTTCTGCCATTTTCTGG + Intergenic
958794891 3:98696407-98696429 ATCCTGGTTCTGCCATTTTCTGG - Intergenic
959075510 3:101745121-101745143 ATCTCTGTTTTGCTATTGACAGG + Intronic
959095879 3:101955133-101955155 CTCCTTGTTCTGCTATTTCCTGG + Intergenic
959227866 3:103608866-103608888 CTCCTGCTTCTGCTTTTGCCAGG + Intergenic
960034425 3:113088203-113088225 ATCCTGGCTCTGCCATTTATTGG - Intergenic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
962204410 3:133423264-133423286 ACTCTGGTTTTGCCATTGACTGG + Intronic
962889876 3:139662285-139662307 ATCCTGGTTCTGTCACTGATGGG + Intronic
964444561 3:156745086-156745108 ATCCTAGTTCTGCCATTAAATGG - Intergenic
964557924 3:157961252-157961274 ATCCTAGTTCTGATTCTGACAGG + Intergenic
965539903 3:169861537-169861559 ATGCTGTTTCTGCAATTGTCTGG + Intronic
965835601 3:172848493-172848515 ATCCCAGCTCTGCTATTTACTGG + Intergenic
966579489 3:181544381-181544403 ACTCTGGTTCTGCAATGGACGGG + Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
967391205 3:188956562-188956584 ATCCTGGCCCAGCCATTGACTGG + Intronic
967748757 3:193089360-193089382 ATTCTGGCTCTGCCAGTGACTGG + Intergenic
970059220 4:12011899-12011921 CTCTTGGCTCTGCTCTTGACTGG + Intergenic
970850612 4:20598374-20598396 ATCCAGCTTCTGCCATTTACAGG + Exonic
971140126 4:23915983-23916005 ATCCTGGCTCTGCCATTTATAGG + Intergenic
971343951 4:25795632-25795654 GTCCTGGGTCTGCTACTCACTGG - Intronic
973019950 4:45190567-45190589 ATCCTAGTTCTTCTACTGCCTGG - Intergenic
973644680 4:52938300-52938322 ATAATGGTTCTGCCATTGACTGG - Intronic
976340260 4:83939327-83939349 ATCCAGGTGCTGCAAATGACAGG + Intergenic
976805384 4:89040607-89040629 ATCTTGGTTTTGCCATTGACTGG + Intronic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981132305 4:141171230-141171252 GTCCTGATTCTGCTACTGACTGG - Intronic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
983223104 4:165061673-165061695 ATCCAGGTTCTGCTAATGTCTGG + Intergenic
983769340 4:171529621-171529643 ATCGTGGCTCTGCCATTCACTGG + Intergenic
984509224 4:180658468-180658490 ATGATGGTTTTGGTATTGACTGG + Intergenic
984740201 4:183154218-183154240 ATCCTGGCTCTGCCTTTCACTGG + Intronic
985357180 4:189133942-189133964 ATCCTGGCTCTGCTATTCGCTGG - Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
987269239 5:16288246-16288268 CTGCTGGTTCTCCTGTTGACAGG - Intergenic
988701714 5:33681743-33681765 CTCCTGGTTCTGCACATGACTGG - Intronic
989187953 5:38643055-38643077 ATCCTGGTTCTGTCATTTAGGGG + Intergenic
989273385 5:39558137-39558159 ACCCTGGCTCTGCTATTTATTGG + Intergenic
991617751 5:68514891-68514913 ATCCTGGCTCTGCTTTTTCCTGG + Intergenic
993565036 5:89463621-89463643 ATACTGGGTATGCTATTGACAGG + Intergenic
994680006 5:102874939-102874961 ATCCTTGTTCTCCTATTTACCGG - Intronic
995248463 5:109962193-109962215 ATCCTGGCCCTGCCATTTACTGG + Intergenic
997059745 5:130487548-130487570 AGCCTAGTTCTGCTTTTCACTGG - Intergenic
997342212 5:133153522-133153544 ATCCTGGTTCTGCTGCCCACTGG - Intergenic
997670821 5:135670488-135670510 GTCCTGGTTCTGCTGCTCACTGG + Intergenic
999540126 5:152562104-152562126 ATCCTGGTTCTTCTCCTGAAAGG - Intergenic
1001292428 5:170473440-170473462 ATTCTGGTTCCACCATTGACTGG - Intronic
1001411177 5:171513118-171513140 ATCCTGGTTCTGCCATTTTGGGG + Intergenic
1001818064 5:174688119-174688141 GTCCTGGCTCTGCTGTTTACTGG - Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1003800369 6:9658257-9658279 TTTCTGGTTCTGCTGTTGATTGG - Intronic
1003944849 6:11065566-11065588 ATCCTGGTTATGCTCTTATCTGG + Intergenic
1004243799 6:13953073-13953095 TTCCTGGGTCTGTTATTTACTGG + Intronic
1004302250 6:14469231-14469253 ATCATGGTTCTCCTATAGAATGG + Intergenic
1004873643 6:19933414-19933436 AACCTGGTTCTGCTGTTGACTGG + Intergenic
1005878534 6:30035026-30035048 ATGCTGGCTCTCCTATTGCCTGG + Intergenic
1006573491 6:35025386-35025408 GTCCTGGCTCTGCAATTGACTGG + Intronic
1007848333 6:44779741-44779763 CTGCTAGTTCTTCTATTGACAGG + Intergenic
1008373123 6:50759196-50759218 ATCTTTGTTGAGCTATTGACTGG + Intronic
1008895569 6:56550596-56550618 ATACTGGTGCTGCTATTTGCGGG - Intronic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010521073 6:76838219-76838241 ATCCAGGTTTTGTTATTGTCAGG + Intergenic
1010527108 6:76914889-76914911 ACCCTGGCTCTGCTATTCAGTGG + Intergenic
1011743288 6:90385035-90385057 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1011814566 6:91173348-91173370 ATCCTAGTCCTGCGAGTGACTGG - Intergenic
1014168816 6:118255201-118255223 ATCCTGGCTCTGACATTGCCAGG + Intronic
1014980515 6:127941035-127941057 ATCCTGGTTCTGATATGGGGAGG + Intergenic
1016339837 6:143050698-143050720 ATCTTAGCTCTGCCATTGACAGG + Intergenic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1019694004 7:2434383-2434405 ATCCTGCTTCTGTAACTGACCGG - Exonic
1021518294 7:21510794-21510816 GTCCTGCTTCTGCTATGAACTGG - Intronic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022620548 7:31979567-31979589 ATCCTGGCTCTGCCATTTACTGG - Intronic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1026397533 7:69971257-69971279 ATTCTGCTTCTGCCATTTACTGG + Intronic
1026455325 7:70567418-70567440 ATCCTGGTTCTGCCACTCTCTGG + Intronic
1027462464 7:78471992-78472014 ATCCTGGTTTTGCCATTTACTGG - Intronic
1030309443 7:108054615-108054637 ATCCTGGTTTTGCCCTTAACAGG + Intronic
1031059829 7:117038497-117038519 ATTTTGGTTCTGCCCTTGACTGG + Intronic
1032188401 7:129747673-129747695 ATCTTGGTTCTGCTGTTTAATGG - Intronic
1037493001 8:19413199-19413221 ATCCAGGTTCTGCCATTTCCAGG + Intronic
1039352472 8:36778229-36778251 GACCTGCTTCTGCCATTGACTGG + Intergenic
1039803951 8:40983028-40983050 GTCCTAGCTCTGCTGTTGACTGG + Intergenic
1039927731 8:41953017-41953039 ATCCTGTTTCTGCTTTCTACTGG + Intronic
1042718384 8:71800996-71801018 ATCCTGACTCTGCCATTGCCTGG + Intergenic
1047009266 8:120653612-120653634 GTCCTGGTTCTGCTATACCCAGG - Intronic
1047158299 8:122347279-122347301 CTCCAGGTTCTGGTAGTGACAGG + Intergenic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1047832336 8:128648616-128648638 AACGTGGTTCTGTGATTGACTGG - Intergenic
1048002990 8:130394910-130394932 CTCCTGGTTCTGCTGTTTGCTGG - Intronic
1049563930 8:143327651-143327673 TTCCTAGCTCTGCTAGTGACTGG + Intronic
1049934362 9:486551-486573 ATCCTGCCTCTGCTACTCACAGG - Intronic
1050164402 9:2748753-2748775 TTCCTAGTTCTGCTATTAATTGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1051640566 9:19221069-19221091 AGCCTGGTTCTGCTTTTTATTGG - Intergenic
1052251534 9:26403808-26403830 TGCCCAGTTCTGCTATTGACTGG - Intergenic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053474082 9:38369557-38369579 GTCCTGATTCTGCTACTCACAGG - Intergenic
1053609103 9:39692922-39692944 ATCCAGGATCTGCTACTCACTGG + Intergenic
1053866947 9:42449192-42449214 ATCCAGGATCTGCTACTCACTGG + Intergenic
1054089213 9:60778567-60778589 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054244422 9:62649476-62649498 ATCCAGGATCTGCTACTCACTGG - Intergenic
1054558549 9:66684019-66684041 ATCCAGGATCTGCTACTCACTGG - Intergenic
1058157482 9:101531750-101531772 ATCCTGGTTCTGCTAAGGTGAGG + Intronic
1058625034 9:106925977-106925999 ATCCTGGTTCTCTTCTTCACGGG - Exonic
1059409982 9:114125686-114125708 ATCCTGGTACCACCATTGACTGG - Intergenic
1059457013 9:114406181-114406203 ATCCCGGCTCTGCCACTGACTGG - Intronic
1059719084 9:116941947-116941969 ATCCTGGCTTTGCTACTGAAAGG + Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060454970 9:123783648-123783670 ATCCTGGCTCTGCCATTTACAGG - Intronic
1061883275 9:133578559-133578581 ATCCTTGGTCTGCAATTGCCAGG + Exonic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1191724159 X:64261304-64261326 GTCCTGGCTCTGCCATTCACTGG - Intergenic
1197028861 X:121789387-121789409 ATCCTGGCTCCACTATTTACAGG + Intergenic
1198089760 X:133316325-133316347 ATCCTGGTTTGGCCATTTACTGG - Intronic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1198659252 X:138949022-138949044 ATCCTGGCCCAGCTACTGACTGG - Intronic