ID: 1183740236

View in Genome Browser
Species Human (GRCh38)
Location 22:39664931-39664953
Sequence TTCCCCCATCCGCCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183740236_1183740243 17 Left 1183740236 22:39664931-39664953 CCCCTCCTGGGCGGATGGGGGAA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1183740243 22:39664971-39664993 CGAGAAGCCACGGGTCGAATTGG 0: 1
1: 0
2: 0
3: 0
4: 21
1183740236_1183740241 8 Left 1183740236 22:39664931-39664953 CCCCTCCTGGGCGGATGGGGGAA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1183740241 22:39664962-39664984 GCACTGTACCGAGAAGCCACGGG 0: 1
1: 0
2: 1
3: 10
4: 86
1183740236_1183740244 18 Left 1183740236 22:39664931-39664953 CCCCTCCTGGGCGGATGGGGGAA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1183740244 22:39664972-39664994 GAGAAGCCACGGGTCGAATTGGG 0: 1
1: 0
2: 0
3: 2
4: 39
1183740236_1183740240 7 Left 1183740236 22:39664931-39664953 CCCCTCCTGGGCGGATGGGGGAA 0: 1
1: 0
2: 1
3: 9
4: 186
Right 1183740240 22:39664961-39664983 TGCACTGTACCGAGAAGCCACGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183740236 Original CRISPR TTCCCCCATCCGCCCAGGAG GGG (reversed) Intronic
900907323 1:5568715-5568737 TTCTCCCTTCACCCCAGGAGTGG - Intergenic
901642107 1:10697896-10697918 TCCCTCCATCGGCCCCGGAGCGG - Intronic
902245064 1:15115279-15115301 TTTGCCGATCCACCCAGGAGTGG + Exonic
902788025 1:18745558-18745580 TTTCCCCATGCACCCAGTAGAGG - Intronic
903042410 1:20541381-20541403 TTCCCCCATACACCAAGCAGCGG + Intergenic
905915227 1:41679740-41679762 TTCCCACATCCTCCCAGGTCTGG - Intronic
907242075 1:53086412-53086434 TTCCACCCTCCTCCCAGGGGTGG - Intergenic
908193292 1:61725152-61725174 CTTCCGCCTCCGCCCAGGAGCGG + Intronic
908474181 1:64471547-64471569 TCCCCCCATGCTCCCGGGAGGGG - Intronic
912412526 1:109488614-109488636 TCCCACCTTCTGCCCAGGAGGGG - Intronic
912473827 1:109923590-109923612 TTCCCCCTCCAGGCCAGGAGGGG + Exonic
912778810 1:112524981-112525003 TTCCCCCAACCACCCACCAGAGG - Exonic
912855503 1:113165573-113165595 TTCCCACTTCCTCCCAGGAAGGG + Intergenic
913961447 1:143340629-143340651 TTCCCCGAGTCGCCCAGGCGCGG - Intergenic
914055800 1:144166202-144166224 TTCCCCGAGTCGCCCAGGCGCGG - Intergenic
914123346 1:144800160-144800182 TTCCCCGAGTCGCCCAGGCGCGG + Intergenic
921129671 1:212208928-212208950 GTCCCCCATCTGTCCAGGTGAGG + Intergenic
922286559 1:224175813-224175835 CTCCTCCACCCGCTCAGGAGGGG + Intronic
924041210 1:239985587-239985609 TTTCCACATCCGGCCAGGCGTGG - Intergenic
1067029903 10:42873026-42873048 TTCCCCGAGTCGCCCAGGCGTGG - Intergenic
1068859698 10:61834944-61834966 GGCCCCCATCCACCCAGGAAGGG + Intergenic
1070975490 10:80603035-80603057 TTCCCCCAACCACCCAGGCAGGG - Intronic
1074365766 10:112856337-112856359 TTCCCACCTCCACCCTGGAGAGG + Intergenic
1075389771 10:122083969-122083991 CTGCCCCATCACCCCAGGAGAGG + Exonic
1075796161 10:125121182-125121204 TTCCCCCAGGAGCCCAGGTGTGG + Intronic
1076726944 10:132418418-132418440 TTCCCTCATGTGCCCTGGAGAGG - Intergenic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1079882551 11:25944826-25944848 TTCCCACATGCCCCCAGGATAGG + Intergenic
1080386978 11:31816182-31816204 TGCCCCCTTCTGCCCCGGAGGGG + Intronic
1082835412 11:57647339-57647361 TTCCTCCATTCCCTCAGGAGGGG - Exonic
1084424851 11:69079046-69079068 CTCACCCACCCGCCCAGTAGAGG - Intronic
1089127784 11:116189530-116189552 TTCCCCTCGCTGCCCAGGAGGGG - Intergenic
1090719760 11:129460423-129460445 TTCCCACATCAGAGCAGGAGGGG + Intergenic
1091375394 12:21855-21877 TTCCTCTATCTGCCCCGGAGAGG + Intergenic
1091848556 12:3677115-3677137 CTCCCATATCCTCCCAGGAGGGG - Intronic
1096142600 12:49254740-49254762 ATCCCCCATCCTCCAGGGAGGGG - Intronic
1096871306 12:54594113-54594135 TTCCCCCGTCCTCCCAGGCTTGG + Intergenic
1097118384 12:56716052-56716074 TTCCAACACCAGCCCAGGAGAGG + Exonic
1101700678 12:107170782-107170804 TCCCTCTATCCTCCCAGGAGGGG + Intergenic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103379348 12:120481734-120481756 TTCCCCCAACCTCCAGGGAGGGG - Intronic
1103552814 12:121748594-121748616 TTCCTCCATGAGCCCAGGAGGGG + Intronic
1104522837 12:129491219-129491241 TTCACTCATCTGCCCAGGGGAGG + Intronic
1107024783 13:35789150-35789172 TTCCCCATTCTGCCCACGAGAGG + Intronic
1107823638 13:44308115-44308137 TGGCCCCATCAGCCCTGGAGGGG - Intergenic
1108082618 13:46752418-46752440 TCCCCCCATCTTCCCAAGAGTGG - Intronic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1115441229 14:33438395-33438417 TTCCCCCATTCGGCCAGGAAAGG - Intronic
1119319422 14:73720758-73720780 TTCCCCCATCTGCAGAGTAGAGG + Intronic
1119891354 14:78184859-78184881 TTCCTCCATCCACCCAGCAAGGG - Intergenic
1121422530 14:93825265-93825287 TTCCACCACCCCCCCGGGAGCGG - Intergenic
1122746504 14:103900061-103900083 TGCCCACATCCGCCCAGGTGGGG + Intergenic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1129819582 15:78588948-78588970 TTCCCAGATTTGCCCAGGAGTGG - Intronic
1130127202 15:81103898-81103920 TTCCCCCATTCACCAAGCAGCGG - Intronic
1130388526 15:83434416-83434438 CTCACACATCCCCCCAGGAGGGG - Intergenic
1133530237 16:6648423-6648445 TTCCCTCATCCGCACATAAGGGG - Intronic
1136219468 16:28819210-28819232 TTCCCCCATCCCCCCATCACAGG + Intergenic
1136994329 16:35177871-35177893 TTTCCCCATTCATCCAGGAGGGG - Intergenic
1137869352 16:51934461-51934483 TCCCCCATTCCCCCCAGGAGAGG - Intergenic
1138405304 16:56788199-56788221 TTCCCCTACCCTCCCAGGAGAGG + Intronic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1145784222 17:27583612-27583634 TTTGCCCACACGCCCAGGAGGGG + Intronic
1145916211 17:28575590-28575612 TTGGCCCATCTGGCCAGGAGAGG - Intronic
1146063186 17:29617614-29617636 TCTCCCCCTCCCCCCAGGAGAGG - Exonic
1148875364 17:50683932-50683954 TTCCCTTCTCCGCCCAGGTGGGG + Exonic
1151665326 17:75542389-75542411 TTCCCCCATCCTGCTGGGAGTGG + Intronic
1152316711 17:79585144-79585166 TGCTCCCATCCTCCCAGCAGTGG - Intergenic
1152352324 17:79790778-79790800 CTGCCCCACACGCCCAGGAGTGG + Intergenic
1153024060 18:657780-657802 TGCCCCCCGCCGCACAGGAGCGG + Exonic
1155462999 18:26104398-26104420 TTCCCCCATCTCCCCATGTGAGG + Intergenic
1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG + Intergenic
1160700798 19:506468-506490 TTCCACCATCCTCCCAGCACAGG - Intergenic
1161531782 19:4793897-4793919 TTCCCCCATCTCAGCAGGAGAGG - Exonic
1163414320 19:17176732-17176754 TTCCCCCATCCTGCCTGGAGTGG + Intronic
1165938274 19:39402848-39402870 TTTCCCCGCCCGCCCAGGACTGG + Intergenic
1166294726 19:41883318-41883340 TTCCCCCAACAGCCGAGGGGAGG - Intronic
1202695285 1_KI270712v1_random:118879-118901 TTCCCCGAGTCGCCCAGGCGCGG - Intergenic
925368360 2:3326077-3326099 TTACCCCTTACCCCCAGGAGAGG - Intronic
926757740 2:16249820-16249842 TTTCCCCATCCACCTTGGAGAGG + Intergenic
927454419 2:23237409-23237431 TCCCCTCCTCGGCCCAGGAGAGG + Intergenic
929281853 2:40088263-40088285 CTCCCTCATCCCCCCAGCAGTGG - Intergenic
932551574 2:72775224-72775246 TTCCCCCAACCTCCAGGGAGGGG - Intronic
934276452 2:91575927-91575949 TTCCCCGAGTCGCCCAGGCGCGG - Intergenic
934921930 2:98351095-98351117 TTCCTCCATCTGCCCAAGAAAGG - Intronic
936686264 2:114830037-114830059 TTCGGCCATCAGCCCAGGAGAGG - Intronic
942108475 2:172656835-172656857 TTCCCCCACCCACACATGAGGGG + Intergenic
943621340 2:190151362-190151384 TTTCCCCATCCCCCCATGACAGG + Intronic
946075627 2:217071318-217071340 CTCCCCCATCAGCCCAGGCATGG + Intergenic
946181389 2:217951118-217951140 TGGCCCCATCCTACCAGGAGTGG + Intronic
948661432 2:239508932-239508954 TGCCCACCTCAGCCCAGGAGAGG - Intergenic
948953106 2:241267803-241267825 TTCTCCCATCCCTCCAGGTGTGG + Intronic
949034031 2:241808102-241808124 CTCCCCCCTCAGCCCAGGAAAGG + Intergenic
1171030358 20:21670947-21670969 TACCCCCATTCACCCAGGACAGG + Intergenic
1171351480 20:24506410-24506432 TTCCCCCAAGCGCCAAAGAGAGG + Intronic
1172903159 20:38349539-38349561 TTTCCACAGCGGCCCAGGAGGGG + Exonic
1174418734 20:50385419-50385441 TCCCCCCACCCTCCGAGGAGGGG + Intergenic
1180823245 22:18846561-18846583 TTCCCCACTGCTCCCAGGAGCGG + Intronic
1180850841 22:19019273-19019295 TTCCCCACTGCTCCCAGGAGTGG - Intergenic
1181079295 22:20403347-20403369 TTCCACCATCCACCCAGGCTTGG + Intronic
1181123671 22:20689660-20689682 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
1181189498 22:21127985-21128007 TTCCCCACTGCTCCCAGGAGCGG - Exonic
1181209703 22:21282510-21282532 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
1181399810 22:22644434-22644456 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
1181649601 22:24251634-24251656 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
1181707770 22:24659112-24659134 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
1183687388 22:39368951-39368973 TTCTCCCATCTGCCCCAGAGGGG + Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1185192339 22:49446865-49446887 TTCCACCCTCCGCCCAGGGCTGG + Intronic
1203217244 22_KI270731v1_random:12923-12945 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
1203273386 22_KI270734v1_random:72467-72489 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
950042467 3:9929022-9929044 TTCACTCATCCGGCCAGGCGCGG + Intronic
951279682 3:20732402-20732424 CTCCTCCATCCCCCCAGTAGAGG - Intergenic
951703075 3:25515500-25515522 TTCCCCCTCCCCCCCAGGATTGG - Intronic
960869885 3:122238192-122238214 CTCCCCTATCCCCCCAGCAGTGG + Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
962344130 3:134607463-134607485 GGCCTCCATCCGCCCAGGACAGG - Intronic
963188874 3:142447470-142447492 TTCCCCCATCCCACCCAGAGCGG - Intronic
963851889 3:150217585-150217607 TTTCCCCATCCCTCTAGGAGAGG - Intergenic
964494205 3:157271109-157271131 TTCACCCCTCAGCCCATGAGGGG - Intronic
967911501 3:194546058-194546080 ATCCCCCATCCTCTGAGGAGTGG - Intergenic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
969156911 4:5219198-5219220 TTTCCCCCTACACCCAGGAGGGG + Intronic
975052249 4:69880331-69880353 TTACCCCTTCAGGCCAGGAGTGG - Intergenic
975608833 4:76183714-76183736 ACCCCCCAACCTCCCAGGAGGGG - Intronic
976946754 4:90779907-90779929 TTCACCCATCTGCACAGGATTGG - Intronic
978154196 4:105471683-105471705 TTACCCCATTCGCCCTAGAGTGG + Intronic
985152214 4:186959258-186959280 TTCCCCCATCCCTGCAGGTGGGG + Intergenic
987708789 5:21484482-21484504 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
988750821 5:34189663-34189685 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
989077112 5:37575473-37575495 TACCCCCATCCTCCAGGGAGAGG + Intronic
991735959 5:69631587-69631609 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991739087 5:69652875-69652897 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991759111 5:69903556-69903578 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
991788225 5:70214566-70214588 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991790662 5:70232616-70232638 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991812453 5:70487226-70487248 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991815413 5:70507703-70507725 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991818548 5:70528992-70529014 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991838340 5:70778622-70778644 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
991880672 5:71214930-71214952 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
991883109 5:71232951-71232973 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
994420919 5:99525833-99525855 TTCCCCACTGCTCCCAGGAGCGG - Intergenic
994486122 5:100388481-100388503 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
995884253 5:116876083-116876105 TTCTCCCATTAGGCCAGGAGGGG - Intergenic
997453737 5:134003349-134003371 TTCCCCTATCTCCCCAGGAGAGG + Intronic
998106727 5:139473554-139473576 TTCCCCCATCCCTTCTGGAGAGG - Intergenic
998411876 5:141917381-141917403 TTCCCCAAGCCACCCAGGAAAGG - Intergenic
1002399028 5:178981002-178981024 TTCCCCCATCCCCCCGGGATTGG - Exonic
1005548894 6:26895968-26895990 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
1006696382 6:35933856-35933878 TTCCCCAATGCCCCCAGCAGAGG + Intergenic
1007688037 6:43678973-43678995 TTCCCCCAAAAGCCAAGGAGGGG - Intronic
1008109755 6:47478605-47478627 CTCCCCCATCCCACGAGGAGGGG - Intronic
1009019643 6:57937078-57937100 TTCCCCACTGCTCCCAGGAGCGG + Intergenic
1012783971 6:103599627-103599649 TCCCCCCACCCGCCAAGGATGGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019100926 6:169628627-169628649 TTCTCTCATCCTCCCAGGACAGG + Intronic
1021891243 7:25188218-25188240 CTCCCCCATCTCACCAGGAGAGG + Intergenic
1023831530 7:44041179-44041201 CTGCCGTATCCGCCCAGGAGGGG + Intergenic
1023877202 7:44293348-44293370 TTCCCCCATATGCCCTGGTGAGG + Intronic
1024029126 7:45442020-45442042 TTCTCCCCTGCTCCCAGGAGAGG + Intergenic
1024082117 7:45864409-45864431 TTCCCACCTGCGGCCAGGAGAGG - Intergenic
1025971006 7:66325488-66325510 TTCCCCCCTCCCCCCAAGACAGG + Intronic
1029672078 7:102040265-102040287 TTCCGTCATCCTCCCTGGAGAGG - Intronic
1029741852 7:102495483-102495505 CTGCCGTATCCGCCCAGGAGGGG + Intronic
1029759843 7:102594652-102594674 CTGCCGTATCCGCCCAGGAGGGG + Intronic
1029777205 7:102690562-102690584 CTGCCGTATCCGCCCAGGAGGGG + Intergenic
1032012918 7:128358754-128358776 TGCCCCCATACTCCCTGGAGAGG - Exonic
1033083537 7:138320974-138320996 TTCCGGCTTCCACCCAGGAGGGG + Intergenic
1034443730 7:151101231-151101253 TTCCCCCACCAGCCCAGGAGGGG - Intronic
1034620926 7:152456531-152456553 TTCCCCATTCCGGCCAGGCGAGG + Intergenic
1035746852 8:1967260-1967282 TTCCCCCATCCCCCCGCGTGTGG - Intergenic
1036433596 8:8712408-8712430 GTCCCCCAGCTGCACAGGAGTGG - Intergenic
1036632043 8:10522841-10522863 TTACCCAATCTGGCCAGGAGTGG + Intergenic
1040750349 8:50698459-50698481 TTCCCCCACCAGTACAGGAGGGG - Intronic
1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG + Intergenic
1042996651 8:74707274-74707296 TGGCCACATCTGCCCAGGAGAGG + Intronic
1045164371 8:99586970-99586992 CTCCCCCATCCCCCCATGACAGG + Intronic
1045336100 8:101205539-101205561 CTCCTCCACCCGCTCAGGAGGGG + Intronic
1045664719 8:104471763-104471785 TTTCTCCTTCTGCCCAGGAGCGG - Intergenic
1049164528 8:141117866-141117888 TTTTCCCAGCAGCCCAGGAGGGG - Intronic
1049272066 8:141701166-141701188 TTCCTCCCTCCGCCCTGGAAAGG - Intergenic
1049570768 8:143369317-143369339 GCCCCACATCCGCCCAGAAGGGG - Intronic
1050583207 9:7082478-7082500 TTCCACCATCAGCCCTGGTGAGG - Intergenic
1056811835 9:89771133-89771155 TTCTCACAGCCACCCAGGAGAGG - Intergenic
1060596679 9:124852968-124852990 ATACCCCTTCCGTCCAGGAGTGG - Intergenic
1189487603 X:41445288-41445310 CTCCCCCAGCAGCCCACGAGTGG + Intergenic
1189492337 X:41480022-41480044 TTCCCCTATGTACCCAGGAGAGG + Intergenic
1189988323 X:46573385-46573407 CGCCCCCATCAGCCCTGGAGTGG - Intergenic
1190127739 X:47721744-47721766 TTGCCCCAGGCGCGCAGGAGTGG + Intergenic
1190894034 X:54597908-54597930 CTCCACCATCCCCCCAGCAGTGG - Intergenic
1192841064 X:74856799-74856821 CTCCCCCATTCCCCCAGCAGTGG + Intronic
1194937756 X:99971184-99971206 CTCCCCCATCCCCACAGCAGTGG - Intergenic
1197226787 X:123961952-123961974 TTCCCCCCTCCGCCCATGCCAGG - Intronic
1198816711 X:140599293-140599315 ATCCACCAACAGCCCAGGAGTGG - Intergenic