ID: 1183741461

View in Genome Browser
Species Human (GRCh38)
Location 22:39670786-39670808
Sequence GGGCCTCTGCAGGTGGTGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183741461_1183741470 15 Left 1183741461 22:39670786-39670808 CCCTGCACCACCTGCAGAGGCCC 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1183741470 22:39670824-39670846 ATGCCACCTATTGTCACACCCGG 0: 1
1: 0
2: 0
3: 15
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183741461 Original CRISPR GGGCCTCTGCAGGTGGTGCA GGG (reversed) Exonic
900115507 1:1026252-1026274 GGGCCTCTGTGGGTGGTGGTGGG + Intronic
900156130 1:1203963-1203985 GGGTCTCTGCAGGGGGGCCACGG + Intronic
900465084 1:2821620-2821642 GGGCCTCAGCTGGTGGGGCTGGG - Intergenic
900487192 1:2928593-2928615 GGGCCTCCGCAGGTGCGGCCGGG + Intergenic
900944467 1:5822102-5822124 GGGCCACTGCAGTAGGTGCCTGG - Intergenic
901028814 1:6294151-6294173 GTGCTGCTGCAGGGGGTGCACGG + Intronic
901194746 1:7434050-7434072 GGGACTCTCCAGGAGGTGGAAGG - Intronic
901493923 1:9610669-9610691 GGGCCTCTCCAGGGGGTGACGGG - Exonic
901508432 1:9701227-9701249 GGGCCACTACAGCTGGAGCAGGG - Intronic
901800469 1:11705277-11705299 GAGCAGCTGCGGGTGGTGCACGG + Intronic
902365214 1:15968759-15968781 GGGGCTATCCAGGTTGTGCATGG - Intronic
902876201 1:19342354-19342376 GAGCCTCTGATGCTGGTGCAGGG - Intronic
903847238 1:26285685-26285707 GGGCCTCTGCAAGTCGTGTGTGG + Intronic
904266406 1:29320716-29320738 GGTGCTCTGCAGCGGGTGCAGGG - Exonic
904345127 1:29862897-29862919 TGGCCTTTGTAGTTGGTGCAGGG - Intergenic
904617142 1:31756050-31756072 CGGCCTCAGCAGGTGGGGCTGGG + Exonic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
904810711 1:33161716-33161738 GGGCAGCTCCAGGTGGTGCAGGG - Intronic
905260833 1:36717154-36717176 TGGCATCGGCAGGTGGAGCAAGG + Intergenic
906125901 1:43426723-43426745 GGGCCACTGCTGGGGGTTCATGG + Exonic
906518892 1:46455889-46455911 GGGCCTCTGCAGCTTGTGGAAGG + Intergenic
906608951 1:47189197-47189219 GGGACTCTGCAGGTGGGACTTGG - Intronic
912533072 1:110340226-110340248 GGGCCTCTGTAGGTGGTCACCGG + Exonic
912623439 1:111188658-111188680 GGGTCTCTCCAGGCAGTGCAAGG - Intronic
912816366 1:112831955-112831977 GTGCCTGTGCAGGTGTGGCATGG + Intergenic
914801304 1:150964542-150964564 GGGCCTTTGGAGGTGGAGAAGGG - Exonic
920312710 1:205058069-205058091 AGGCCTCTGCAGTGGGTGCTGGG + Intronic
920542125 1:206786706-206786728 GGGCCTGTGGAAATGGTGCAAGG + Intergenic
921111882 1:212046442-212046464 GGGCCTCTTGAGGGGGAGCATGG - Intronic
921823003 1:219639255-219639277 GAGCCTCTTCAGGTTGTACATGG + Intergenic
921850577 1:219928663-219928685 GGGCCGCGGGAGGCGGTGCACGG - Intronic
922368520 1:224887777-224887799 GGGCCTGTGCAGATAGCGCATGG - Intergenic
922749598 1:228064353-228064375 GGGCTGCTGCACCTGGTGCATGG + Intergenic
1062875890 10:942829-942851 GGGCCTCTCCCAGGGGTGCAGGG - Intergenic
1063484151 10:6403413-6403435 TGGGCTCTGCAGGTGTTGGATGG - Intergenic
1065389559 10:25168657-25168679 GGGCCCCAGCAAGTGGTTCAAGG - Intergenic
1065538643 10:26739132-26739154 AGGCCTGTGCAGCTGGTGCAGGG - Intronic
1067426851 10:46217177-46217199 GGGCCACTGCAGGATGTGGAGGG + Intergenic
1067567838 10:47351057-47351079 GGCCCGCTGCAGGTCCTGCATGG - Exonic
1069799669 10:71074260-71074282 GGGTCTCTGCAGGTGGGGTTGGG + Intergenic
1069959952 10:72073723-72073745 AGGCCCCTGCAGCTGGAGCAGGG - Intronic
1071108516 10:82127138-82127160 GGGTGGCTGCAGGTGCTGCAAGG + Intronic
1071497390 10:86178571-86178593 GGTCATCTGGAGGTGGCGCATGG - Intronic
1074123854 10:110512815-110512837 GGGCCTATGCAGGTGCTGAGTGG + Intergenic
1075476005 10:122734497-122734519 GGGCCTCAGCAGGGGCTGCGAGG - Intergenic
1076837624 10:133029050-133029072 GGGCATCTGCAGAGGGTCCAAGG + Intergenic
1077080337 11:722151-722173 GGGCCTCTGGACCTGGTGCCTGG + Exonic
1077090192 11:774943-774965 GAGCCCCTGCAGTTGGTGGAGGG - Intronic
1077091244 11:779312-779334 GGGCCAGTGCAGGTGGGGCTGGG - Intronic
1077319696 11:1935718-1935740 GGGCCTCTGGCGGTGCTGGAGGG - Intronic
1078850443 11:15158337-15158359 GGGCCTCTGAGGGTGGGGCCAGG - Intronic
1080647491 11:34197498-34197520 ACGCCCCTGCATGTGGTGCATGG + Exonic
1084376793 11:68783290-68783312 GTGCCGCTTCAGGTGGTGTAGGG - Intronic
1084603647 11:70160676-70160698 GGACATCCTCAGGTGGTGCAGGG - Intronic
1084959629 11:72709733-72709755 GGGGCTCCACAGGTGGGGCAGGG + Intronic
1085357256 11:75849944-75849966 GGGGCTCTCCAGGGGCTGCAAGG - Intronic
1089953584 11:122550969-122550991 GGGCAGCAGCAGGTGCTGCACGG - Intergenic
1090205770 11:124883403-124883425 GGGCCTCTGCAAGTGCTCGAGGG + Intergenic
1090838576 11:130471196-130471218 GGGGTGCTGCAGGTGGTGGACGG + Exonic
1091398636 12:169716-169738 GGCCCCCTGCAGGTGGGGTAAGG - Intronic
1091798973 12:3312873-3312895 GGGGCTCTGCTGGTGCAGCATGG - Intergenic
1092284129 12:7119142-7119164 TGGCCTCTGCTGCTGGTGCCCGG + Intergenic
1094341871 12:29421014-29421036 GTGCCTGTGCCTGTGGTGCAGGG - Intronic
1096616330 12:52835267-52835289 GGGCTCCTGCATGTGGGGCAGGG - Intergenic
1097168267 12:57097115-57097137 GGGCATCTGCAGGTGAGGCCTGG + Exonic
1098381982 12:69879279-69879301 GGTGCTCTGCAGCGGGTGCATGG - Intronic
1099172837 12:79385977-79385999 GGCCCACAGAAGGTGGTGCATGG + Intronic
1099861511 12:88229796-88229818 GGCCCTCCGCAGATGGGGCATGG - Intergenic
1100856504 12:98762191-98762213 TGGCCTATGCAGGTGATCCAGGG - Intronic
1101720814 12:107349115-107349137 GGGCAGCTGCAGGTGGTGACTGG + Intronic
1102166376 12:110810045-110810067 GGCCTTCTGCAGGTGAGGCAGGG - Intergenic
1103764556 12:123271344-123271366 GGGCCTCGGCTGGGGGTGCGGGG - Intronic
1103860158 12:124005933-124005955 GTGCCTCTGCAGTTCTTGCACGG + Intronic
1104857149 12:131907673-131907695 GGGCCTCTTGAGGGGATGCAGGG + Intronic
1104860499 12:131921015-131921037 GGGCCGCTGCCGTGGGTGCAGGG + Intronic
1105220658 13:18323039-18323061 GGGCCAGGGCAGGTGGGGCAGGG + Intergenic
1105402087 13:20104995-20105017 GGGCCACTGGAGGAGGTGCTAGG + Intergenic
1105745811 13:23375780-23375802 GCGCCTCTGCAGGCGGGGCGGGG - Intronic
1108478308 13:50843003-50843025 GGGACTCAGCAGGAGGGGCAGGG - Intronic
1111547325 13:89757807-89757829 GGACCAATGCAGGTGGTACAGGG + Intergenic
1112536131 13:100257613-100257635 AGGCCTCAGCAGGTGGTGGTGGG + Exonic
1113792426 13:113036002-113036024 TGGCCTCAGCAGGTGGAGGATGG + Intronic
1113899639 13:113788978-113789000 GGGCCTTTGCAGGTGCTGCTGGG + Intronic
1114237290 14:20834229-20834251 GGTCCTCTGCAGAGGGGGCATGG + Intergenic
1115446354 14:33494917-33494939 GAGACTCTGCGGGTTGTGCATGG - Intronic
1118941895 14:70346463-70346485 GGTCCTCTGCAGAGGGGGCATGG - Intronic
1119478979 14:74948151-74948173 GGGCCTCTGAAAGAGGTGCCTGG - Intronic
1119774286 14:77238927-77238949 GGGCCGCTGGAGCTGGAGCAGGG + Intronic
1121232578 14:92368701-92368723 GGGGCTCTGAGGGTGGGGCAGGG + Intronic
1121329363 14:93040416-93040438 GGGCCTCTGCAGGTGGGGAGTGG - Intronic
1121580390 14:95025547-95025569 GAGCCACAGCAGGTGGTGCAGGG + Intergenic
1121627629 14:95398168-95398190 GTGCCTCTGTGTGTGGTGCATGG + Intergenic
1121637036 14:95460987-95461009 GGACCTCGGCAGGAGGGGCAGGG + Intronic
1122282966 14:100635111-100635133 GGGTCTCTGCAGGGGCTGAAAGG + Intergenic
1122641508 14:103162474-103162496 TGGCCTCTTCAGCTTGTGCATGG - Intergenic
1122982184 14:105196843-105196865 GGGCCTCGGCAGGTGCGGCCGGG + Intergenic
1123588912 15:21835415-21835437 GGGCCTCTGCATGTCAGGCAAGG - Intergenic
1123804268 15:23854955-23854977 GGGCCCCTGCCCTTGGTGCAGGG + Intergenic
1123808277 15:23897454-23897476 GGGCATCAGCAGGTGGGGCGGGG + Intergenic
1125316757 15:38440726-38440748 AGGTCTCTGCAGGTGGTGAGGGG + Intergenic
1126309623 15:47300902-47300924 AGTCCTCTGCAGGTGGTTTAGGG - Intronic
1126345503 15:47689698-47689720 GGGCATCTGAAGGTGGTGGCAGG - Intronic
1128728778 15:70006679-70006701 AGGCCAGTGCAGGTGGGGCATGG - Intergenic
1129325666 15:74799044-74799066 GGGCCTCAGGAGGAGGTGCAGGG + Intronic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1130919908 15:88335297-88335319 AGGCCTCTCCAGGTGCGGCAGGG - Intergenic
1131435814 15:92420734-92420756 GGGCGTCTGAGGGTGTTGCAGGG - Intronic
1132501270 16:285798-285820 GGGCCTCTGCGGGGCCTGCAGGG - Intronic
1132579171 16:677322-677344 GTGCCCCTGGAGATGGTGCACGG + Exonic
1132579825 16:679843-679865 GGGCCTCTGCTGATGGGGCCGGG + Intronic
1132579852 16:679908-679930 GGGCCTCTGCGGATGGGGCTGGG + Intronic
1132878823 16:2152119-2152141 GGGCTTCTGTATGTGGTACACGG + Intronic
1132893103 16:2214205-2214227 GGGCTGCTGCAGGTAGCGCAGGG + Exonic
1133133300 16:3691606-3691628 GGGCTTCTGCAGGGGCTGCGAGG - Intronic
1136222152 16:28835703-28835725 GGGCAGCTGCTGGTGGTGGATGG - Exonic
1136346496 16:29679368-29679390 GGGCCTCTGGGGGTTGAGCAAGG - Intronic
1136514616 16:30760626-30760648 GGTCTTCTCCAGCTGGTGCATGG + Exonic
1137560217 16:49497549-49497571 GTGGCTCTGCAGGTGGGGCCGGG - Intronic
1138522053 16:57576637-57576659 CGGCCCCTCCAGCTGGTGCATGG - Exonic
1140318797 16:73927621-73927643 CGGCCTTTGCTGGTGGGGCATGG + Intergenic
1140657044 16:77151706-77151728 GGCCCTGGGCAGGTGGTGTAAGG - Intergenic
1141194388 16:81849048-81849070 GGGCCTGTGTGGGTGGTGCAAGG + Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1141574283 16:84954169-84954191 GGCACTTTGCAGGTGGGGCAAGG + Intergenic
1141842305 16:86580970-86580992 GGGCGGCTGCAGGGGGTGCGGGG - Exonic
1141856161 16:86682797-86682819 AGGCCCCTGCATGTGGTGGAGGG - Intergenic
1142137681 16:88459143-88459165 GGGCCTCTGAAGGAGCTGCATGG - Intronic
1142280739 16:89146366-89146388 AGGCCCATGCAGGAGGTGCATGG + Intronic
1142379492 16:89723338-89723360 TGTCCTCTGAAGGTGGGGCAGGG - Exonic
1142412524 16:89923749-89923771 GGGCCTCCGCAGGTGCAGCTGGG + Intronic
1142708666 17:1711256-1711278 GGGGCTCTTCAGGTGGTGAGGGG - Intergenic
1144733757 17:17543362-17543384 GGGCCACTGAATGTGGTGAAGGG - Intronic
1144929923 17:18850985-18851007 GGGGCTCTCCAGCTGGGGCAGGG + Intronic
1145234631 17:21199974-21199996 TGGCATTTGCCGGTGGTGCAGGG - Intronic
1146376463 17:32298138-32298160 GTGCCCCTGGAGATGGTGCATGG + Exonic
1146597336 17:34181588-34181610 GAGGCTGTGCAGGTGGGGCAGGG + Intergenic
1147190255 17:38734245-38734267 GGGCCTCAGCTGGGGGTGGAGGG + Exonic
1147495358 17:40910351-40910373 GGGCCACTGCTTGTGTTGCAGGG - Intergenic
1148685498 17:49498291-49498313 GGGCCTCTGCGTGTGGAGAAGGG - Intronic
1149644175 17:58227776-58227798 GTGCCTCTGCAGGCCCTGCATGG - Intronic
1151884575 17:76916062-76916084 GGGCCTCTGCTGCTGGGGCCTGG + Intronic
1152037631 17:77883227-77883249 GGGCCTCTGCCTCTGCTGCAGGG - Intergenic
1152298198 17:79480570-79480592 GGGGCTGTGCAGGTGGAGGAAGG - Intronic
1152434101 17:80264626-80264648 GGCCCTCTGCATGTGGGTCATGG - Intronic
1152549352 17:81021595-81021617 GGGCATCTGCAGGTGGTAGAGGG - Intergenic
1152763066 17:82119635-82119657 GGGTGCCTGCAGGTGCTGCAAGG + Intronic
1153477768 18:5516123-5516145 GGGGCTCTGGATGTGGTGCTTGG - Intronic
1154503068 18:15005971-15005993 GGGCCTCTGAGGGTGGTACAGGG + Intergenic
1155462462 18:26098261-26098283 GGGCCTTTGCAGGTTGTACCTGG - Intergenic
1156208452 18:34911803-34911825 GAGCCACTTCAGGTGGAGCATGG + Intergenic
1157513691 18:48296175-48296197 GGGCCTGAGCAGGTGGTGGGGGG - Intronic
1157548474 18:48564288-48564310 GGACCTCTGTGGGTGGTGGAGGG + Intronic
1157984614 18:52422918-52422940 GGGCTTGTGCAGGTGGTGGCAGG + Intronic
1158635334 18:59151171-59151193 TGGCCTCTGCAGTCTGTGCAGGG + Intronic
1158661892 18:59396024-59396046 AGGAATCTGCAGGTGGGGCAGGG - Intergenic
1159119247 18:64150252-64150274 GGCACACAGCAGGTGGTGCAGGG + Intergenic
1160242305 18:77132630-77132652 GGGCCTGGGCAGGCGGAGCAGGG - Exonic
1160667057 19:335826-335848 GGTCCTCTGCTGGGGGTGCTGGG + Intronic
1161316160 19:3618662-3618684 GGGCCTCTGTCTGGGGTGCAGGG - Intronic
1161579974 19:5075346-5075368 GGGCCTCAGCAGCTGCTGCCGGG + Intronic
1162100029 19:8333913-8333935 GAGCCTCAGCAGGTGGCACAGGG - Exonic
1162551286 19:11359853-11359875 GGACGGCTGAAGGTGGTGCAGGG - Exonic
1164394285 19:27850337-27850359 GGGCTTGAGCAGGGGGTGCAGGG + Intergenic
1165096849 19:33414153-33414175 GGCCTCCTGCAGGTGGGGCAGGG + Intronic
1165311168 19:35030308-35030330 CGGCCTCTCCGGGTGGCGCAGGG - Intergenic
1165449501 19:35873982-35874004 GGGCCTCTGCAGATGCAGCCAGG + Intronic
1165740690 19:38203567-38203589 TGGCCTTTGGAGGTGCTGCATGG - Intronic
1167573516 19:50305641-50305663 GAGCCACTGCACCTGGTGCAGGG - Intronic
925432293 2:3805512-3805534 GGGTCACTGCAGCTGATGCAAGG - Intronic
926217764 2:10915741-10915763 GGGCCTGGCCAGGGGGTGCAAGG + Intergenic
927484367 2:23478669-23478691 CGGGCTCTGGAGGTGGTGAAGGG + Intronic
928651204 2:33405472-33405494 GGGCCTCTGCAAATGGTGAGAGG - Intergenic
929181471 2:39044731-39044753 GGGCCTATGCAAGTTTTGCAGGG + Intronic
931446455 2:62331203-62331225 GGGTCTGTGCAGATGGTGCGGGG + Intergenic
931829125 2:66032371-66032393 TGGGCTCTGCAGCTGCTGCAAGG - Intergenic
931986957 2:67751429-67751451 GGACATGCGCAGGTGGTGCAAGG + Intergenic
932087112 2:68772268-68772290 GGGCCTCTGGGGGTGGCCCAAGG + Intronic
932597138 2:73101113-73101135 GGGCCTCCCCAGGTGAGGCAAGG + Intronic
933812700 2:86042963-86042985 GGGACTCAGGAGGTGATGCAGGG - Exonic
933994630 2:87659152-87659174 GGTTCACTGCAGCTGGTGCAGGG + Intergenic
934923042 2:98361178-98361200 GGGCCTCTCCAGGGGTGGCAGGG - Intronic
935325273 2:101930036-101930058 GGGCCTCTGCCGGTGTGTCACGG - Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936299226 2:111291761-111291783 GGTTCACTGCAGCTGGTGCAGGG - Intergenic
938502233 2:131836141-131836163 GGGCCTCTGAGGGTGGTACAGGG + Intergenic
943387756 2:187223655-187223677 GGGCATCTGCATCTGGTGAAGGG + Intergenic
946172754 2:217905335-217905357 GGGCCTCTCCAGGTGGAGCAGGG - Intronic
946188067 2:217992386-217992408 GGGGCTCTGGAGCAGGTGCAAGG - Intronic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
949062227 2:241968008-241968030 GGGACCCTGGAGGTGATGCAGGG + Intergenic
1170437574 20:16346197-16346219 GGGCCTCTGCAGGAAGAGCCTGG + Intronic
1170486434 20:16821177-16821199 TTGCCTCTGCAGGTGCTGTAGGG + Intergenic
1170897359 20:20427634-20427656 GGGCCACTGCAGCAGGTGCATGG - Intronic
1171292446 20:23990073-23990095 GGACCTCTGCAGCAGGTGCTAGG - Intergenic
1172749178 20:37237815-37237837 GGGCCCAGGCAGGTGCTGCAAGG - Intronic
1173043754 20:39490281-39490303 GGGCCTCTGTAGCTGGGGGAGGG - Intergenic
1173249033 20:41354883-41354905 GGGGCTCTGCAGGGGGAGCCTGG + Intronic
1173626427 20:44476137-44476159 GGGCCTCGGAAGGTTGTCCACGG + Intronic
1174050726 20:47765564-47765586 GGGCCTCCTCAGGTGGTCCAGGG + Intronic
1175240747 20:57546465-57546487 TGGCCTCTGCAGGTTGAGGAGGG + Intergenic
1175545129 20:59773161-59773183 GGGCCCCTCCTGGAGGTGCAGGG + Intronic
1175787101 20:61718562-61718584 GAGCCTGTGCAGGTGGTGCTTGG - Exonic
1176180632 20:63747816-63747838 GGGCCTCTGGTGGGGGTGCTTGG - Intronic
1176366950 21:6039131-6039153 GGGCCCCTGCAGCAGGTGCGGGG + Intergenic
1176519338 21:7813069-7813091 GGGCCACTGCAGGCTATGCAGGG - Intergenic
1178406920 21:32331999-32332021 GGGCCTCTGCAGGTCTTTCCTGG - Intronic
1178491752 21:33057012-33057034 GGGCCTGTGCAGTTGGAGCAAGG + Intergenic
1178653366 21:34443082-34443104 GGGCCACTGCAGGCTATGCAGGG - Intergenic
1179180173 21:39037971-39037993 GGGCCTCTCCTTCTGGTGCAGGG + Intergenic
1179191460 21:39125983-39126005 GGGTCTCAGCGGGTGGTGAAAGG - Intergenic
1179667553 21:42923123-42923145 GGTCCTCTGCAGAGGGGGCACGG + Intergenic
1179726927 21:43346052-43346074 GGGCCTCTGGAGCTGATGCAGGG + Intergenic
1179756568 21:43499415-43499437 GGGCCCCTGCAGCAGGTGCGGGG - Intergenic
1180611377 22:17100410-17100432 GGGCTTGGGCAGGTGGTGAACGG - Exonic
1180724839 22:17939169-17939191 GGGACTCTGCAGGCCGTGCAGGG - Intronic
1180982228 22:19884216-19884238 TGGCCTCTGCAGGAGGTGGCAGG + Intronic
1181497016 22:23293010-23293032 GGGGCTCTGCTGGTGGGGCTGGG + Intronic
1182623935 22:31632352-31632374 GGGCCTCAGCATGTGGTACAGGG + Intronic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
1183936564 22:41265750-41265772 GGGGCTGAGCAGGTGGTCCATGG + Intronic
1184131315 22:42518338-42518360 GGGCCTCCCAAGGCGGTGCAGGG + Intronic
1184141537 22:42580550-42580572 GGGCCTCCCAAGGCGGTGCAGGG + Intergenic
1184690036 22:46113360-46113382 GGGCCTCTGCCTGTGGAGGAAGG + Intronic
1184957603 22:47902100-47902122 CGGCCTCTGGAGGGGATGCATGG - Intergenic
1185066667 22:48635685-48635707 AGGCCTCTGCAGGTGCAGCCTGG + Intronic
1185221392 22:49630731-49630753 AGGCCTCTGCAGCAGCTGCACGG + Intronic
949889562 3:8723727-8723749 GTGGCTCTGCGGTTGGTGCATGG - Intronic
950143645 3:10632726-10632748 GGTCCTCTGCAGGTGGCTCTGGG + Intronic
952744518 3:36764492-36764514 GGGCGGCTGCAGCTGGTGCGCGG - Intergenic
953976270 3:47383899-47383921 GGGGCTCTGCAGTTGGGGAAGGG - Intronic
954125468 3:48525468-48525490 GGGGCTCTGCAGGGGCTGCGTGG - Intronic
955407154 3:58632826-58632848 GGGCCACGGCAGGTGGGACACGG - Intergenic
957734672 3:84190025-84190047 GGGCCACGGCAGCTGCTGCAGGG + Intergenic
960047757 3:113213281-113213303 GTGCATCTGCAGGTGGCACAAGG - Intronic
960855131 3:122094895-122094917 GTGCCTCTGCAGGTGGCACTAGG - Intronic
961321252 3:126078052-126078074 GGGCCCCTGCAGGTCCTTCAGGG - Intronic
961666775 3:128497665-128497687 GAGCCTCTGCAGCTGGGACAAGG + Intergenic
962254486 3:133861034-133861056 CAGCCTCTGCAGGTGCTGCTGGG - Intronic
962894223 3:139699359-139699381 GGGCCTCTGCTGGTGACTCAGGG + Intergenic
964937950 3:162116892-162116914 GGTCCTCTGCAAGTACTGCATGG - Intergenic
967339928 3:188385406-188385428 GGGCCCTTGCTGGTGGTGGATGG + Intronic
968230032 3:197000083-197000105 GTGCCTGTGCTGGTGGTCCAGGG - Intronic
968658659 4:1789710-1789732 GGGCCTCCGCAGGTTGCCCATGG - Intergenic
968739305 4:2319348-2319370 GGGCCTTGGCAGGTGGTCCTTGG - Intronic
969226968 4:5805002-5805024 GTGCCACTCCAGGTGCTGCATGG - Intronic
972675534 4:41256855-41256877 AGGCCTGTGCAGGGGGAGCAGGG - Exonic
975717150 4:77216154-77216176 GGTCCACAGCAGGTGGTGGAAGG + Intronic
976300047 4:83508367-83508389 GGTCCTCTGCAGAGGGGGCACGG + Intronic
985621993 5:960676-960698 AGGCCTCTGCAGGAGTGGCAGGG - Intergenic
985796229 5:1964135-1964157 GGGCATCTGCAGGTCCTTCAGGG - Intergenic
985801571 5:2007996-2008018 GGGCCTCTGGAACTGGAGCATGG + Intergenic
986233188 5:5885494-5885516 GGGCCTCTCCAGCTGCTCCAGGG - Intergenic
989585813 5:43073171-43073193 GGTCCTCTGCAGAGGGGGCATGG + Intronic
990637027 5:57739894-57739916 AGTACTCTGCAGGTGGAGCATGG + Intergenic
993681476 5:90883840-90883862 GGGCCTCTGCAGGAGTTGATGGG + Intronic
994979480 5:106855148-106855170 GGGCCTCTTCAGCTCATGCATGG + Intergenic
997211247 5:132078292-132078314 GGGCCCCTGGCTGTGGTGCAGGG - Intergenic
997605643 5:135174037-135174059 GGACCTGAGCAGGTGGTGCTGGG - Exonic
997718496 5:136059729-136059751 TGGCCTCTGCAGGTGCAGCCAGG - Intronic
997877133 5:137559565-137559587 GTGCCTCTCCTGGTGGGGCACGG + Intronic
998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG + Intergenic
999302987 5:150502504-150502526 GGGCCTATGCTGGTGGGGGAGGG + Intronic
999755900 5:154664068-154664090 CAGCCTCTGGAGGTGGTGCAGGG + Intergenic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1001097407 5:168786467-168786489 GGTCATCTCCAGATGGTGCAGGG + Intronic
1001791365 5:174460156-174460178 GGGCCTCTCCAGAGGGTCCAGGG + Intergenic
1001791372 5:174460176-174460198 GGGCCTCTCCAGAGGGTCCAGGG + Intergenic
1002707301 5:181170417-181170439 GGGCCTCTGCAGGGGCCGCCTGG - Intergenic
1003734526 6:8863685-8863707 GGTCCTCTGCAGGTTGTCCAAGG - Intergenic
1004671303 6:17800208-17800230 GGGGCTCTGCAGCTGCTGCTTGG + Intronic
1005549235 6:26897564-26897586 GGACCTCTGCAGCAGATGCAAGG - Intergenic
1005549413 6:26898381-26898403 GGACCTCTGCAGCAGATGCAAGG - Intergenic
1006454653 6:34124882-34124904 GGGCCTCTGGATGTGATGCATGG - Intronic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1007428973 6:41765455-41765477 GGGTCTCTGCTGGGGGTGGATGG - Intergenic
1007693040 6:43715079-43715101 GGGCCCCTGCAGGTGCAGCTTGG - Intergenic
1009924534 6:70103979-70104001 GGCCCTCTAGTGGTGGTGCAGGG - Intronic
1010296185 6:74199449-74199471 GGGGCTCTGCAGCTGCTGCAGGG - Intergenic
1017101697 6:150854751-150854773 GCGCTGCTGCAGGGGGTGCAGGG - Intergenic
1018573398 6:165233709-165233731 GGGCATCTGCAGGGAGAGCAAGG + Intergenic
1019105557 6:169664393-169664415 GAGCCTCTGCAGGCCGTGGAGGG - Intronic
1019258271 7:65315-65337 GGGCCTCTGCACAAGATGCACGG - Intergenic
1019428053 7:986652-986674 GGGCCGGTGCAGCTGGAGCAGGG - Exonic
1019595835 7:1857910-1857932 CTGCCTCTGCAGGTTCTGCAGGG - Intronic
1021717034 7:23469874-23469896 GGGCCTGGGCGGGCGGTGCAGGG + Intronic
1022094643 7:27130944-27130966 GGGGCGCTGCACGTGGGGCACGG - Intronic
1024004672 7:45216708-45216730 GGGCCTCTGAGGGTGAGGCAGGG + Intergenic
1026000894 7:66558354-66558376 GGGCCTAGGCAGGGGGTGCAGGG - Intergenic
1027255854 7:76430381-76430403 TGGCCTCAGCATGGGGTGCAGGG + Intronic
1031564742 7:123281756-123281778 GGGCCTCTTCAAATGCTGCATGG + Intergenic
1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG + Intronic
1032987657 7:137356659-137356681 GGGCCTGTCCAGGTGGTGGGAGG - Intergenic
1033514723 7:142094516-142094538 GGGCCTGTGCCGGTAGGGCAGGG + Intronic
1034393649 7:150803852-150803874 GGGCAGCAGCAGGTGGGGCAGGG + Intronic
1035679726 8:1479080-1479102 AGGCCTCTGAGGGTGGAGCAGGG + Intergenic
1038516936 8:28195374-28195396 GAGTGTCTGCAGCTGGTGCAGGG - Intergenic
1039038227 8:33382846-33382868 AGCCCTGTGCAGGTGGGGCAAGG - Intronic
1041146652 8:54883235-54883257 GGGGCTCTGTTGCTGGTGCAGGG + Intergenic
1041663050 8:60417351-60417373 GGCTCTCTGCATATGGTGCACGG - Intergenic
1043909767 8:85849504-85849526 GGGCCTATGCAGGTTGTAAAAGG - Intergenic
1046751731 8:117933908-117933930 GGGCATCTTCACGTGGAGCAAGG - Intronic
1049040667 8:140110254-140110276 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049040786 8:140110688-140110710 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049040859 8:140110907-140110929 GAGCTGCTGCAGGGGGTGCAGGG - Intronic
1049370217 8:142260850-142260872 GAGCCTCTGCAGCTGGGTCAGGG + Intronic
1049376636 8:142292470-142292492 GGGCCTGTGGAGGTGGTGGGTGG + Intronic
1049586715 8:143435787-143435809 GGGCCACTGCGGGAGGTGGATGG - Intergenic
1056137319 9:83642986-83643008 GGTCCTCTGCAGGATGTTCAGGG - Intronic
1057313187 9:93954290-93954312 GGGCCTCTGCAGGGCTTGAACGG - Intronic
1059058858 9:111014213-111014235 AGGCCTCTGGAGGTTGTGAATGG - Intronic
1060218564 9:121752669-121752691 GGGCCTGGTCAGGTGGAGCAGGG + Intronic
1060236823 9:121870152-121870174 GGGCTTCTCCCAGTGGTGCATGG - Intronic
1060915409 9:127386464-127386486 ACGCCACTGCAGGTGGTGCTGGG + Intronic
1060994066 9:127866338-127866360 AGGCCTCTGCAGCTGGTCCTCGG - Intergenic
1062253694 9:135611005-135611027 GGGCTGCACCAGGTGGTGCATGG - Intergenic
1062449270 9:136608710-136608732 GGGCTTCTGCAGGAGGACCAGGG - Intergenic
1062497208 9:136837538-136837560 GGGCCTCTGAGGGTGGTACAGGG - Exonic
1062533128 9:137010444-137010466 TGGGCTCTGGAGGTGGGGCAGGG - Intronic
1062591208 9:137275629-137275651 GGGCGCCTGCAGGGGGTGCCAGG + Intergenic
1188984106 X:36754128-36754150 TGGACTCTGCAGGTGATGCATGG - Intergenic
1188984203 X:36754931-36754953 AGGACTCTGCAAGAGGTGCATGG - Intergenic
1188987193 X:36778488-36778510 AGGACTCTGCAGGTTGTACATGG - Intergenic
1189634538 X:42992139-42992161 GGGTCTGTGCAGTTGGTGGAGGG - Intergenic
1190296463 X:49030388-49030410 GGGCATCTGAGGGCGGTGCAGGG + Exonic
1192232939 X:69278353-69278375 GGGACTCAGCAGCTGGTGCAAGG - Intergenic
1199235527 X:145488048-145488070 CAGCATCTTCAGGTGGTGCAGGG + Intergenic
1200083561 X:153591696-153591718 GGCAGTGTGCAGGTGGTGCAGGG - Intronic
1200119303 X:153782941-153782963 GACTCTCTGCAGGTGCTGCACGG + Exonic
1200129252 X:153831974-153831996 CGGTCTCTGCAGCTGGTGGATGG + Intergenic
1200397288 X:155998703-155998725 CAGCCTCTGCAGGTGGGGCGGGG + Intronic
1201162364 Y:11176780-11176802 GGGCCTCTGCATGCGAGGCAAGG + Intergenic
1202379373 Y:24262268-24262290 GGGCAGGTGGAGGTGGTGCAGGG + Intergenic
1202491409 Y:25407853-25407875 GGGCAGGTGGAGGTGGTGCAGGG - Intergenic