ID: 1183743443

View in Genome Browser
Species Human (GRCh38)
Location 22:39680438-39680460
Sequence GGTCCCCAGGAACCATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 146}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183743439_1183743443 1 Left 1183743439 22:39680414-39680436 CCAGCCTCAGGTGGCTGCAGGGC 0: 1
1: 0
2: 6
3: 55
4: 460
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743428_1183743443 19 Left 1183743428 22:39680396-39680418 CCAGCCCCCAGAGTGGCCCCAGC No data
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743441_1183743443 -3 Left 1183743441 22:39680418-39680440 CCTCAGGTGGCTGCAGGGCAGGT 0: 1
1: 0
2: 5
3: 53
4: 394
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743435_1183743443 3 Left 1183743435 22:39680412-39680434 CCCCAGCCTCAGGTGGCTGCAGG 0: 1
1: 0
2: 6
3: 67
4: 475
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743426_1183743443 30 Left 1183743426 22:39680385-39680407 CCTGGGGTGTTCCAGCCCCCAGA No data
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743429_1183743443 15 Left 1183743429 22:39680400-39680422 CCCCCAGAGTGGCCCCAGCCTCA 0: 1
1: 0
2: 1
3: 38
4: 375
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743430_1183743443 14 Left 1183743430 22:39680401-39680423 CCCCAGAGTGGCCCCAGCCTCAG 0: 1
1: 0
2: 1
3: 52
4: 430
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743437_1183743443 2 Left 1183743437 22:39680413-39680435 CCCAGCCTCAGGTGGCTGCAGGG 0: 1
1: 0
2: 5
3: 57
4: 450
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743433_1183743443 12 Left 1183743433 22:39680403-39680425 CCAGAGTGGCCCCAGCCTCAGGT 0: 1
1: 0
2: 3
3: 26
4: 314
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146
1183743431_1183743443 13 Left 1183743431 22:39680402-39680424 CCCAGAGTGGCCCCAGCCTCAGG 0: 1
1: 0
2: 3
3: 40
4: 433
Right 1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG 0: 1
1: 0
2: 0
3: 23
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183743443 Original CRISPR GGTCCCCAGGAACCATCAGC AGG Intronic
900136743 1:1120984-1121006 GGTCCCCAGGAGCCCTCAGGAGG - Intergenic
900371861 1:2335789-2335811 GGTCCCCAGGGCACATCAGCGGG + Intronic
900391809 1:2436919-2436941 GCTCCCCAGGAGGCCTCAGCTGG - Intronic
903156120 1:21444976-21444998 GGTCACCAGGAACCTTCGCCTGG - Exonic
903304189 1:22401163-22401185 GGGCCCCAGGAAACGTTAGCCGG + Intergenic
907333167 1:53684442-53684464 GGTCCCCATGAACCATCTTAAGG - Intronic
907625478 1:56025151-56025173 GGTCCACAGGAAACATAAGCAGG + Intergenic
907901404 1:58744592-58744614 GTTCCACAGGAACTATGAGCAGG - Intergenic
917666496 1:177230355-177230377 GTTCCCCAGGAGGTATCAGCAGG - Intronic
919850329 1:201668060-201668082 GGGCCCCAGGATCCCTCAGCAGG - Intronic
920084674 1:203406590-203406612 GGTACCCAAGAAACATCAGCTGG - Intergenic
920118178 1:203636038-203636060 AGTCCCCAGGTTCCCTCAGCTGG - Intronic
920501481 1:206488109-206488131 GGCCTCCAAGAACCACCAGCTGG - Intronic
920932315 1:210400505-210400527 GGTCCCCAGCACACACCAGCAGG - Exonic
923541741 1:234893169-234893191 GTGGCCCAGGAACCAGCAGCAGG - Intergenic
923627221 1:235623785-235623807 TCTCCCCAGCAACCAGCAGCTGG + Intronic
1063574714 10:7251503-7251525 TGTCCCCAGTACCCATCAGCGGG + Intronic
1064874149 10:19974340-19974362 GGGCCACAGAAACCACCAGCTGG - Intronic
1069050120 10:63783501-63783523 TGACCCCAGGAACTACCAGCAGG - Intergenic
1071982167 10:91014384-91014406 GATCTCCAGGAGCCAGCAGCAGG + Intergenic
1076653129 10:132003728-132003750 TGGCCCCAGGCACCCTCAGCTGG + Intergenic
1077167539 11:1150571-1150593 GAACCCCAGGCACCTTCAGCAGG - Intergenic
1077188011 11:1244035-1244057 GGTCTGCAGGAACCGTGAGCAGG + Exonic
1077188437 11:1245706-1245728 GGTCTGCAGGAACCGTGAGCAGG + Exonic
1077188967 11:1247806-1247828 GGTCTGCAGGAACCGTGAGCAGG + Exonic
1077189395 11:1249477-1249499 GGTCTGCAGGAACCGTGAGCAGG + Exonic
1077334730 11:1998199-1998221 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1078116426 11:8456501-8456523 GGTGCTCGGGAACTATCAGCTGG + Intronic
1082068446 11:47919461-47919483 GGGGCCCAGGACCCAGCAGCTGG + Intergenic
1083263746 11:61536741-61536763 GGTCTCCAGGAGCCACCAGAGGG + Intronic
1084067590 11:66714238-66714260 GGGCTCCAGGAACCATGAGCTGG - Intronic
1084561970 11:69910377-69910399 GATCCCCAGGACCCCTCGGCTGG - Intergenic
1088115681 11:106310136-106310158 TCTCCCCAGGAACCATCTCCTGG - Intergenic
1088152556 11:106762948-106762970 GGTTCACAGGAATAATCAGCAGG - Intronic
1089570183 11:119402652-119402674 GGTCCCCAAGTACCCCCAGCTGG + Intergenic
1090613584 11:128494299-128494321 GGTCCCAAGGAATAATCAGTGGG - Intronic
1091356234 11:134940015-134940037 GGTCCCCAGCCTCCAACAGCAGG - Intergenic
1202817713 11_KI270721v1_random:53381-53403 AGTCCCCAGGGACCCGCAGCTGG - Intergenic
1095628127 12:44342332-44342354 GTTGCCCAGAATCCATCAGCTGG - Intronic
1096070661 12:48773850-48773872 GGTCCCCAGCGCCCATCACCAGG + Intronic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1096370849 12:51067804-51067826 GGACCCCAGAAGCCCTCAGCAGG + Exonic
1096614557 12:52824403-52824425 AGGCCCCAGGAAGCATCAGAGGG + Intronic
1096614566 12:52824437-52824459 GGCCCCCAGGTAGCATCAGGAGG + Intronic
1108760608 13:53558984-53559006 TGTCCCCAGACACCATTAGCTGG - Intergenic
1110218663 13:73050547-73050569 GGACCCTAGGAAGCATCAGGAGG + Intergenic
1113386687 13:109855309-109855331 GCTTCCCAGTAAGCATCAGCAGG + Intergenic
1113887203 13:113667222-113667244 GGTCCCCAGGAACCCTCGACAGG + Exonic
1121431819 14:93893155-93893177 GGTACCCAGGAAGCAACAACAGG + Intergenic
1121456461 14:94041799-94041821 GGGCCCAAGGAACCCACAGCCGG - Intronic
1121981202 14:98456026-98456048 TGGCCCCAGCAACCAACAGCTGG - Intergenic
1122324677 14:100875170-100875192 GGTCCCCAGAAGCTGTCAGCTGG + Intergenic
1122695302 14:103549477-103549499 GGTGCCCAGCAAGCATCTGCAGG - Intergenic
1122784627 14:104157992-104158014 GGTCCCCAGGGGCCCACAGCCGG - Intronic
1122977803 14:105178154-105178176 TGGCCCAAGGAAGCATCAGCAGG - Intronic
1128791676 15:70438986-70439008 TGTCCCCAGCCACCATCAGTTGG + Intergenic
1137828967 16:51525857-51525879 GGTGCACAAGAACCATCTGCTGG - Intergenic
1140328194 16:74026572-74026594 GAACCCCAGGAAGCATCTGCGGG + Intergenic
1141359594 16:83383160-83383182 GGTCCCGAGGAAACATCAGATGG - Intronic
1141613558 16:85197554-85197576 TGTCCCCAGGACCCATCTTCTGG - Intergenic
1141637652 16:85323292-85323314 GGTCTCCAGCAACCCTCAGAAGG - Intergenic
1141660836 16:85440709-85440731 AGGCCCCAGGAACCATCACGGGG + Intergenic
1141808936 16:86361026-86361048 GGTCACCAGGACCCCTCAGTGGG + Intergenic
1142088505 16:88197622-88197644 GGGCCCCAGGAACCATGGGGAGG - Intergenic
1142967209 17:3589090-3589112 TGTCACCAGGAGCCACCAGCTGG + Intronic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1146560558 17:33865227-33865249 CGTCCCCAGGAGCCATGAGATGG + Intronic
1147265537 17:39232187-39232209 GGTCCCCAGGCTGCTTCAGCTGG - Intergenic
1147635119 17:41959339-41959361 GGACCCCAGGAAGTATCTGCTGG + Intronic
1147670529 17:42174405-42174427 GCCCACCAGGCACCATCAGCTGG - Intronic
1149865992 17:60151199-60151221 GGACCCCAAGAACCATCCGAGGG - Intronic
1150137297 17:62703057-62703079 TGTGCCCAGGAACCAGCACCAGG - Intronic
1155310475 18:24518190-24518212 CGTCCTCAGAAACCATCAGCAGG - Intergenic
1159942944 18:74422583-74422605 GGACCCCTGGAAGCAGCAGCAGG + Intergenic
1160365077 18:78317364-78317386 GTTCCTCAGGAACCGTAAGCGGG + Intergenic
1160365281 18:78319345-78319367 GGTGGCCTGGAACCCTCAGCAGG - Intergenic
1161579956 19:5075267-5075289 GGGCCCCCGGAACCAACACCAGG - Intronic
1162525114 19:11202325-11202347 GGTCCCCAGGAAACAGCACTTGG + Intronic
1164696863 19:30251464-30251486 GGGCCCTGGGAACCATCAGCAGG - Intronic
1165324984 19:35109205-35109227 GGGCCCCAGGAACAGTCAGCAGG - Intergenic
1168433943 19:56302862-56302884 AGTCCCCAGCAACCAGCAACAGG - Intronic
925160617 2:1681119-1681141 GGTCCCCAGGCCCCTCCAGCCGG + Intronic
925590329 2:5502970-5502992 GGTCCCCAGAAAGCACCAGAAGG - Intergenic
929125656 2:38520733-38520755 GTTTCCCAGGCTCCATCAGCTGG + Intergenic
932451582 2:71813993-71814015 GGTCTCCAGGGAACATCTGCTGG + Intergenic
933950118 2:87321985-87322007 GAGCCTCAGGAACCATGAGCAGG + Intergenic
935729967 2:106057145-106057167 GGTGCCCAGGGTCCATCAGATGG + Intergenic
936037153 2:109122272-109122294 GGACCCTAGGAAACATCAACAGG + Intergenic
936330072 2:111539612-111539634 GAGCCCCAGGAACCATGAGCAGG - Intergenic
937359285 2:121217804-121217826 GGTCCCCAGGAACAGGAAGCAGG + Exonic
937958977 2:127439914-127439936 AGGCCCCAGGAGCCTTCAGCAGG + Intronic
938278757 2:130050354-130050376 GGTCCCCAGGGAGGATCAGGGGG + Intergenic
938329731 2:130441213-130441235 GGTCCCCAGGGAGGATCAGGGGG + Intergenic
938360215 2:130680290-130680312 GGTCCCCAGGGAGGATCAGGGGG - Intergenic
938452008 2:131429426-131429448 GCTCCCCTGGACCCATCAGCTGG + Intergenic
944912333 2:204322841-204322863 GTGCCCCAGGAACCATCAGTAGG - Intergenic
945949620 2:216026167-216026189 TGTCCCCAGCAGCCATCAGCTGG - Intronic
948623756 2:239253786-239253808 GGGCCCCAGGAACAGGCAGCTGG - Intronic
1168893487 20:1308800-1308822 TGTCCCCAGGAACCACCTTCTGG + Exonic
1169305326 20:4484866-4484888 GCTCCCCAGGGACCATAGGCGGG - Intergenic
1169357261 20:4917671-4917693 GGTCCCCAGGGACAGACAGCTGG - Intronic
1169373021 20:5043193-5043215 GCTCCCCAGGAATCCTCAGCTGG + Intergenic
1174215464 20:48912714-48912736 TGATCCCAGGACCCATCAGCAGG - Intergenic
1174370801 20:50086088-50086110 GGTCACTAGGAGCCATCAGAGGG - Intronic
1179730360 21:43364132-43364154 GGTCCCCGCTGACCATCAGCAGG - Intergenic
1179902973 21:44403267-44403289 AGGCCCCAGGACCCAGCAGCTGG - Intronic
1183062573 22:35345248-35345270 GGTCCCCAGGTTCCATCCCCTGG - Intronic
1183743443 22:39680438-39680460 GGTCCCCAGGAACCATCAGCAGG + Intronic
1184241934 22:43215646-43215668 GGTCCCCAGGAAAAACCAGAGGG + Intronic
1184449667 22:44575548-44575570 GGTGCCCAGCACCCAGCAGCAGG + Intergenic
1185276359 22:49951677-49951699 GGTCACCAGGCCCCATCAGGAGG + Intergenic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
954301016 3:49700798-49700820 GGTCCCCTGGGAGCATCAGGAGG + Intronic
956587948 3:70884094-70884116 GGTCCCCAGTAAAGGTCAGCAGG - Intergenic
956727699 3:72170094-72170116 GGTCCCCAGGAGACATGGGCAGG - Intergenic
959505391 3:107151361-107151383 GGCCTCCAGGAGCCATGAGCAGG - Intergenic
968966557 4:3771836-3771858 GGTACACAGGAACCCTGAGCAGG - Intergenic
968970437 4:3790954-3790976 TGTCCTCAGGAAACATGAGCAGG - Intergenic
968981753 4:3853891-3853913 GGTGCTCAGTAAACATCAGCAGG - Intergenic
969401136 4:6956466-6956488 CGTGCGCAGGAGCCATCAGCGGG - Intronic
973872465 4:55180124-55180146 GGTCCCCAGACTCCAACAGCAGG + Intergenic
973954369 4:56048908-56048930 GGTGCCCAGAAACCAGGAGCGGG - Intergenic
978379403 4:108111351-108111373 GGTCCCCAGGTACACTCAGCAGG - Intronic
982627799 4:157789201-157789223 GGTGCCAAGAAACCATCAGAGGG + Intergenic
985493679 5:193145-193167 GTTCCCCAGGACCCATCACTGGG - Intronic
992204873 5:74421514-74421536 GGTCCCCTGGAGCCCTAAGCTGG + Intergenic
997356740 5:133267326-133267348 GGGCCCCAGGACCCATGAGAGGG + Intronic
1000473718 5:161678629-161678651 GGTCCCCATGAACATTCAGCAGG - Intronic
1009787160 6:68354813-68354835 GGTCCCCTGGAATCAACATCAGG + Intergenic
1010583246 6:77625850-77625872 TGTCCCCAGCAGCCACCAGCTGG + Intergenic
1011296041 6:85827243-85827265 GGACCCCAGGAATCATATGCAGG - Intergenic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1016028676 6:139315025-139315047 GGTCCCCAGGAACAATTTGGGGG - Intergenic
1016395147 6:143616554-143616576 GGTGACCAGGAAACATCACCAGG - Intronic
1017788697 6:157776664-157776686 CGCCACCAGGAACCATCACCAGG - Intronic
1019322696 7:422833-422855 GGACCCCTGGAACCAACACCCGG - Intergenic
1019390374 7:783462-783484 GGTCCCCAGGACCCTTCAGAGGG - Intronic
1022138256 7:27469100-27469122 AGTTCCCAGGGAGCATCAGCTGG + Intergenic
1029407297 7:100383199-100383221 GGTACCCTGGGACCAGCAGCAGG + Intronic
1029422361 7:100478030-100478052 GAGCCCCAGGGACCATGAGCGGG - Exonic
1029499335 7:100918321-100918343 TCTTCCCAGGAACCCTCAGCTGG + Intergenic
1029561098 7:101303326-101303348 GGTCCCCAGGAAAGCTCAGGCGG - Intergenic
1032002655 7:128275542-128275564 GGTCACCAGGATCCCTCATCTGG - Intergenic
1034337795 7:150334582-150334604 GGGATCCAGGCACCATCAGCAGG - Intronic
1035118394 7:156544454-156544476 GGGCCCCAGGAACCAGCACACGG + Intergenic
1035167421 7:157000005-157000027 GGTCCTCAGGAAGCCTCGGCCGG + Intronic
1037619225 8:20548788-20548810 GGTCTTCAGGAGCCATCAGAGGG + Intergenic
1042556691 8:70039347-70039369 GTACCCCAGGAACCAGGAGCGGG + Intergenic
1042859652 8:73299299-73299321 GGTCCCCAGGAACAGGCAGCAGG + Intronic
1043645744 8:82516515-82516537 GCTCCCCAAGAACCACCAGAAGG - Intergenic
1045347046 8:101302863-101302885 TCTCCCCAGGAACCATGACCGGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049368007 8:142250015-142250037 GCTGCCCAGGACCCCTCAGCAGG - Intronic
1049979413 9:890605-890627 GGTGCCCAGAAACCATCCACTGG - Intronic
1052198002 9:25741809-25741831 GAACCCCAGGAAGAATCAGCAGG - Intergenic
1057266183 9:93619588-93619610 GGCCACCAGGAACCACCAGCAGG - Intronic
1057471989 9:95366208-95366230 AGTCCCCAGGAAACAGTAGCTGG + Intergenic
1059475990 9:114548147-114548169 GCACTCCAGGAAGCATCAGCTGG + Intergenic
1060151129 9:121289105-121289127 GGGCCCCAGCAAGCAACAGCAGG + Intronic
1061557792 9:131382586-131382608 GGTCCGAACGAACCAGCAGCAGG - Intergenic
1061825416 9:133255680-133255702 GGTGCCCAAGAACCACCAGGCGG - Exonic
1062049391 9:134439269-134439291 GGTCCCCAGGAAGCAGCCACTGG - Intronic
1062574897 9:137201424-137201446 GGTCCCCAAAAAGCATCTGCAGG + Intronic
1187156376 X:16724031-16724053 AGTCCCCAAGAACCATCCCCAGG + Intronic
1187505605 X:19875875-19875897 GGACCCCAAGAAGCAGCAGCTGG - Intronic
1187551128 X:20306884-20306906 AGTCCCAAGGAACCATCAAAGGG - Intergenic
1190707732 X:53044640-53044662 GGTCCCCAGGGTGCATCAGCAGG - Intergenic
1192151890 X:68717805-68717827 GGTCCCCAGGAACGTGCACCAGG - Exonic
1195750968 X:108161777-108161799 GGTCCCCAGGCACCTTCCCCAGG + Intronic
1198039738 X:132838303-132838325 AGATCCCAGGAACCATCCGCTGG + Intronic