ID: 1183744774

View in Genome Browser
Species Human (GRCh38)
Location 22:39686055-39686077
Sequence GAGGAGGGCCGCGGTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 530}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183744756_1183744774 21 Left 1183744756 22:39686011-39686033 CCAGCCCGGGCTGCACCCACCAC 0: 1
1: 0
2: 1
3: 25
4: 470
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744765_1183744774 -6 Left 1183744765 22:39686038-39686060 CCATGGACCCCTCGGACGAGGAG 0: 1
1: 0
2: 1
3: 6
4: 70
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744757_1183744774 17 Left 1183744757 22:39686015-39686037 CCCGGGCTGCACCCACCACGACT 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744760_1183744774 6 Left 1183744760 22:39686026-39686048 CCCACCACGACTCCATGGACCCC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744758_1183744774 16 Left 1183744758 22:39686016-39686038 CCGGGCTGCACCCACCACGACTC 0: 1
1: 1
2: 3
3: 13
4: 199
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744762_1183744774 2 Left 1183744762 22:39686030-39686052 CCACGACTCCATGGACCCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744761_1183744774 5 Left 1183744761 22:39686027-39686049 CCACCACGACTCCATGGACCCCT 0: 1
1: 0
2: 2
3: 9
4: 142
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530
1183744755_1183744774 24 Left 1183744755 22:39686008-39686030 CCACCAGCCCGGGCTGCACCCAC 0: 1
1: 0
2: 1
3: 48
4: 478
Right 1183744774 22:39686055-39686077 GAGGAGGGCCGCGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 37
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183744774 Original CRISPR GAGGAGGGCCGCGGTGGCGC GGG Exonic