ID: 1183747006

View in Genome Browser
Species Human (GRCh38)
Location 22:39697852-39697874
Sequence CCTCATTCGCAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183747006_1183747014 -8 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747014 22:39697867-39697889 GAATGAGGAATGGAGGCTGGGGG No data
1183747006_1183747017 14 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747017 22:39697889-39697911 GAGGTGAAGCAACCTCTCCAGGG No data
1183747006_1183747016 13 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747016 22:39697888-39697910 GGAGGTGAAGCAACCTCTCCAGG No data
1183747006_1183747019 28 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747019 22:39697903-39697925 TCTCCAGGGACCCCACCCACAGG No data
1183747006_1183747020 29 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747020 22:39697904-39697926 CTCCAGGGACCCCACCCACAGGG No data
1183747006_1183747013 -9 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747013 22:39697866-39697888 CGAATGAGGAATGGAGGCTGGGG No data
1183747006_1183747012 -10 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747012 22:39697865-39697887 GCGAATGAGGAATGGAGGCTGGG No data
1183747006_1183747015 -5 Left 1183747006 22:39697852-39697874 CCTTCCTGCTTCTGCGAATGAGG No data
Right 1183747015 22:39697870-39697892 TGAGGAATGGAGGCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183747006 Original CRISPR CCTCATTCGCAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr