ID: 1183751743

View in Genome Browser
Species Human (GRCh38)
Location 22:39724917-39724939
Sequence CTCAAGCCTCAGGTGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183751743_1183751753 7 Left 1183751743 22:39724917-39724939 CCCCACCCCACCTGAGGCTTGAG No data
Right 1183751753 22:39724947-39724969 CTAATGTTCCTGCTGGGCCCTGG No data
1183751743_1183751750 0 Left 1183751743 22:39724917-39724939 CCCCACCCCACCTGAGGCTTGAG No data
Right 1183751750 22:39724940-39724962 ACACTTCCTAATGTTCCTGCTGG No data
1183751743_1183751755 17 Left 1183751743 22:39724917-39724939 CCCCACCCCACCTGAGGCTTGAG No data
Right 1183751755 22:39724957-39724979 TGCTGGGCCCTGGCCCTGCTTGG No data
1183751743_1183751751 1 Left 1183751743 22:39724917-39724939 CCCCACCCCACCTGAGGCTTGAG No data
Right 1183751751 22:39724941-39724963 CACTTCCTAATGTTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183751743 Original CRISPR CTCAAGCCTCAGGTGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr