ID: 1183751881

View in Genome Browser
Species Human (GRCh38)
Location 22:39725563-39725585
Sequence CTGAGTCATGTCTGCTATTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183751881_1183751883 -4 Left 1183751881 22:39725563-39725585 CCCGAATAGCAGACATGACTCAG No data
Right 1183751883 22:39725582-39725604 TCAGCTGTAAGCTATAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183751881 Original CRISPR CTGAGTCATGTCTGCTATTC GGG (reversed) Intergenic
No off target data available for this crispr