ID: 1183753128

View in Genome Browser
Species Human (GRCh38)
Location 22:39733526-39733548
Sequence GACCCTGACTACTGCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183753127_1183753128 -1 Left 1183753127 22:39733504-39733526 CCATGGTTCAAGGTCTGGCTTTG No data
Right 1183753128 22:39733526-39733548 GACCCTGACTACTGCCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183753128 Original CRISPR GACCCTGACTACTGCCTGTG TGG Intergenic