ID: 1183755623

View in Genome Browser
Species Human (GRCh38)
Location 22:39760744-39760766
Sequence GTATAGCCAAAGTCCTACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183755623 Original CRISPR GTATAGCCAAAGTCCTACTG AGG (reversed) Intronic
910373063 1:86538867-86538889 GTACAGGCAAAGTCCCACGGGGG + Intergenic
918730870 1:187994507-187994529 AGATATCCAAAGTCCTTCTGAGG - Intergenic
921123781 1:212159210-212159232 GTGGAGCCAGAGTCCAACTGGGG + Intergenic
923250187 1:232173040-232173062 GAACAACCCAAGTCCTACTGAGG - Intergenic
1065386329 10:25137143-25137165 GTATACACAGACTCCTACTGGGG + Intergenic
1077899595 11:6478182-6478204 TTGTAGCCAAATTCCTCCTGAGG + Exonic
1080785218 11:35469297-35469319 GTATTGCCAAAGTTCTCCAGGGG + Intronic
1083328838 11:61887494-61887516 ATAAAGCCAAAGTCCTTCCGAGG + Intronic
1088033766 11:105286183-105286205 GAATAGCCAAAGTAATCCTGAGG + Intergenic
1093260971 12:16937536-16937558 GTTTACCCAAAGTCATTCTGGGG + Intergenic
1093471842 12:19510623-19510645 ATAGAGCCAAAGTCATACTTTGG + Intronic
1097384879 12:58938696-58938718 GTATATACAAAGTCCTCCTATGG + Intergenic
1097561962 12:61218703-61218725 GGATAGACAAAGTCTTAGTGAGG - Intergenic
1103280082 12:119750440-119750462 GTATACACAAAGACATACTGTGG + Intronic
1105656179 13:22441290-22441312 ATTTGGACAAAGTCCTACTGAGG + Intergenic
1107242545 13:38254045-38254067 ATATAGCCAAAGTCATTCTAGGG - Intergenic
1114326759 14:21596894-21596916 GAATAGCCAAAGTAATCCTGAGG + Intergenic
1114820651 14:26014961-26014983 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1116122721 14:40741254-40741276 GTAAAGCCAAAGAGCTTCTGTGG - Intergenic
1119109860 14:71961341-71961363 TTATAGCCAATGCCCAACTGAGG + Intronic
1120597217 14:86455922-86455944 GTATATCCATGGTCCTATTGTGG - Intergenic
1121912787 14:97807104-97807126 ATACAGCCAGAGTCCTATTGGGG + Intergenic
1124511189 15:30327364-30327386 CTACAGCCTAAGTCCAACTGAGG - Intergenic
1124731725 15:32203401-32203423 CTACAGCCTAAGTCCAACTGAGG + Intergenic
1143730564 17:8880519-8880541 GCAGAGCCATAGTCCCACTGTGG - Exonic
1143859041 17:9874532-9874554 GTCTACCCAAAGTCCTCCTAGGG + Intronic
1146505256 17:33399356-33399378 GGATAGCCAAAGGCACACTGGGG + Intronic
1147758665 17:42783902-42783924 GCATAGCCAGAGTCCTGGTGGGG - Intronic
1148534329 17:48426111-48426133 GTATAGTAAAATTCCAACTGTGG - Intronic
1148674332 17:49436344-49436366 ATAAATCCAAAGTCCTAATGAGG + Intronic
1151209212 17:72531492-72531514 ATGTAGCCAAATTCCTTCTGAGG + Intergenic
1157985775 18:52435971-52435993 ATAGAGACAATGTCCTACTGGGG - Intronic
1159561355 18:69998597-69998619 GTAAAGCCAAATGCCTTCTGTGG - Intergenic
1165866620 19:38943197-38943219 AAAAAGCCAAAGTCCTCCTGTGG - Intronic
930980571 2:57521390-57521412 GTATAGCCAAAGTCATCCTGAGG - Intergenic
932346418 2:70998507-70998529 GTATTACCAAAGTACTACTTTGG - Intergenic
932717466 2:74111960-74111982 GAAGAGCCAAAGTCTTCCTGTGG - Intergenic
935926349 2:108073959-108073981 GTATAGCCAAGGCACTATTGTGG - Intergenic
940531124 2:154877600-154877622 GTATAGCAACAGTCCTACTGGGG - Intergenic
941235183 2:162962646-162962668 ATATAGCCAACCTCCTACTCAGG - Intergenic
941529862 2:166654636-166654658 GTATAGCCAAAGCAGTCCTGAGG - Intergenic
943808737 2:192157198-192157220 GTATAGATAAAGTCTGACTGAGG + Intronic
943856529 2:192800812-192800834 GTAAGGCCAAAATCCAACTGGGG + Intergenic
945012496 2:205480246-205480268 CTAGAGCCAAAGCCCTAATGAGG - Intronic
945861699 2:215130181-215130203 GAATAGCCAAAGTACTCCTAAGG - Intronic
948693847 2:239722878-239722900 GGATGGCCAAAGTCCAGCTGAGG + Intergenic
1173405453 20:42760429-42760451 GTATTGCCAGTGTGCTACTGAGG - Intronic
1183755623 22:39760744-39760766 GTATAGCCAAAGTCCTACTGAGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
951599682 3:24359776-24359798 ATAAAGCCAAAGTCATGCTGAGG - Intronic
958670169 3:97193752-97193774 CTATAGCTAAAGTCATACTGTGG - Intronic
959834498 3:110902757-110902779 GTAGAGCCACAGTCAGACTGTGG + Intergenic
971888253 4:32481709-32481731 GTTTAGGCAAAGTCCAACTTAGG - Intergenic
973804708 4:54514639-54514661 CACTAGCCTAAGTCCTACTGAGG - Intergenic
975657142 4:76653009-76653031 ATATAGCAAAAGTCCTACTGAGG - Intronic
976703989 4:88002807-88002829 GTAAAGTCAAAGTCTTACTGTGG + Intergenic
981952450 4:150425008-150425030 ATACAGCCAAAATCTTACTGTGG + Intronic
987530224 5:19108991-19109013 GAATAGCCAAAGCAATACTGAGG - Intergenic
1008338034 6:50330032-50330054 GTTTACTCAAAGTGCTACTGAGG + Intergenic
1008718422 6:54318383-54318405 CTCAAGCCAAAGTCCTAATGAGG + Intronic
1010097472 6:72063488-72063510 GTATGCCCAAAGTCCTGCTCTGG - Intronic
1016247038 6:141994965-141994987 GTAGGACCAAAGTCCTACTTGGG - Intergenic
1016444041 6:144114484-144114506 GTATAGCCAAAGACCTTTTGGGG + Intergenic
1022649864 7:32264820-32264842 GCCTAGCGAAAGTTCTACTGAGG + Intronic
1026622845 7:71965616-71965638 GTATAGCTAAATTCCTACATAGG + Intronic
1031892660 7:127312974-127312996 GAATAGCCAAAGCCATCCTGAGG + Intergenic
1040456008 8:47598694-47598716 GTATAGCAAACATCCTGCTGTGG + Intronic
1043231509 8:77807995-77808017 GAATAGCCAAAGCAATACTGAGG + Intergenic
1050063899 9:1738619-1738641 GTACTGCGAATGTCCTACTGGGG + Intergenic
1055555616 9:77470576-77470598 CTATAGCTAAAGTGCTACAGAGG + Intronic
1056379475 9:86044190-86044212 ACATTGCCAAAGGCCTACTGGGG + Intronic
1058931955 9:109729396-109729418 GTATAGCCAAAGGCATCATGAGG + Intronic
1060357063 9:122919122-122919144 GTGTAGACAAAGGCCTACAGTGG - Exonic
1187963977 X:24592686-24592708 GTAAAACCAAAGTCCTCCAGTGG + Intronic
1189762145 X:44332639-44332661 GCATAGCCGGAATCCTACTGAGG + Intronic
1190734907 X:53249904-53249926 GTCTAGCCAAAGGCCGACTGAGG + Intronic