ID: 1183758150

View in Genome Browser
Species Human (GRCh38)
Location 22:39790073-39790095
Sequence CTGAATGTGCAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 451}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183758144_1183758150 10 Left 1183758144 22:39790040-39790062 CCAGGAACACCAACAGGTCTAAG 0: 1
1: 0
2: 0
3: 3
4: 126
Right 1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG 0: 1
1: 0
2: 5
3: 55
4: 451
1183758146_1183758150 1 Left 1183758146 22:39790049-39790071 CCAACAGGTCTAAGATGGCTGTG 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG 0: 1
1: 0
2: 5
3: 55
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183758150 Original CRISPR CTGAATGTGCAGAAGGAGAA GGG Intronic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902971304 1:20053707-20053729 CTAAATCTGCAGGAGGAGAAGGG - Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903467244 1:23560093-23560115 CTGAGATTGCAGAAGGAGGAGGG + Intergenic
903692877 1:25186624-25186646 CTGTGTGGGCGGAAGGAGAAGGG - Intergenic
903976059 1:27150996-27151018 CTGAGAGTGCAGAGGGAGCATGG + Intronic
904296993 1:29526230-29526252 CAGAATGTACAGGAGGAGAGTGG + Intergenic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904603239 1:31684813-31684835 CTGAAGGGGCAGAAGGTGAGAGG - Exonic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
905270180 1:36782450-36782472 CTGAGTGCTCAGAAAGAGAAGGG + Intergenic
905407351 1:37743629-37743651 CTGAAAGTGCAAAAATAGAATGG - Intronic
906776575 1:48535154-48535176 GTGAATGTGCAGAAGGACTTAGG + Intronic
907278651 1:53330647-53330669 CTAAATGTGAAAAATGAGAAAGG + Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907488678 1:54794968-54794990 CTCAGTGTGCAGGAGCAGAAAGG - Intronic
907776389 1:57519727-57519749 ATTAATGTGCAGTAGGAGATAGG - Intronic
907858084 1:58323540-58323562 GGGAATGTGGAGAATGAGAAAGG - Intronic
907921591 1:58919202-58919224 AGGAGTGAGCAGAAGGAGAATGG + Intergenic
908023207 1:59919992-59920014 CTGACTGTGCAGAAAAAAAATGG + Intronic
908331426 1:63074558-63074580 CTGATTTTGCAGAAGCAGATAGG + Intergenic
908814579 1:68018560-68018582 CAGAGTGTCCAAAAGGAGAAGGG - Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
911992119 1:104712091-104712113 CTGAATGTGGAGGATAAGAAAGG - Intergenic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
912925568 1:113910216-113910238 CTGAGTGTGAAGCAGGAAAATGG - Intronic
915836649 1:159181982-159182004 CTGATTGTGAAGCAGGAGACAGG - Intronic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
917008549 1:170444585-170444607 CAGATTGTGCAGAAGAAGCAGGG - Intergenic
917011816 1:170482872-170482894 CTGAAAGTAGAGAAAGAGAAGGG + Intergenic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917672584 1:177287091-177287113 GTAAATGTTCAGAAAGAGAAGGG - Intergenic
917994123 1:180417268-180417290 GGGAATGTGGAAAAGGAGAATGG - Intronic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
919525926 1:198650373-198650395 CTGAATGGGAGGATGGAGAAAGG + Intronic
920034470 1:203056887-203056909 CTGTTTGGGAAGAAGGAGAAGGG + Exonic
920748918 1:208655655-208655677 ATGGGTGTGAAGAAGGAGAATGG - Intergenic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
920954732 1:210608074-210608096 CTGAATTTTCAACAGGAGAATGG - Intronic
921407755 1:214799597-214799619 CTGCATCTGCAGCAGTAGAAGGG + Intergenic
922067590 1:222158868-222158890 CTCAATGGGCAAGAGGAGAAGGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
923544403 1:234913837-234913859 CAGAATGGGCAGGAGGAGATCGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924579419 1:245311061-245311083 ATGAAGCTGAAGAAGGAGAAAGG + Intronic
924659104 1:246000393-246000415 CAGAATGTGAAGATGGAGATAGG + Intronic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1063040211 10:2330028-2330050 TTGAAGGTCCAGAAGGAGAAGGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1064533982 10:16339413-16339435 ACGAACGTGCAGCAGGAGAAAGG + Intergenic
1065009264 10:21406854-21406876 CTGACTTTTCAGTAGGAGAAAGG - Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1068055579 10:52009074-52009096 CTGAATGGGCAAAAGCTGAAAGG + Intronic
1068302948 10:55169465-55169487 CTAAATGTGCAACAGCAGAAAGG + Intronic
1068402998 10:56554427-56554449 CTAAATGTGCTGAAGGACAGTGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070403764 10:76076467-76076489 CTGAATGTGAAGATAGAGAGTGG + Intronic
1070705473 10:78634650-78634672 TTGAATGGACACAAGGAGAAAGG - Intergenic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1072439892 10:95445056-95445078 CTGAGAGGGTAGAAGGAGAATGG + Intronic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1074251030 10:111747490-111747512 CTCAATGTGCAGAATCAGAGGGG - Intergenic
1074578684 10:114695483-114695505 TTGAATTTGTAGAAAGAGAATGG - Intergenic
1075071148 10:119320747-119320769 CTGAATGGGACCAAGGAGAACGG + Intronic
1075455267 10:122580926-122580948 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075457388 10:122593629-122593651 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075458463 10:122600124-122600146 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075458965 10:122603160-122603182 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075459597 10:122607219-122607241 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075460229 10:122611278-122611300 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1075460861 10:122615337-122615359 GTGATTGGGCAGAAAGAGAAGGG - Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079566843 11:21892810-21892832 CTGAATGTGCAGTTGCAAAATGG - Intergenic
1080208576 11:29758269-29758291 CTGACTGTTCAGAGGGAGCATGG - Intergenic
1080787333 11:35487477-35487499 CTGGAAGTGCAGCAGCAGAAGGG - Intronic
1081449850 11:43160813-43160835 CTTAATGTCCAGGAAGAGAAAGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083649461 11:64193078-64193100 GTCAATGAGCTGAAGGAGAAAGG + Exonic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085519561 11:77130145-77130167 CTGACTGAGCAGAAGGTCAAGGG - Intronic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086947680 11:92859487-92859509 CTGAATGTTCAAAAGGAAATGGG - Intronic
1087307883 11:96505847-96505869 CTGACAGGGCAGAAGGATAAAGG - Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1088792870 11:113241651-113241673 CTGAATGTGCAGGAGTAGAAGGG + Intronic
1088853113 11:113721718-113721740 CTGAATGTGCAGGAAGAGAGAGG - Intergenic
1089197871 11:116705554-116705576 CTTAATGTGCAGAAATTGAAAGG + Intergenic
1089199409 11:116714790-116714812 CTGAGTGTGGAGAGGGGGAAAGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1089997708 11:122924721-122924743 CTGATTGTTCTTAAGGAGAATGG - Intronic
1090232959 11:125122811-125122833 TTCATTGTGCAGAAAGAGAAAGG + Intergenic
1090691888 11:129192097-129192119 CTGACTGTGAAGAGGAAGAAAGG - Exonic
1090831184 11:130421909-130421931 CTGCATGTGAAGAATGTGAACGG + Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092519983 12:9260657-9260679 CTGAATTTGAAGATAGAGAAAGG + Intergenic
1092826452 12:12404417-12404439 CTCAACTGGCAGAAGGAGAATGG + Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1093932706 12:24970193-24970215 CTGCATGTGCATTAGGAGGATGG - Intergenic
1095594120 12:43939579-43939601 CTGAAGTGGCAGTAGGAGAAGGG - Intronic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1096818495 12:54216461-54216483 CTGAAGCTGCAGCAGGAGGAAGG - Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097463634 12:59895025-59895047 GTGAATGGGCAGGAGAAGAATGG - Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1098975170 12:76895132-76895154 CTGTATCTGCAAAAGGAGCAAGG + Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1100090132 12:90958170-90958192 CAGAATGTGAAGCAAGAGAAAGG - Intergenic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1100574987 12:95882719-95882741 AAGAATGGGTAGAAGGAGAAGGG - Intronic
1100861464 12:98811322-98811344 ATGGATGTGCAGAAGGAGTCTGG - Intronic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102371091 12:112382571-112382593 CTGAATGGCCAGGGGGAGAAGGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103015693 12:117492841-117492863 CTGACTTTGAAGATGGAGAAGGG + Intronic
1103304994 12:119956988-119957010 CTGGCTTTGCAGATGGAGAAGGG + Intergenic
1103399757 12:120635711-120635733 CTGAATGTGGAAAATGAGAATGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106930509 13:34658964-34658986 CTGTATGTGTAGAAGGGCAATGG - Intergenic
1107361992 13:39628623-39628645 CTGACTCTGCAGAAGTAAAAAGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109753441 13:66726232-66726254 CAAAATGTTCTGAAGGAGAAAGG + Intronic
1110859483 13:80332182-80332204 CTAAATGTGCACAAGGACCAGGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115154532 14:30322999-30323021 CTGAATGTAAATAATGAGAAGGG - Intergenic
1116588645 14:46742522-46742544 CTGAATGTGCAGCTTGAGGATGG + Intergenic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1118170889 14:63387420-63387442 CTGTGTGTGCAGAAGGACAGTGG - Intronic
1118388598 14:65277779-65277801 CTGCATGTGCAAGAGGAGAAAGG - Intergenic
1118435207 14:65765011-65765033 CTGAAGGTGGAGAAGGACAGCGG + Intergenic
1118477761 14:66134153-66134175 CAGAATCTAGAGAAGGAGAAAGG + Intergenic
1118924221 14:70177218-70177240 ATGAATGTGCAAAAATAGAAGGG + Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120880420 14:89411491-89411513 CTGAATATGAACTAGGAGAAGGG - Intronic
1120955688 14:90079930-90079952 CTGAAAGTGGAGAAGGAAACAGG + Intronic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1121096598 14:91221701-91221723 ATGAAAGTGCTGAAAGAGAATGG - Intronic
1121654060 14:95582113-95582135 CAGAATGTTCAAGAGGAGAAAGG + Intergenic
1123831801 15:24146894-24146916 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123836779 15:24202910-24202932 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123846046 15:24303016-24303038 CAGAATGTGTAGCAGTAGAAGGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1125023423 15:35006998-35007020 CTGAGCGTGGAGAAAGAGAAGGG + Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126104798 15:45140574-45140596 CAGAATGTGCAAAAGTTGAATGG - Intronic
1126171569 15:45699591-45699613 GGCAATGTGCAGAAGGTGAAGGG - Intergenic
1126482759 15:49144272-49144294 TTGAAGGTGAAAAAGGAGAATGG - Exonic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1127631997 15:60836271-60836293 CTTTATGTGCAGATGGAGAGAGG + Intronic
1129012793 15:72438291-72438313 GTGAATGTGAAGAAGGACAATGG - Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129673890 15:77622077-77622099 CTGATTGGGCAGCAGGAGAGAGG + Intronic
1130965465 15:88694475-88694497 CGGCATGTGAAGAAGGAGAGGGG + Intergenic
1131001944 15:88946056-88946078 CTGAATCTTCAGAGGGTGAAGGG - Intergenic
1131522237 15:93125412-93125434 CTGAATGGGCAGTAAGGGAAAGG + Intergenic
1131539314 15:93262825-93262847 ATGAATGGGCAGAATAAGAATGG - Intergenic
1132516013 16:366402-366424 CTGCATGTGCAGAATGACAAGGG - Intergenic
1133878115 16:9754122-9754144 CTGAATGTTCAGAAAGAATAAGG - Intronic
1134787541 16:16958736-16958758 CTGCATGTGCTGAAGGCAAATGG + Intergenic
1135397166 16:22139993-22140015 CTGAATCTGCTGCAGGAGAGGGG + Intronic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1136026305 16:27471150-27471172 CTGAGTGCGGGGAAGGAGAATGG + Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137859341 16:51830547-51830569 AAGAATGAGAAGAAGGAGAAGGG - Intergenic
1138519894 16:57565011-57565033 CTGGAAGGGCAGCAGGAGAAGGG - Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138586916 16:57976538-57976560 CTCAATGGGCAGAAGAGGAAGGG - Exonic
1139027050 16:62831429-62831451 CTAAATGTGCTGAAGGTTAAAGG + Intergenic
1139061552 16:63259232-63259254 CTGAATGAGCAAAAGCTGAAAGG - Intergenic
1139642342 16:68301309-68301331 CTGGATGTGCAGAAGGAGTTCGG - Exonic
1140188757 16:72796767-72796789 CAGAAGGTGCAGAAAAAGAATGG - Exonic
1140892547 16:79297678-79297700 CATAATGTGAAGAATGAGAATGG - Intergenic
1143251518 17:5526594-5526616 CTGTGTGTGCTGAAGGAGATGGG + Intronic
1144169935 17:12649789-12649811 GGGTATGTGCAGAAGGAGAGGGG + Intergenic
1148632358 17:49121093-49121115 CTGAATTTGAAGAAGAGGAAGGG + Intergenic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1151321417 17:73354791-73354813 CAGAGGGTGCAGAAGCAGAACGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152988656 18:342588-342610 CTGCATGTACAGAAAGGGAAAGG + Intronic
1153699046 18:7674103-7674125 GTGAATGTGAGGAAAGAGAAGGG + Intronic
1155325080 18:24657000-24657022 CTGAATGGCCAGAAAGAAAATGG - Intergenic
1155776189 18:29765099-29765121 CTGAACGTGCAGAAGAGCAAGGG - Intergenic
1156232044 18:35163047-35163069 CTGAAGGTGCTGAAGGCAAAGGG + Intergenic
1156497002 18:37532266-37532288 CGGGATGTTCAGAAGAAGAAAGG - Intronic
1156695582 18:39762241-39762263 CTGACTTTGAAGATGGAGAAGGG - Intergenic
1157317341 18:46603339-46603361 GTGAATGTGCAGTGGGAGAGAGG + Intronic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158247588 18:55449459-55449481 CTGAAAGTTCTGAAGGAGACAGG + Intronic
1159424088 18:68261328-68261350 GGGAATGGGCAGGAGGAGAAAGG + Intergenic
1159473552 18:68888228-68888250 ATGAATGAGCACAAAGAGAAGGG + Intronic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162062871 19:8107378-8107400 ATGAATGGGTAGATGGAGAATGG + Intronic
1162268773 19:9597184-9597206 CTGAATGAGCAGAATGAGTCAGG + Intergenic
1162844710 19:13383279-13383301 CTGAGTGTGGAGCAGGAGAGAGG + Intronic
1164901584 19:31930610-31930632 CAGAATGTGCAGCAAGAGATTGG - Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1166371409 19:42303250-42303272 AAGAAGGTGCAGAAAGAGAAAGG + Intronic
1166734421 19:45075912-45075934 CTGAGGGTGCTGAAGGAGAGGGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
925425243 2:3744039-3744061 GCGAATGGACAGAAGGAGAATGG + Intronic
925679087 2:6398223-6398245 CTGCATTTCCACAAGGAGAAGGG - Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
927463790 2:23322021-23322043 CAGAGTGTGCAGAGGGAGATGGG + Intergenic
928764055 2:34620486-34620508 CTAAATGTGCATAAGTATAAAGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
929992529 2:46802149-46802171 CTGTATGGGCAGAAGGCCAAGGG - Intergenic
930237435 2:48901527-48901549 CTGGATGGTCAGAAGGAGCAGGG - Intergenic
932425940 2:71635210-71635232 ATGAAAGTGTAGAAGGAGAAAGG - Intronic
932829749 2:74977738-74977760 CTGACTGTGGAGAAGTGGAAAGG + Intergenic
933409682 2:81909891-81909913 CAGGATGTGCAAAAGGAGCATGG + Intergenic
933760237 2:85667595-85667617 CTGGATGGGCAGGAGGAGAGTGG - Intronic
934621863 2:95815262-95815284 CTGAATGTGCAAAACTGGAAGGG + Intergenic
934737668 2:96698184-96698206 CAGAAGGTGCACAAGGAGACAGG - Intergenic
934811581 2:97283548-97283570 CTGAATGTGCAAAACTGGAAGGG - Intergenic
934826110 2:97424392-97424414 CTGAATGTGCAAAACTGGAAGGG + Intergenic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
936823360 2:116551699-116551721 CTGAAATTGCAGAAGTGGAATGG - Intergenic
936919709 2:117675318-117675340 CTGAATGTGAAGAGAGTGAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938142793 2:128810653-128810675 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
938313423 2:130309943-130309965 CAGCATGTGCAGAAGGCCAAAGG - Intergenic
938323249 2:130379882-130379904 GTGGATGTGAAGAAGGATAAGGG + Intergenic
939552819 2:143636697-143636719 TTGAAAGTGCAGAGGAAGAAAGG - Intronic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
940756249 2:157686391-157686413 ATGAGAGTGCAGAACGAGAAAGG + Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942245425 2:174003686-174003708 CTGAAAGTGCAGAGGTAGATCGG + Intergenic
942677143 2:178439332-178439354 CTGAAGGTGGAGAAGGGGCAAGG - Intronic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943261135 2:185665308-185665330 CTGAATTTGAAGTAGGAGATGGG + Intergenic
943663371 2:190583179-190583201 CTTGATGGGCAGAAGGAGAGAGG + Intergenic
944117102 2:196200284-196200306 CTGAATGTACCAAAGGTGAAGGG - Exonic
944637645 2:201690274-201690296 ATAAATCTGCAGAAGGACAAGGG + Exonic
945256080 2:207804369-207804391 GTGTGTGTGCAGAAGGAGACAGG + Intergenic
945664568 2:212724603-212724625 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
945853913 2:215044435-215044457 GTGAATCTGTAAAAGGAGAAGGG - Intronic
945999913 2:216473509-216473531 CTAAATCTGCAGAAATAGAAGGG + Intronic
946028291 2:216685721-216685743 GTGCATTTGCAGAAGGAGAAAGG + Intronic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947457997 2:230273945-230273967 CAGAAGGTTCAGAAGGTGAAGGG + Intronic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
947977123 2:234376408-234376430 CTGACTGTGCAAGAGTAGAACGG - Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948546333 2:238731757-238731779 CGGAATGGGCAGGTGGAGAATGG + Intergenic
1169289784 20:4339353-4339375 ATGAATGTGCAGAACAGGAAGGG - Intergenic
1169348578 20:4850010-4850032 ATGAAGATGCAGTAGGAGAAGGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1172528286 20:35614224-35614246 ATGAATGTTAAGAAGGAGCAGGG - Intergenic
1172944539 20:38676993-38677015 CTCAATGGGCAGAGGCAGAATGG - Intergenic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1175320188 20:58080052-58080074 CTGGCTTTGCAGGAGGAGAAAGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1181716935 22:24737856-24737878 CTCTATGTGTAGAAAGAGAAGGG + Intronic
1182978260 22:34643681-34643703 CTAAGTGTGCAGCAGGAGAAGGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184768937 22:46586868-46586890 CTGGATGGGCAGAGGTAGAAAGG + Intronic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949657350 3:6235863-6235885 CAGAAGGTGAAGGAGGAGAAAGG - Intergenic
950104334 3:10378718-10378740 CTGAATGTGGGAAAGGACAAGGG - Intronic
951140944 3:19158964-19158986 CTTAAAGTTAAGAAGGAGAAGGG - Intronic
951413268 3:22391280-22391302 CTGAATGTGCAAGAATAGAAAGG - Intergenic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
951979284 3:28547971-28547993 ATGCATGGGCAGGAGGAGAATGG + Intergenic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
953202463 3:40789709-40789731 CTGACTTTGAAGAAGGGGAAAGG + Intergenic
953819878 3:46198286-46198308 CTGATACTGGAGAAGGAGAATGG + Intronic
954047397 3:47944350-47944372 CAGACTGTGGAGAATGAGAAAGG - Intronic
954093437 3:48302837-48302859 CTGAATCTGCAGTAGGCCAAAGG + Intergenic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955982438 3:64540487-64540509 GTCAATGTGCAGAAGAAAAATGG - Intronic
955988730 3:64602219-64602241 TTGAATGTTCAGAAAGAGAAAGG + Intronic
956086840 3:65620432-65620454 CTGACAGTGCAGAAGAAGCAGGG + Intronic
956691088 3:71878022-71878044 CTGAATGTGAGGCAGGAGAGCGG - Intergenic
957551777 3:81715069-81715091 ATGAATGTGTAGAAGAATAAAGG + Intronic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
958787788 3:98617078-98617100 CTCACTGTGAAGATGGAGAAAGG - Intergenic
959022667 3:101205549-101205571 TTGAATGTGGAGAAGCAGACTGG + Intergenic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
962772699 3:138627939-138627961 CTGTATGTGCACAAGGAGTCTGG - Intronic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
963580612 3:147122548-147122570 CTGTATATGCAGAAGGAGAGTGG - Intergenic
964030606 3:152134922-152134944 CTAAATGTGTAGAAGTAGGAAGG + Intergenic
964298935 3:155266193-155266215 GTGAAGGTGCAGAGGGAAAAAGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965384006 3:168024192-168024214 CTCAATGTGCAGAGGGAGAGAGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
968330857 3:197868587-197868609 CTGAATGTCCATCAAGAGAATGG + Intronic
969233883 4:5851674-5851696 CTGAAGGTGATGGAGGAGAAAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
970839678 4:20452745-20452767 CTTGATGGGCAGAAGGAAAATGG - Intronic
971465702 4:26957751-26957773 CTAGATGTGCAGAAGGGGAGGGG - Intronic
972385523 4:38562107-38562129 CACACTGTCCAGAAGGAGAAAGG + Intergenic
972818057 4:42666583-42666605 CTGACAGTGCAGAAGGCAAAGGG + Intergenic
972866196 4:43236068-43236090 TTTAATGTGCAGGAGCAGAAAGG - Intergenic
974154800 4:58057166-58057188 CTGAGTTTGCAGAAAGATAAAGG - Intergenic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975497856 4:75054327-75054349 ATGGATGTTCAGAAGGAGGATGG - Intergenic
976339919 4:83935437-83935459 TTGAATCAGCAGAAGGACAAAGG - Intergenic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
977028473 4:91851836-91851858 CTGGCTGTGCTGAAGGACAAGGG - Intergenic
978125563 4:105131127-105131149 GTGAATGTCCACAAGCAGAATGG - Intergenic
978784237 4:112591720-112591742 CTGAATGAAGAGAGGGAGAAAGG - Intronic
979053703 4:115969950-115969972 CTGAATGTGCACTGGGAGAATGG - Intergenic
979927364 4:126583669-126583691 CTGGCTGAGCAGAAGCAGAAGGG - Intergenic
980208367 4:129752206-129752228 CTGAATGTGTAAAAGCACAAAGG + Intergenic
980917058 4:139043391-139043413 GTGGATGTGCAGAAGCAGAAAGG - Intronic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
983830332 4:172318755-172318777 CTGAATGAGGACAAGGATAAGGG + Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
985095433 4:186408218-186408240 GTGAATGAGCAGAATGAGCATGG + Intergenic
985649062 5:1098948-1098970 ATGAATGTGCAGAATGACAAGGG - Intronic
986445992 5:7821813-7821835 CTGATGGAGCAGAAGGGGAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986965375 5:13264152-13264174 CTGTATATGCAGAAAGAGTAAGG - Intergenic
987905817 5:24075698-24075720 CTGCATGTGCAGAGAGAGAATGG + Intronic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
990736569 5:58869932-58869954 TTGATTTTGAAGAAGGAGAATGG + Intergenic
991368541 5:65894438-65894460 CTGAATGGGGAAAAGGAGACAGG - Intergenic
993089320 5:83404720-83404742 CTGAATGTGTACAAGCAGTAAGG + Intergenic
993692987 5:91025639-91025661 CTGAATGTGCAGCAGAAGGGTGG - Intronic
993909307 5:93661905-93661927 CTGAGTGGGCAGAAAGAGTAAGG + Intronic
994145002 5:96384771-96384793 CTGAATATGCTCCAGGAGAAAGG + Intergenic
994192914 5:96888301-96888323 ATGGATGTGCAGGAGGTGAATGG + Intronic
994572627 5:101533581-101533603 CTGAATGTACAGAATAAGAAAGG - Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995098601 5:108270961-108270983 GGGAATGTGGAGAAGGAGAGGGG - Intronic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
996075242 5:119185212-119185234 GGGAAAGGGCAGAAGGAGAAGGG - Intronic
996626743 5:125579428-125579450 ATGAATGTAAAGTAGGAGAATGG + Intergenic
996938709 5:128977521-128977543 GGGAATGAGCAGGAGGAGAAAGG + Intronic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999195005 5:149775825-149775847 TTGCATGTGGAGAAAGAGAAGGG - Intronic
1000116770 5:158161032-158161054 CTGAATGTTCAGAATTAAAAAGG - Intergenic
1000580518 5:163030400-163030422 CGGAAGGTGAAGGAGGAGAAAGG + Intergenic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1000674368 5:164103214-164103236 ATGAATGTGCAGAGTAAGAAAGG - Intergenic
1001241667 5:170076049-170076071 ATGAAGGTGGAGAAGGAGTACGG + Exonic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1002539432 5:179896311-179896333 CTAAATGGGGAGAAGGAAAAGGG + Intronic
1004258389 6:14085817-14085839 CAAAATGTGCAAGAGGAGAAAGG - Intergenic
1004900436 6:20188677-20188699 CTGCATGTGCATTAGGAGGAGGG - Intronic
1006236614 6:32638889-32638911 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1006246581 6:32742464-32742486 CTGAAAGGGAAGAGGGAGAAAGG - Intronic
1007103931 6:39270415-39270437 TTGAATATTCAGAGGGAGAAAGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1009321669 6:62298150-62298172 CTGATTGTTTTGAAGGAGAAAGG + Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009658383 6:66576051-66576073 CAGAATGTGCTGTAGCAGAATGG - Intergenic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012259751 6:97073919-97073941 CTTGATGTGCAGCAGGAAAAAGG - Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014072136 6:117194998-117195020 CTGAATGTACAGAAAAAGAGAGG - Intergenic
1014635332 6:123839164-123839186 TTGAACTTGCAGAAGGAAAAAGG + Intronic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015159492 6:130136564-130136586 ATGAATGGGCAGCAGGAGCAGGG - Intronic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1015813115 6:137180735-137180757 CTGCATGTGCACTGGGAGAATGG - Intergenic
1015842047 6:137487605-137487627 CTGAATAACCAGGAGGAGAAAGG + Intergenic
1016279494 6:142399150-142399172 CTGAGTGTAGAGAAGGCGAAGGG - Intronic
1016707149 6:147122219-147122241 CTCAATGTGTACAAGGAGATGGG - Intergenic
1016720693 6:147293875-147293897 CTGAATGTGAAGAAGAAGATAGG + Intronic
1016754396 6:147667772-147667794 CTGTTTGTGAAGAAAGAGAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017395416 6:153993264-153993286 TTGAATGTACAAAAGGAGGAAGG - Intergenic
1017561823 6:155636400-155636422 CTCAACCTGCAGAAGGATAAGGG + Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019015658 6:168878055-168878077 CTGAATGTGCAGTCTGAGAGTGG + Intergenic
1019701364 7:2476337-2476359 CTGGACCTGGAGAAGGAGAACGG - Intronic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1021105695 7:16637211-16637233 TTGAATGTGCTGAGGGAGAAAGG + Intronic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1022421061 7:30223849-30223871 CAGTATGTGTAGAATGAGAAAGG + Intergenic
1022464884 7:30646957-30646979 CTGAATGGCCAGAGGGAGTACGG + Intergenic
1024888263 7:54169592-54169614 CTGCATGTGCATTAGGAGGATGG + Intergenic
1026095726 7:67345085-67345107 CTGCATGTGCATTAGGAGAATGG + Intergenic
1026478495 7:70758714-70758736 CTGAATTTGCCAAAGGATAAAGG - Intronic
1027724053 7:81780867-81780889 CTGATTTTGAAGATGGAGAAAGG + Intergenic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1029598650 7:101550994-101551016 CTGAGTCTGCAGAAGAGGAAGGG - Intronic
1029618479 7:101675116-101675138 CTGGATGTGCAGAAGGGGGTCGG - Intergenic
1029694408 7:102203466-102203488 CTGATTTTGCAAAAGGTGAAGGG + Intronic
1030176064 7:106655761-106655783 CTGACTATGCAGTAGGAGATTGG - Intergenic
1031497397 7:122467113-122467135 CTAAATGTGCAAAGGCAGAAGGG - Intronic
1031564194 7:123274650-123274672 CTGAATGGGCACAAGGAGGAAGG - Intergenic
1031835424 7:126675787-126675809 CTGAATGGGCAGAAGTTGAAAGG + Intronic
1033463301 7:141567153-141567175 CAGAGTGTGTAGAATGAGAATGG - Intronic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1036007029 8:4676608-4676630 CTGCAGGTGCGAAAGGAGAATGG - Intronic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039755445 8:40517528-40517550 CTGAATGTGGATAAGGGAAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040647074 8:49411511-49411533 ATGAATGTGGAGAAGGCAAAGGG - Intergenic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041957362 8:63570745-63570767 CTGACTTTGAAGATGGAGAAGGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042708713 8:71691050-71691072 CTGACTTTGAAGATGGAGAAAGG - Intergenic
1042791603 8:72613796-72613818 CTGAATTTACAGCAGAAGAAAGG - Intronic
1042885998 8:73552599-73552621 CTGAATGTGTGGAAGTATAATGG + Intronic
1043331721 8:79124711-79124733 GTGAAGGTGGAGATGGAGAAAGG + Intergenic
1043559935 8:81480683-81480705 GTGCATGTGCAGGAGGAAAAAGG + Intronic
1043673980 8:82925850-82925872 CTGAAGGAGCAGAAGTAAAAGGG + Intergenic
1043922116 8:85995428-85995450 GTGAATGTGCTGAAGGAGCAGGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044938020 8:97311820-97311842 CAGTGTCTGCAGAAGGAGAAAGG - Intergenic
1045200047 8:99971273-99971295 CTGAATGGGCAAAAGCTGAAAGG + Intronic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046071930 8:109266003-109266025 TTGAATGACCAGAAGGTGAAAGG - Intronic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1047915754 8:129582252-129582274 CTCAAGGTGCAGAGGGAGATTGG + Intergenic
1047979006 8:130160380-130160402 CAGAATGTGTAAAGGGAGAAAGG - Intronic
1049116167 8:140689808-140689830 GTGAATGGGCAGAAGAGGAAAGG - Intronic
1049295170 8:141829250-141829272 GTGAATGAGCAGGAGGAGGAGGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049621402 8:143599850-143599872 CTCCAAGTGCAGCAGGAGAAAGG - Exonic
1049684628 8:143934375-143934397 CTGGATGTGGAGAAGGAGTGGGG - Exonic
1049978728 9:884417-884439 CTGAATGTGCAGAAAGTAAACGG + Intronic
1050408191 9:5332251-5332273 TTGTATGTGCAGAAGTAGACTGG + Intergenic
1051192486 9:14529966-14529988 CTGACTGTACAGAAGTAGAATGG + Intergenic
1051205086 9:14679529-14679551 CTCAATGGGCTGAAAGAGAAAGG + Intronic
1051842247 9:21412264-21412286 GTGAATGGGCAGAAGGATAAAGG - Intronic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1052284752 9:26772303-26772325 CTGAATGTGAAGAATGGTAATGG + Intergenic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1056488508 9:87082885-87082907 CAGAATTTCCAGAAGGTGAATGG - Intergenic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1056942507 9:90967404-90967426 CACAATGTGTAAAAGGAGAAAGG - Intergenic
1056970846 9:91201029-91201051 TTGAAAGTGCTGAAGGAAAAAGG + Intergenic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058711801 9:107685447-107685469 CTGAATGGGCAGAAGGCAAATGG - Intergenic
1059443492 9:114324049-114324071 CTGAATGTCCAGCGGGAAAATGG + Exonic
1059444682 9:114330823-114330845 CTGAATGTCCAGCGGGAGAATGG + Exonic
1060778238 9:126392408-126392430 CTGAATGCGCAGAAGGGCAGGGG - Intronic
1061731146 9:132615014-132615036 GAGAATGTGCAGAAGGAACAGGG + Intronic
1185839661 X:3376826-3376848 CTGGCTTTGCAGATGGAGAAAGG - Intergenic
1185978946 X:4754915-4754937 CGCAATGTGCAGATGAAGAAGGG - Intergenic
1186240716 X:7562574-7562596 CGAAATGTGCAAAAGGAGAATGG + Intergenic
1186880152 X:13857008-13857030 CTGACTTTGAAGATGGAGAAAGG - Intronic
1187049237 X:15679622-15679644 ATGAATGTGCACAAAGAGAGGGG + Intergenic
1187930519 X:24289570-24289592 ATGAAGGTGAAGGAGGAGAAAGG + Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190939499 X:55026859-55026881 CTGAAATTGAGGAAGGAGAAGGG + Intronic
1192450986 X:71244752-71244774 CTGTATGTACAAAAGAAGAATGG - Intronic
1193423010 X:81307377-81307399 CTGAATGAGGAGAAAGAGTAAGG - Intergenic
1193645570 X:84065413-84065435 CTAAATGTTCAGCAGGAGACAGG + Intronic
1194330223 X:92574011-92574033 CTGTATTTGCAGTATGAGAAAGG - Intronic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1194960878 X:100234286-100234308 CTGACTTTGAAGATGGAGAAAGG + Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1195820519 X:108940503-108940525 CTGAATGGGCAAAAGCTGAAAGG - Intergenic
1196636813 X:118011626-118011648 CTGAGTGTGAAGGATGAGAAAGG + Intronic
1197900057 X:131361256-131361278 TTGTATGTGCAGAAGTAGACTGG - Intronic
1198230016 X:134680088-134680110 CTGAATCTTCAGAAGGACATGGG + Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199215940 X:145260470-145260492 CTGATGGTGGAGAAAGAGAAAGG + Intergenic
1200638932 Y:5693190-5693212 CTGTATTTGCAGTATGAGAAAGG - Intronic
1200814610 Y:7518463-7518485 CAGAATGTGCAGGAGAAGCATGG + Intergenic
1201236155 Y:11914039-11914061 CTGGCTTTGCAGATGGAGAAAGG + Intergenic
1201460516 Y:14217644-14217666 CAAAATGTGCAAAAGGAGAATGG + Intergenic