ID: 1183759666

View in Genome Browser
Species Human (GRCh38)
Location 22:39804742-39804764
Sequence CATCTTTAGGAGCCTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183759666_1183759671 2 Left 1183759666 22:39804742-39804764 CCAAGCACAGGCTCCTAAAGATG 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1183759671 22:39804767-39804789 GCCACTATTGCCCAAGGGGAAGG No data
1183759666_1183759669 -3 Left 1183759666 22:39804742-39804764 CCAAGCACAGGCTCCTAAAGATG 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1183759669 22:39804762-39804784 ATGAAGCCACTATTGCCCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
1183759666_1183759670 -2 Left 1183759666 22:39804742-39804764 CCAAGCACAGGCTCCTAAAGATG 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1183759670 22:39804763-39804785 TGAAGCCACTATTGCCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 126
1183759666_1183759668 -4 Left 1183759666 22:39804742-39804764 CCAAGCACAGGCTCCTAAAGATG 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1183759668 22:39804761-39804783 GATGAAGCCACTATTGCCCAAGG 0: 1
1: 0
2: 0
3: 13
4: 130
1183759666_1183759675 19 Left 1183759666 22:39804742-39804764 CCAAGCACAGGCTCCTAAAGATG 0: 1
1: 0
2: 1
3: 9
4: 189
Right 1183759675 22:39804784-39804806 GGAAGGCACATGATGTGTCTAGG 0: 1
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183759666 Original CRISPR CATCTTTAGGAGCCTGTGCT TGG (reversed) Intronic
900558897 1:3293991-3294013 CTTCTCTAGAAGCCTGGGCTAGG + Intronic
901295331 1:8156801-8156823 GACCTCTAGGAGCTTGTGCTAGG - Intergenic
902437020 1:16404861-16404883 CACCTAAAGGATCCTGTGCTTGG - Intronic
904088599 1:27928834-27928856 CAGCTGGAGGCGCCTGTGCTGGG - Intergenic
904800152 1:33086769-33086791 CATCTTAAAAAGCCTTTGCTGGG + Intronic
905485776 1:38295301-38295323 GAGCTTTAGGAGGCTGTGGTGGG - Intergenic
914732360 1:150382930-150382952 CATCTTTGGGAGGCTGAGGTGGG - Intronic
919035320 1:192300058-192300080 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
922201685 1:223408224-223408246 CATCTTTAGGATCCAGGGTTAGG + Intergenic
922564914 1:226595522-226595544 CATCTTTAGGGGCCACTGTTTGG - Intronic
923565180 1:235071083-235071105 CATCTTTAGGTGTCTGGGCTTGG - Intergenic
923857764 1:237863443-237863465 GATCATTAGCAGCCTGTGATTGG - Intergenic
924138450 1:240997059-240997081 CCTCTTCAGGAGGCTGAGCTGGG - Intronic
1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG + Intergenic
1068363403 10:56011873-56011895 CTTCTATATGAGGCTGTGCTGGG - Intergenic
1068741809 10:60481834-60481856 AATGTTTAGGTGTCTGTGCTAGG - Intronic
1069723799 10:70565095-70565117 CATCTGCTGGAGCCTGTACTAGG + Intronic
1069751873 10:70750081-70750103 TGTCTTTAGGAGCCTGGGCAAGG + Intronic
1070320937 10:75354037-75354059 TGTCTTCAGGAGTCTGTGCTAGG + Intergenic
1071366771 10:84908110-84908132 CATCTCTAGCGGACTGTGCTGGG + Intergenic
1071629374 10:87205663-87205685 GATCTTCAGGAGCCTGTGCTTGG - Intergenic
1072574151 10:96685008-96685030 CATTTCTAGGAGGCTGTGTTGGG - Intronic
1072649473 10:97283308-97283330 CATCTTCAGGAGGCTGAGGTGGG + Intronic
1073572717 10:104594157-104594179 AAATTTTAGGAGCCAGTGCTGGG - Intergenic
1073590252 10:104750483-104750505 CAACTTTAGGGCCCTGTCCTTGG + Intronic
1074736002 10:116433684-116433706 CACCTTTAAGAGCCTTTGCATGG + Intronic
1075725992 10:124611172-124611194 CATCTGTAGGTGCCCCTGCTTGG + Intronic
1076264692 10:129100428-129100450 CATGTTTAGGAGCCTGGTCACGG - Intergenic
1077054811 11:586236-586258 CATCTTTGGGAGGCTGAGGTGGG - Intronic
1077171285 11:1167275-1167297 CATCTTGGGGAGACTGTGTTGGG - Intronic
1078206090 11:9230485-9230507 GCTCTTTGGGAGGCTGTGCTGGG - Intronic
1078925313 11:15869590-15869612 CATCTTTAGGAGTTTGGACTTGG + Intergenic
1079897852 11:26145345-26145367 CCTCATTAGGTGCCTTTGCTAGG + Intergenic
1082763483 11:57148439-57148461 GATCCTTGGGTGCCTGTGCTGGG - Intergenic
1085996954 11:81929431-81929453 CATCCTTAGAAGTCTGAGCTCGG + Intergenic
1086363885 11:86088489-86088511 CCTCTGCAGGAGCCAGTGCTAGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087932799 11:103998132-103998154 GAGTTTTAGGAGCCTGTGCCAGG - Intronic
1088009185 11:104978457-104978479 CATCTTTAGGAGATTTTTCTAGG - Intergenic
1088545765 11:110957213-110957235 CCTCATTAGCAGCTTGTGCTAGG - Intergenic
1090614634 11:128503895-128503917 TATTTTTTGGAGCCTGTGATAGG - Intronic
1091409498 12:229814-229836 CATCTTTGTGAACTTGTGCTTGG + Intronic
1091760129 12:3081663-3081685 CATGTATAAGAGTCTGTGCTGGG + Intronic
1092559710 12:9599490-9599512 CCTCATGAGGAGCCTCTGCTAGG - Intronic
1097020462 12:56017079-56017101 TCTCTTTAGGAGCCTGTGGGAGG - Intronic
1099833290 12:87873404-87873426 GAACTTTAGGAGACTGTGGTAGG - Intergenic
1105999613 13:25708884-25708906 AAATTTTGGGAGCCTGTGCTTGG + Intronic
1107233598 13:38141052-38141074 CAGCTTTAGGAGCCTTTGGGTGG + Intergenic
1107303445 13:38992187-38992209 GATCCTTAGGATCCTGTACTAGG + Intergenic
1108133783 13:47333105-47333127 CATCTTTATGACCTTGTACTTGG - Intergenic
1109559880 13:64032889-64032911 CAACTTCAGGAGCTTGTGCCAGG + Intergenic
1110961015 13:81626158-81626180 CTTATTTATGAGCCTTTGCTTGG - Intergenic
1111675690 13:91385504-91385526 CTTCTTTAAGAGCCGGTGCGGGG - Intergenic
1112473296 13:99708846-99708868 CAACTTTGGGAGCCTGAGGTGGG + Intronic
1118440864 14:65810436-65810458 CATCCTAAGCAGCCTTTGCTGGG + Intergenic
1118705889 14:68479931-68479953 GAACTTTAGGAGGCTGAGCTGGG - Intronic
1119413798 14:74456232-74456254 CATATTTAAGATCCTTTGCTGGG + Intergenic
1121926308 14:97930368-97930390 CGTCATTAAGAGCCTGGGCTGGG - Intronic
1123035840 14:105471608-105471630 CCTCCGTGGGAGCCTGTGCTGGG + Intergenic
1127842640 15:62844246-62844268 CATCTTTCTGAGCCTCTGCTTGG + Exonic
1129155631 15:73715641-73715663 CAGCAGGAGGAGCCTGTGCTGGG + Intergenic
1129247565 15:74288960-74288982 CATCTGCAGGACACTGTGCTAGG - Intronic
1129853239 15:78807120-78807142 CATCTTTAGCTGCCTTGGCTGGG - Intronic
1130526352 15:84710323-84710345 CACCTTTAAGAGCCTATGTTTGG - Intronic
1131298017 15:91169295-91169317 CTTCTTTAAGAACCTGGGCTAGG + Intronic
1131559315 15:93425501-93425523 CATATTCTGGAGCCAGTGCTAGG + Intergenic
1133240347 16:4410440-4410462 GGTCTATAGGAGCCTGTGTTTGG - Intronic
1133940498 16:10305216-10305238 CATTTTTAGGAGGCTGAGGTGGG + Intergenic
1133963660 16:10516055-10516077 CCTCTTTCGGAGCCTCTCCTGGG - Intergenic
1136001121 16:27293779-27293801 CATCTTCAAATGCCTGTGCTGGG + Intergenic
1136470193 16:30474422-30474444 CGTCTGGAGGAGCCTGTGGTGGG + Intronic
1137895334 16:52205781-52205803 CATCTTCAGGAGGCTGTGGGAGG - Intergenic
1139348546 16:66320742-66320764 CAGCTGTTGGTGCCTGTGCTGGG - Intergenic
1140635405 16:76907256-76907278 CATGTTTAGTAGCCTGTGGCAGG + Intergenic
1141384063 16:83603259-83603281 CTTCTTTAGGGGCCTGGGCCAGG + Intronic
1142411737 16:89920488-89920510 TCTCTTTAGGAGCCTGAGGTTGG - Exonic
1143230479 17:5350019-5350041 CATCTCTAGGATTCTGTCCTTGG - Intronic
1144421422 17:15102485-15102507 CATCTTGGGAAGCCTTTGCTGGG + Intergenic
1148219565 17:45851918-45851940 CAGCTTTATGAGCATGGGCTTGG + Intergenic
1148224326 17:45887936-45887958 AATCTCTGGGAGCCTTTGCTAGG + Intergenic
1148722047 17:49760956-49760978 CATTTTTATGAACCTGGGCTAGG - Intronic
1149467435 17:56891123-56891145 CCTCTTTAGGAAACTGTTCTGGG + Exonic
1151925129 17:77190036-77190058 AATCTTTGGGATCCTGGGCTAGG - Intronic
1152588257 17:81198680-81198702 CCTCTTGGGGAGCCTTTGCTGGG - Intronic
1154468645 18:14674994-14675016 CATCTTTAGGAGGCTGAGGTGGG - Intergenic
1155579523 18:27287322-27287344 CATCTTGATGAACCTCTGCTTGG - Intergenic
1158126692 18:54107498-54107520 CTCCTTGAGGAGCCTTTGCTGGG - Intergenic
1158295677 18:55994523-55994545 CCTGTTTAGGAGCCTGTATTAGG - Intergenic
1159510074 18:69386515-69386537 CAACTTTAGGAGGCTGAGGTGGG + Intergenic
1160768325 19:818821-818843 CATTTTTAGTAGGCTGTGCGTGG - Intronic
1161139801 19:2640530-2640552 CATCTTGCCAAGCCTGTGCTGGG - Intronic
1161393469 19:4032984-4033006 CATCGTCAGGGGCCTGTTCTGGG + Intronic
1161439096 19:4280284-4280306 CACCTTGATGAGCCGGTGCTTGG - Exonic
1167779605 19:51590609-51590631 CACATGCAGGAGCCTGTGCTGGG + Exonic
925010132 2:478323-478345 CAGCGTTAGGAGTCTGTTCTTGG - Intergenic
926908645 2:17829228-17829250 CATGTTTCTTAGCCTGTGCTTGG + Intergenic
927629748 2:24762844-24762866 CATCATTAAGAGCCTGACCTTGG + Intronic
928019312 2:27689487-27689509 CATCCTTGGAAGCCTGTGCCAGG - Intronic
931106254 2:59059560-59059582 CATCTTTGGTAGCCTGGGTTGGG + Intergenic
931855051 2:66294244-66294266 CATCTTAAGGAGCTTGTTCTAGG - Intergenic
932204868 2:69870475-69870497 CTTCTTTTGTTGCCTGTGCTTGG - Intronic
932635037 2:73380619-73380641 CATCATTAGGAGCACTTGCTTGG + Intergenic
934847854 2:97673879-97673901 GATCTTTAGGAGGGTGGGCTTGG + Intergenic
935200973 2:100856350-100856372 CAGCATTGGGAGCCTGTGCTCGG - Intronic
939293878 2:140231409-140231431 CATATTTAAGAGCTTGTGTTGGG - Exonic
942273037 2:174296577-174296599 AATCTTTGGGAGGCTGTGGTGGG + Intergenic
943121897 2:183746928-183746950 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
943497072 2:188633954-188633976 CATTGTTAGGAGTCTGTTCTGGG + Intergenic
944129659 2:196334019-196334041 CAACTTAAGGAGCCGTTGCTCGG - Intronic
946127649 2:217578068-217578090 CATCTTTCTGAGCCTGGGCCTGG + Intronic
947817171 2:233045354-233045376 CATCGTGAGGAGTCAGTGCTGGG + Intergenic
948335364 2:237202997-237203019 CATGTTTAGCAGCCTGTGGGGGG + Intergenic
948378564 2:237538098-237538120 CATCGTCAGGAGCCGGTGCTGGG - Intronic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
1170679630 20:18514468-18514490 CAGCTTTAGGGGCCTCTGGTTGG - Intronic
1172410466 20:34718139-34718161 CATCTTTTGGATACTGTGGTTGG + Intronic
1172848002 20:37941498-37941520 GATGTTTCTGAGCCTGTGCTGGG - Intronic
1172916791 20:38449263-38449285 CACTTTTGGGATCCTGTGCTGGG + Intergenic
1176264879 20:64203879-64203901 CATCTTCCGGAGCCTGTGAAGGG - Intronic
1176805871 21:13482662-13482684 CATCTTTAGGAGGCTGAGGTGGG + Intergenic
1177529197 21:22338159-22338181 CATCCTTAGGAGGCTGAGGTGGG + Intergenic
1177817555 21:25993880-25993902 AATTTTTAGGAGTCTGTCCTAGG - Intronic
1182239148 22:28900857-28900879 CAGCTTTAGGAGGCTGAGGTGGG + Intronic
1182648502 22:31830158-31830180 CATATCTAGAAGCCTGTGCCTGG - Intronic
1183253927 22:36748450-36748472 CATCGCTAGGAGCCTGCACTGGG + Intergenic
1183759666 22:39804742-39804764 CATCTTTAGGAGCCTGTGCTTGG - Intronic
949332006 3:2933132-2933154 CATTTTTATGAGGCTGTGATCGG + Intronic
949563760 3:5226605-5226627 TATATTTAGGAGCCTTTCCTTGG - Intergenic
951869396 3:27343834-27343856 CATCTTTATGAGGCTGTGGCTGG + Intronic
952746604 3:36787699-36787721 CATTCTGAGGAGCCTGTGGTGGG - Intergenic
952962041 3:38598413-38598435 CATCTTTTCCAGCCTGTCCTTGG - Intronic
955114985 3:55989028-55989050 CCTCCTTAGGGGCCTGGGCTGGG + Intronic
964290268 3:155170726-155170748 CCTCTTTAGTAACCTGTTCTTGG + Intronic
964711215 3:159673861-159673883 CATGTTTGGGACACTGTGCTAGG + Intronic
965535718 3:169822164-169822186 CAACCTGAGGAGCCTGTGCCCGG + Exonic
966667688 3:182490622-182490644 CATCTTCAATATCCTGTGCTGGG + Intergenic
966889439 3:184396059-184396081 CATTTTTAGGAGGCTGAGTTGGG - Intronic
967197853 3:187044388-187044410 TTTCTTTGAGAGCCTGTGCTGGG - Intronic
967299599 3:188000059-188000081 CATCTTAAAGATCCTGGGCTTGG + Intergenic
968451643 4:678796-678818 CACCCCCAGGAGCCTGTGCTGGG + Intronic
971317760 4:25581498-25581520 CATCTTCAGATGCCAGTGCTTGG - Intergenic
973958402 4:56086387-56086409 CACTTTTAGGAGCCTGAGGTAGG - Intergenic
975065831 4:70062406-70062428 CATCTTCAGGAGCTTTAGCTGGG - Intergenic
975812668 4:78185197-78185219 CTTGTGTAGGAGCCTGTGGTAGG + Intronic
982609493 4:157555667-157555689 CATCTTTAGCTCCCTCTGCTTGG + Intergenic
984751516 4:183281009-183281031 CACCTTCAGGAAGCTGTGCTAGG + Intronic
985778471 5:1857405-1857427 GTTCTCTAGGAGCCTGGGCTCGG - Intergenic
987822420 5:22982949-22982971 CATATTTAGCAGCATATGCTTGG + Intergenic
991098398 5:62763957-62763979 TATCTTCATGAGCCAGTGCTGGG + Intergenic
997215389 5:132105555-132105577 AATCATTAGCACCCTGTGCTGGG - Intergenic
998555636 5:143120866-143120888 CATCTGTAGGAGCCAGAACTTGG - Intronic
1000250336 5:159488661-159488683 CATCTCTGGGTGTCTGTGCTTGG + Intergenic
1000332602 5:160217887-160217909 CCTCTTTGGGAGCCTGAGGTGGG - Intronic
1000452205 5:161403333-161403355 CCTCTTTAAGAGAGTGTGCTAGG - Intronic
1003277274 6:4663459-4663481 CATCTTCAGGATCCTGTTCCGGG + Intergenic
1003686040 6:8303096-8303118 CATCTGTGGGAGTCTGTGATGGG + Intergenic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1004962370 6:20804723-20804745 CATCTTTAGAAGGATCTGCTTGG + Intronic
1006239959 6:32668925-32668947 CATCTCTTGGAATCTGTGCTTGG + Intergenic
1010253347 6:73731274-73731296 CATCTTTGGGAGGCTGAGGTGGG - Intronic
1010688551 6:78879979-78880001 TATCTTTCAGAGCTTGTGCTGGG - Intronic
1011957613 6:93042574-93042596 AATCTTTAGGAGCATGTTGTTGG - Intergenic
1015114747 6:129635546-129635568 CATATTTTGGAGCATGTGGTCGG + Intronic
1020074997 7:5252078-5252100 CATCTTTGGGAGGCTGAGGTAGG - Intergenic
1023835421 7:44064802-44064824 CACCTTCAGGAGCCTGGGCAGGG - Intronic
1024242720 7:47447971-47447993 CTTCTTTAGGTGGATGTGCTTGG - Intronic
1027240377 7:76323887-76323909 CAACTTTGGGAGGCTGAGCTGGG - Intergenic
1029730665 7:102435879-102435901 CATCTTTGGGAGGCTGAGGTGGG - Intronic
1030139589 7:106291245-106291267 CAGCTTTAAGAGCTTGTGCATGG + Intergenic
1030363236 7:108617646-108617668 CGACTTTTAGAGCCTGTGCTCGG - Intergenic
1032427635 7:131834337-131834359 CATCTTGAGGAGCCCCTGCGTGG + Intergenic
1032438996 7:131927481-131927503 CATGTATAGGATACTGTGCTGGG - Intergenic
1033686680 7:143646869-143646891 CTTCCTCAGGAGCCTGTGCAGGG + Intronic
1033689054 7:143720438-143720460 CTTCCTCAGGAGCCTGTGCAGGG - Exonic
1033697929 7:143810745-143810767 CTTCCTCAGGAGCCTGTGCAGGG - Intergenic
1033800200 7:144892243-144892265 CATCTGTGGGAGACTCTGCTTGG + Intergenic
1036187869 8:6640198-6640220 AATCTTCATGAGCCTGGGCTCGG - Intronic
1037085536 8:14844634-14844656 CATCTTTAGGCTCATGTGCTCGG - Intronic
1038268170 8:26051841-26051863 CATTCCTAGGAGGCTGTGCTGGG + Intergenic
1039979392 8:42394238-42394260 CATCCTTAGCAGCCTTTCCTAGG - Exonic
1042219798 8:66462077-66462099 CATGTTTACTAGCCTGTGCTAGG - Intronic
1042984344 8:74566515-74566537 CTGCTTCAGGAGCCTGGGCTCGG - Intergenic
1046077935 8:109334513-109334535 CATCGAAAGGAGCCTGGGCTGGG - Intronic
1055829362 9:80360381-80360403 CTTGTTTAGGAGCCTTCGCTGGG - Intergenic
1056835897 9:89954785-89954807 CATCTTTAAATACCTGTGCTAGG + Intergenic
1056918306 9:90763250-90763272 CATCTTTTGGAGTCCCTGCTGGG + Intergenic
1057986963 9:99726826-99726848 CATGTGTAGGACACTGTGCTAGG - Intergenic
1060830843 9:126715220-126715242 GCTCTTTAGGAGCCTAAGCTGGG + Intergenic
1203698820 Un_GL000214v1:119252-119274 AATCTTGAGGAGTCAGTGCTGGG + Intergenic
1187481993 X:19665622-19665644 CAACATTAAGAGCCTGAGCTGGG + Intronic
1189857656 X:45239411-45239433 CATGTTGAAGAGCCAGTGCTTGG - Intergenic
1191259876 X:58305636-58305658 CATTTTTAGGAGTCTATGCATGG + Intergenic
1192377811 X:70582301-70582323 CATCTTTCAGAGCATCTGCTAGG - Intronic
1195209488 X:102639231-102639253 CCTCTTTGGGAACCAGTGCTAGG - Intergenic
1197724734 X:129768798-129768820 CAGCTGTAGCAGTCTGTGCTAGG - Exonic
1197755017 X:129987370-129987392 TATCTTTTGGAGCCGGTGTTAGG + Intronic
1197871182 X:131064148-131064170 CATATTTAGGAGACTGGGTTGGG + Intronic
1199971731 X:152866619-152866641 CATCCTTAGCATTCTGTGCTTGG + Intronic
1199978154 X:152906230-152906252 CATCTCTAGGAGCAAGTTCTTGG + Intergenic
1201018042 Y:9624706-9624728 TATCTGCAGGAGCCTGTCCTCGG - Intergenic