ID: 1183762280

View in Genome Browser
Species Human (GRCh38)
Location 22:39832753-39832775
Sequence AGAGCTCTGTGTCTCCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183762280_1183762286 12 Left 1183762280 22:39832753-39832775 CCCCCGGGGAGACACAGAGCTCT No data
Right 1183762286 22:39832788-39832810 AATGTGTGTGAGAGTGAGTAGGG 0: 1
1: 1
2: 8
3: 66
4: 643
1183762280_1183762285 11 Left 1183762280 22:39832753-39832775 CCCCCGGGGAGACACAGAGCTCT No data
Right 1183762285 22:39832787-39832809 AAATGTGTGTGAGAGTGAGTAGG 0: 1
1: 0
2: 4
3: 66
4: 636
1183762280_1183762287 13 Left 1183762280 22:39832753-39832775 CCCCCGGGGAGACACAGAGCTCT No data
Right 1183762287 22:39832789-39832811 ATGTGTGTGAGAGTGAGTAGGGG 0: 1
1: 1
2: 5
3: 84
4: 1058
1183762280_1183762288 19 Left 1183762280 22:39832753-39832775 CCCCCGGGGAGACACAGAGCTCT No data
Right 1183762288 22:39832795-39832817 GTGAGAGTGAGTAGGGGTGTCGG 0: 1
1: 0
2: 6
3: 71
4: 533
1183762280_1183762289 25 Left 1183762280 22:39832753-39832775 CCCCCGGGGAGACACAGAGCTCT No data
Right 1183762289 22:39832801-39832823 GTGAGTAGGGGTGTCGGTGCTGG 0: 1
1: 0
2: 1
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183762280 Original CRISPR AGAGCTCTGTGTCTCCCCGG GGG (reversed) Intronic
No off target data available for this crispr