ID: 1183767241

View in Genome Browser
Species Human (GRCh38)
Location 22:39889750-39889772
Sequence GTTGTATTTTTACCAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1661
Summary {0: 1, 1: 0, 2: 1, 3: 64, 4: 1595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183767241_1183767242 21 Left 1183767241 22:39889750-39889772 CCTCTTTTTGGTAAAAATACAAC 0: 1
1: 0
2: 1
3: 64
4: 1595
Right 1183767242 22:39889794-39889816 AGAAAATGTACCTGTATAAGTGG 0: 1
1: 0
2: 2
3: 18
4: 254
1183767241_1183767244 26 Left 1183767241 22:39889750-39889772 CCTCTTTTTGGTAAAAATACAAC 0: 1
1: 0
2: 1
3: 64
4: 1595
Right 1183767244 22:39889799-39889821 ATGTACCTGTATAAGTGGTTGGG No data
1183767241_1183767243 25 Left 1183767241 22:39889750-39889772 CCTCTTTTTGGTAAAAATACAAC 0: 1
1: 0
2: 1
3: 64
4: 1595
Right 1183767243 22:39889798-39889820 AATGTACCTGTATAAGTGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183767241 Original CRISPR GTTGTATTTTTACCAAAAAG AGG (reversed) Intronic
900660827 1:3782463-3782485 TTTGTATTTTTACTAAAGACAGG + Intronic
900962740 1:5935701-5935723 TTTGTATTTTTACTAAAGATGGG - Intronic
901071420 1:6520985-6521007 TTTGTATTTTTACTAGAGAGGGG - Intergenic
901222851 1:7593659-7593681 GTTGTATTTTTAGTAAAGACAGG + Intronic
901354136 1:8628070-8628092 GTCGTTTTTTAAACAAAAAGAGG - Intronic
901552964 1:10009701-10009723 TTTGTATTTTTAGCAGAAACGGG + Intronic
901611319 1:10500744-10500766 TTTGTATTTTTAGCAAAGACGGG + Intronic
901720907 1:11196678-11196700 TTTGTATTTTTAGTAGAAAGGGG - Intronic
901825108 1:11856237-11856259 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
901961964 1:12833975-12833997 TTTGTATTTTTAGCAAAGACAGG - Intergenic
901984640 1:13064845-13064867 TTTGTATTTTTAGCAGAAAGGGG + Intronic
901991753 1:13120663-13120685 TTTGTATTTTTAGCAGAAACGGG - Intergenic
901997170 1:13161925-13161947 TTTGTATTTTTAGCAGAAAGGGG - Intergenic
902827478 1:18986906-18986928 TTTGTATTTTTAACAGAAACGGG + Intergenic
903199011 1:21717780-21717802 TTTGTATTTTTAGCAGAGAGAGG - Intronic
903427153 1:23262431-23262453 GTTGTATTTTTAGTAGAAACGGG - Intergenic
903581135 1:24372004-24372026 TTTGTATTTTTAGTAAAAACAGG - Intronic
903670085 1:25030437-25030459 TTTGTATTTTTACTAGAGAGAGG + Intergenic
903680555 1:25093590-25093612 TTTGTATTTTTAGTAAAAAGAGG - Intergenic
904017023 1:27429602-27429624 TTTGTATTTTTACTAAAGACAGG - Intronic
904088789 1:27930045-27930067 TTTGTATATTTAGCAAAAAGGGG - Intergenic
904158538 1:28504960-28504982 TTTGTATTTTTAGCAAGACGGGG - Intergenic
904170745 1:28590890-28590912 TTTGTATTTTTAGTAAAAACGGG + Intronic
904249839 1:29215404-29215426 TTTGTATTTTTAGTAAAGAGGGG - Intronic
904509128 1:30987366-30987388 TTTGTATTTTTAGTAGAAAGGGG + Intronic
904516235 1:31057551-31057573 TTTGTATTTTTAGCAGAGAGAGG - Intronic
904583497 1:31565179-31565201 TTTGTATTTTTAGCAGAAACAGG - Intergenic
905064448 1:35168136-35168158 TTTGTATTTTTAGTAAAACGGGG - Intergenic
905110668 1:35592115-35592137 GTTGTATTTTTACTAGAGACCGG - Intronic
905216027 1:36408210-36408232 TTTGTATTTTTAGCAAAGACAGG - Intergenic
905496989 1:38398565-38398587 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
905570601 1:39001435-39001457 TTTGTATTTTTAGCAGAGAGGGG + Intronic
905698937 1:39997297-39997319 TTTGTATTTTTACCAGAGACGGG + Intergenic
905755687 1:40507349-40507371 TTTGTATTTTTACTAGAAACGGG + Intergenic
906248813 1:44295761-44295783 GTTGCATTTTTCCCAAAGATTGG - Intronic
906271785 1:44484968-44484990 TTTGTATTTTTACTAGAAATGGG - Intronic
906288039 1:44600994-44601016 ATTGCAATTGTACCAAAAAGAGG - Intronic
907224805 1:52935416-52935438 TTTGTATTTTTAATAAAAACGGG - Intronic
907253263 1:53157861-53157883 TTTGTATTTTTATTAAAAATGGG - Intergenic
907645013 1:56233467-56233489 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
907672330 1:56486815-56486837 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
907733986 1:57093939-57093961 ATTGTATTTTTAGTAGAAAGGGG - Intronic
907784844 1:57601399-57601421 TTTGTATTTTTAGTAGAAAGGGG - Intronic
908067940 1:60427616-60427638 TTTGTATTTTTAGCAGAAACTGG - Intergenic
908125011 1:61022074-61022096 TTTGTATTTTTAGTAAAAACCGG + Intronic
908252825 1:62278564-62278586 TTTGTATTTTTAGTAGAAAGGGG + Intronic
908268238 1:62398835-62398857 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
908506836 1:64811656-64811678 ACTGTATTTTTACAATAAAGTGG - Intronic
908619058 1:65955423-65955445 GTTGTTGTTTTTCCAATAAGAGG - Intronic
908623995 1:66019525-66019547 TTTGTATTTTTAGCAAAGACAGG + Intronic
908742872 1:67346556-67346578 TTTGTATTTTTAGTAGAAAGTGG + Intronic
908753374 1:67445687-67445709 TTTGTATTTTTAGTAAAAATAGG - Intergenic
908851926 1:68385609-68385631 TTGGTATTGTTACCAGAAAGGGG - Intergenic
909291661 1:73890666-73890688 GGTGTATTGTTACAAAAAACAGG - Intergenic
909291665 1:73890724-73890746 GGTGTATTGTTACAAAAAACAGG - Intergenic
909372219 1:74897417-74897439 TTTGTATTTTTACTAGAAACGGG + Intergenic
909603551 1:77485943-77485965 TTTGTATTTTTATTAAAGAGGGG - Intronic
909647653 1:77935207-77935229 TTTGTATTTTTAGTAGAAAGGGG + Intronic
909656296 1:78037134-78037156 GTTGTAATTTTACCAGAAGCAGG - Intronic
909962335 1:81861715-81861737 TTTGTATTTTTAGTAAAAACAGG - Intronic
910114843 1:83720557-83720579 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
910256481 1:85253279-85253301 GTTTTCTTTTTACAAAAAATAGG + Intronic
910331556 1:86078250-86078272 GTATTTTTTTTACCAAGAAGGGG - Intronic
910360145 1:86408085-86408107 TTTGTATTTTTAGCAAAGATGGG - Intergenic
910779683 1:90916206-90916228 GTTTTTTTTATACTAAAAAGTGG - Exonic
911082360 1:93945822-93945844 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
911532971 1:99067845-99067867 TTTGTATTTTTAGCAAAGACAGG + Intergenic
911669269 1:100590065-100590087 GTTATAATTTTACCAAGAAAGGG + Intergenic
911841651 1:102689612-102689634 TTTGTATTTTTACCAGAGATGGG + Intergenic
912359945 1:109087031-109087053 GTTGTATTTTTAGTAAAGACAGG + Intergenic
912830287 1:112946723-112946745 TTTGTATTTTTAGTAGAAAGGGG + Intronic
912912161 1:113773350-113773372 TTTGTATTTTTAGTAAAGAGGGG - Intronic
912933822 1:113985975-113985997 GTTGTGGGTTTACCAAAATGAGG - Intergenic
913027636 1:114861970-114861992 TTTGTATTTTTAGTAGAAAGGGG + Intronic
913236564 1:116789554-116789576 TTTGTATTTTTAGCAGAAACAGG - Intergenic
913249088 1:116897017-116897039 TTTGTATTTTTACCAGTAACGGG - Intergenic
913293985 1:117301007-117301029 TTTGTATTTTTAGTAAAAACAGG + Intergenic
913348887 1:117835929-117835951 TTTGTATTTTTAGCAAAGATAGG - Intergenic
913426013 1:118730521-118730543 TTTGTATTTTTAGAAAAAACAGG - Intergenic
913432902 1:118814949-118814971 TTTGTATTTTTAGTAAAAACAGG - Intergenic
913446423 1:118955156-118955178 GGTTTATTTTTATCTAAAAGGGG + Intronic
913572960 1:120139873-120139895 TTTGTATTTTTAGCAGAAACAGG + Intergenic
914294220 1:146304678-146304700 TTTGTATTTTTAGCAGAAACAGG + Intergenic
914555264 1:148755461-148755483 TTTGTATTTTTAGCAGAAACAGG + Intergenic
914761903 1:150605809-150605831 TTTGTATTTTTAGTAAAAACGGG + Intronic
914811066 1:151028593-151028615 TTTGTATTTTTACCAGAGACAGG + Intronic
914897500 1:151690018-151690040 TTTGTATTTTTAGTAAAAATGGG + Intronic
915191155 1:154151915-154151937 TTTGTATTTTTAGTAGAAAGGGG - Intronic
915259033 1:154662344-154662366 TTTTTATTTTTCCTAAAAAGTGG - Intergenic
915370026 1:155341347-155341369 GTTGTATTTTTAGTAGAGAGGGG + Intronic
915385211 1:155485081-155485103 TTTGTATTTTTACCAGAGATGGG - Intronic
915429251 1:155852939-155852961 TTTGTATTTTTACCAGAGACGGG - Intronic
915502597 1:156329476-156329498 TTTGTATTTTTAGCAAAGACAGG + Intronic
915847490 1:159282765-159282787 TTTGTATCTTTAAAAAAAAGAGG - Intergenic
916241530 1:162644765-162644787 TTTGTATTTTTAGCAGACAGGGG + Intronic
916286056 1:163107119-163107141 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
916733721 1:167588820-167588842 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
917040000 1:170794844-170794866 GTTGTTTTCTTTCCAAAAATAGG + Intergenic
917122803 1:171659208-171659230 TTTGTATTTTTACTAAAGACAGG - Intergenic
917566687 1:176219729-176219751 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
917670132 1:177265945-177265967 TTTGTATTTTTACTAAAGATAGG - Intronic
917880344 1:179329544-179329566 GTTGTATTTTTAGTAAAGATGGG - Intronic
918059244 1:181047425-181047447 TTTGTATTTTTAGTAAAAACAGG - Intronic
918577724 1:186083489-186083511 TTTTTTTTTTTAGCAAAAAGTGG - Intronic
918781914 1:188710365-188710387 TTTGTATTTTTAGCAGAAACAGG - Intergenic
918905215 1:190483381-190483403 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
918952607 1:191159117-191159139 GTTGTGTTTTTATCATAAATGGG - Intergenic
919184439 1:194126692-194126714 GTTCTATTTTTACTTGAAAGAGG + Intergenic
919228218 1:194737082-194737104 GTTGTATTTTTAGGCAAAATTGG + Intergenic
919352154 1:196471078-196471100 TTTGTATTTTTACTAAAGACGGG + Intronic
919378662 1:196826619-196826641 TTTGTATTTTTACTAGAAACAGG + Intronic
919593990 1:199538716-199538738 GTTGTGGGTTTACCAAAATGAGG - Intergenic
919870118 1:201813882-201813904 TTTGTATTTTTAGTAGAAAGGGG - Intronic
919905356 1:202074848-202074870 GTTGTATTTTTAGCAGAGACAGG + Intergenic
920241206 1:204552098-204552120 TTTGTATTTTTAGTAAAAATGGG - Exonic
920502408 1:206493615-206493637 TTTGTATTTTTACCAGAGATGGG - Intronic
920929720 1:210376034-210376056 TTTGTATTTTTACTAGATAGGGG + Intronic
920982303 1:210849535-210849557 TTTGTATTTTTACCAGAGACGGG + Intronic
921236046 1:213131613-213131635 TTTGTATTTTTAGCAGAAACGGG + Intronic
921331879 1:214047245-214047267 GTTGTATTTTTAGCAGAGATGGG - Intergenic
921495780 1:215839776-215839798 ACTGTATTTATACTAAAAAGAGG + Intronic
921850067 1:219925360-219925382 TTTGTATTTTTAGCAGAAACGGG - Intronic
921876541 1:220202769-220202791 TTTGTATTTTTACTAGAAATGGG - Intronic
922027452 1:221763978-221764000 GTTGTATTTTTAGTAGAAATGGG + Intergenic
922202390 1:223416948-223416970 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
922301018 1:224300931-224300953 TTTGTATTTTTAGTAAAAATGGG - Intronic
922520415 1:226245767-226245789 TTTGTATTTTTACTAGAAACGGG + Intronic
922999719 1:229996954-229996976 TTTGTATTTTTACTAGAGAGGGG + Intergenic
923307115 1:232698535-232698557 TTTGTATTTTTAGTAAAAACAGG + Intergenic
923622563 1:235590281-235590303 TTTGTATTTTTAGTAAAGAGGGG - Intronic
923752472 1:236758790-236758812 TTTGTATTTTTACTAGAAACAGG + Intronic
924051296 1:240082032-240082054 GTTGTATTGTTACCAGAAAGGGG + Intronic
924226980 1:241929914-241929936 TTTGTATTTTTACTAAAGACAGG - Intergenic
924437831 1:244059405-244059427 TTTTTTTTTTTACCAAGAAGTGG + Intergenic
924448611 1:244157626-244157648 GATGTATTGTTACCAGAAAGGGG + Intergenic
924473183 1:244361398-244361420 GTTGTATTTTTAGTAAAGACGGG + Intronic
924518710 1:244787482-244787504 TTTGTATTTTTACCAGAAGTGGG - Intergenic
924555396 1:245114289-245114311 TTTGTATTTTTAGCAGAAACAGG - Intronic
924557841 1:245132636-245132658 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1062987090 10:1779180-1779202 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1063108895 10:3017919-3017941 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1063197735 10:3758955-3758977 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1063217888 10:3940270-3940292 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1063238644 10:4145559-4145581 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1063361684 10:5464398-5464420 TTTGTATTTTTAGCAAAGAAGGG - Intergenic
1063388077 10:5629000-5629022 GTTTTTTTTTTACCAAGAATCGG + Intergenic
1063416389 10:5876053-5876075 GTTGTATTTTTAGAAGAAACTGG + Intronic
1063468944 10:6268848-6268870 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1063741157 10:8821749-8821771 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1063926587 10:10983737-10983759 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1063983815 10:11479746-11479768 GTTGTATTTTTAGTAGAAACGGG + Intronic
1064029823 10:11876761-11876783 TTTGTATTTTTACTAGAAACAGG + Intergenic
1064057594 10:12110864-12110886 GTTTTATTTTTAGCAGAAATGGG - Intronic
1064083932 10:12330930-12330952 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1064149689 10:12852304-12852326 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1064522320 10:16216097-16216119 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1064540018 10:16395872-16395894 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1064551209 10:16502815-16502837 GTTGTATTTTTAGTAAAGACGGG - Intronic
1064661144 10:17609324-17609346 GTTGTATTTTTAATAGAAATGGG + Intronic
1064739189 10:18414654-18414676 TTTGTATTTTTAGCAAAAATGGG + Intronic
1064822245 10:19350446-19350468 GTTGTATTTTTAGTAAAGACAGG + Intronic
1064837320 10:19548168-19548190 TTTGTATTTTTACTAAAGATGGG + Intronic
1065029288 10:21568805-21568827 GTTGTATTTTTAGCAGAGACGGG + Intronic
1065207352 10:23369873-23369895 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1065219408 10:23480751-23480773 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1065302222 10:24333194-24333216 TTTGTATTTTTAGTAAAAACGGG + Intronic
1065675381 10:28168063-28168085 TTTGTATTTTTAGCAGAAACGGG - Intronic
1065766539 10:29035380-29035402 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1065876882 10:30004893-30004915 GTTGTATTTTTAGTAGAGAGGGG + Intergenic
1065919528 10:30380100-30380122 TTTGTATTTTTAATACAAAGAGG - Intergenic
1065942957 10:30581645-30581667 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1066233174 10:33458115-33458137 GTTGTATTTTTACAATAAAAAGG - Intergenic
1066377004 10:34866712-34866734 GTTGTATTTTTAGTAAAGATGGG - Intergenic
1067093134 10:43281420-43281442 GTTGTATTTTTAGTAGAGAGAGG - Intergenic
1067180959 10:43985589-43985611 GTTGTATTTTTAGTAAAGACGGG - Intergenic
1067444232 10:46330623-46330645 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1067485661 10:46647426-46647448 TTTGTCTTTTTAAGAAAAAGAGG - Intergenic
1067609096 10:47694224-47694246 TTTGTCTTTTTAAGAAAAAGAGG + Intergenic
1067799016 10:49344820-49344842 TTTGAATTTTTATCATAAAGAGG - Intergenic
1068112794 10:52700039-52700061 GTTGTATTATTTCAAAAAATTGG + Intergenic
1068167962 10:53355836-53355858 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1068219513 10:54026239-54026261 TTTGTATTTTTATCAGAAACGGG + Intronic
1068246945 10:54384369-54384391 GTTGCATTTTCACTAAAAAAAGG - Intronic
1068320052 10:55400961-55400983 ATTATATTTTTACCAAAAGGAGG - Intronic
1068559797 10:58501230-58501252 ATTGTATTTTAAATAAAAAGAGG - Intergenic
1068691226 10:59917051-59917073 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1068700302 10:60012741-60012763 TTTGTATTTTTAGCATAAACGGG + Intergenic
1068982740 10:63078616-63078638 TTTGTATTTTTAGCAAAGACTGG + Intergenic
1069389541 10:67919039-67919061 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1069460409 10:68589841-68589863 TTTGTATTTTTAGCAGAAATGGG + Intronic
1069467976 10:68659054-68659076 TTTGTATTTTTAGCAAAGATGGG - Intronic
1069729489 10:70601655-70601677 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1069931349 10:71883984-71884006 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1070858258 10:79627340-79627362 GATGTAATTTTACAACAAAGAGG + Intergenic
1071374589 10:84989768-84989790 GTTGTATTTTTAGTAGAAATGGG + Intergenic
1071566987 10:86676389-86676411 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1071624684 10:87155874-87155896 TTTGTCTTTTTAAGAAAAAGAGG + Intronic
1071837379 10:89432011-89432033 GTTTTATCATTACCCAAAAGAGG - Exonic
1072098485 10:92206242-92206264 TTTGTATTTTTAGCAGAAACGGG + Intronic
1072176275 10:92925464-92925486 TTTGTATTTTTAGTAAAAACAGG + Intronic
1072429730 10:95360195-95360217 GTTGAAGTTATACAAAAAAGAGG - Intronic
1072561909 10:96584641-96584663 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1072573008 10:96675062-96675084 GTTGTATTTTTAGCAGAGATGGG + Intronic
1072614688 10:97041641-97041663 TTTGTATTTTTAGTAAAGAGAGG + Intronic
1072809690 10:98450080-98450102 TTTGTATTTTTACTAGAAATGGG - Intergenic
1073148343 10:101294903-101294925 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1073310516 10:102536980-102537002 TTTGTATTTTTAGCAGAGAGAGG + Intronic
1073311311 10:102544527-102544549 TTTGTATTTTTACTAGAAATAGG - Intronic
1073389873 10:103165839-103165861 TTTGTATTTTTAGCAGAAACAGG + Intronic
1073470599 10:103719889-103719911 TTTGTATTTTTAGCAGAAATGGG + Intronic
1073477193 10:103762196-103762218 GTTGTATTTTTAGCAGAGATGGG + Intronic
1073510400 10:104039231-104039253 GTGGTATTATTACAAAAAGGAGG - Intronic
1073664958 10:105521141-105521163 GTTGTATTGTTACTAAATTGAGG - Intergenic
1073740511 10:106400899-106400921 GTTGGATTTTTACATAACAGGGG - Intergenic
1073816799 10:107215887-107215909 GTTGTTTGTTTCCCAATAAGAGG - Intergenic
1074284373 10:112084270-112084292 GTTGTATTTTTAGTAAAGAAGGG + Intergenic
1074632186 10:115271201-115271223 GATGTATTCTTAGCAAAATGAGG + Intronic
1074779909 10:116794639-116794661 TTTGTATTTTTAATAAAAATGGG - Intergenic
1074839274 10:117332676-117332698 TTTGTATTTTTAGCAGAAATGGG + Intronic
1074856700 10:117479279-117479301 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1074933382 10:118152759-118152781 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1075117358 10:119638120-119638142 TTTGTATTTTTACCAGAGACGGG - Intergenic
1075195773 10:120357885-120357907 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1075527294 10:123197440-123197462 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1075751640 10:124777105-124777127 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1075886607 10:125904950-125904972 GTTGTATTTTTAGCAGAGACGGG - Intronic
1075967723 10:126627170-126627192 TTTGTATTTTTAACAAAGATGGG + Intronic
1076397298 10:130149577-130149599 TTTGTATCTTTACCCAAAATAGG + Intronic
1077666663 11:4116418-4116440 GTTGTATTTTTAGTAAAGACAGG - Intronic
1077812009 11:5647692-5647714 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1078189942 11:9085551-9085573 TTTGTATTTTTAGCAAAGACGGG - Intronic
1078768642 11:14325470-14325492 TTTGTATTTTTAGCAGAGAGGGG + Intronic
1078770760 11:14349332-14349354 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1079571552 11:21949670-21949692 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1079671352 11:23175283-23175305 GTTGTATTTTTAGTAAAGATTGG - Intergenic
1079708859 11:23655342-23655364 TTTGTATTTTTAACAAAGATGGG - Intergenic
1080539170 11:33250212-33250234 TTTGTATTTTTAGCAGAGAGAGG + Intergenic
1080755811 11:35197361-35197383 GATGTCTCTTTACTAAAAAGGGG - Intronic
1080999548 11:37651391-37651413 TTTGTATTTTTACTAAAGACGGG + Intergenic
1081364141 11:42214287-42214309 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1081704195 11:45171269-45171291 GTTGTATTTTTAGTAGAAACAGG + Intronic
1081838062 11:46174289-46174311 GTTGTATTTTTAGTAAAGATGGG + Intergenic
1081888169 11:46517317-46517339 TTTGTATTTTTAGTAAAAACAGG + Intronic
1081961294 11:47139500-47139522 GTTGTATTTTTAGCAGAGACAGG - Intronic
1082064421 11:47887717-47887739 GTTGTATTTTTAGTAGAAACAGG - Intergenic
1082115013 11:48318677-48318699 TTTGGATTTCTACCTAAAAGTGG + Intergenic
1083028482 11:59570699-59570721 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1083240936 11:61387985-61388007 TTTGTATTTTTAGCACAAATGGG + Intergenic
1083249711 11:61458243-61458265 GTTGTATTTTTAGTAGAAACAGG - Intronic
1083439103 11:62664500-62664522 TTTGTATTTTTAGCAAAAACGGG + Intronic
1083449985 11:62737024-62737046 CTTGTATTTTTACTAGAAACGGG - Intronic
1083819798 11:65162753-65162775 TTTGTATTTTTACTAGAAATGGG - Intergenic
1084015308 11:66375945-66375967 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1084279584 11:68079103-68079125 TTTGTATTTTTAGTAAAAACAGG + Intronic
1084346037 11:68549585-68549607 GATGTATCTTTTCCCAAAAGAGG + Intronic
1084621674 11:70274954-70274976 GTTGGATTTCTACAAAGAAGTGG + Intronic
1084753230 11:71218021-71218043 TTTGTATTTTTAGAAGAAAGAGG + Intronic
1085278158 11:75313179-75313201 TTTGTATTTTTAGCAGAAACAGG - Intronic
1085322059 11:75581262-75581284 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1085494207 11:76952835-76952857 TTTGTATTTTTAGTAAAGAGAGG + Intronic
1085538971 11:77248372-77248394 GTTGTATTTTTACTAGAGACAGG + Intronic
1085632036 11:78126357-78126379 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1085741974 11:79085197-79085219 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1086131023 11:83402569-83402591 TTTGTATTTTTAGAAAAAATGGG - Intergenic
1086204278 11:84239350-84239372 TTTGTATTTTTACCAGAGACAGG + Intronic
1086318118 11:85614467-85614489 TTTGTATTTTTAGTAAAAACGGG - Intronic
1086426862 11:86693400-86693422 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1086484487 11:87283684-87283706 TTTGTATTTTTAGCAGAAACAGG - Intronic
1086485687 11:87298912-87298934 TTTGTATTTTTACTAAAGACGGG - Intronic
1086530161 11:87775433-87775455 ATTTTAATTTTACCAAAAATTGG + Intergenic
1086695406 11:89838864-89838886 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1086710747 11:90005621-90005643 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1087060739 11:93974592-93974614 TTTGTATTTTTTCCAGAAACAGG - Intergenic
1087700326 11:101430074-101430096 GTTTTATTTTGACATAAAAGAGG + Intergenic
1087803666 11:102532424-102532446 GTTGTATTTTTATTAGAAACAGG - Intergenic
1087928355 11:103946901-103946923 GTTGTTTTTTTTCCTAAAATTGG - Intronic
1088017154 11:105074793-105074815 GTTGTTTTTTTTCCAAAACGAGG - Intronic
1088486595 11:110346788-110346810 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1089242197 11:117091375-117091397 TTTGTATTTTTAGTAAAAACAGG + Intronic
1089485012 11:118838578-118838600 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1089840422 11:121412647-121412669 TTTGTAGTTTTACTAAAGAGAGG - Intergenic
1090061275 11:123466102-123466124 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1090263723 11:125341182-125341204 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1090500276 11:127254369-127254391 TTTGTATTTTTAGCAAAAACAGG - Intergenic
1090570304 11:128037938-128037960 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1091081251 11:132670446-132670468 GTTTCATTTGAACCAAAAAGGGG - Intronic
1091847001 12:3664833-3664855 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1091954908 12:4631400-4631422 GGTTTATTTTTGCCACAAAGTGG + Intronic
1092139920 12:6176590-6176612 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1092198797 12:6567119-6567141 GTTGTATTTTTAGTAAAGACAGG + Intronic
1092477329 12:8830221-8830243 TTTGTATTTTTAGTAAAAACAGG + Intronic
1092484260 12:8888570-8888592 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1092514510 12:9195092-9195114 TTTGAATTTTTAGCAAAAAAAGG + Intronic
1092683329 12:11013898-11013920 GTTGTATTTTTACTAGAGACTGG + Intronic
1093032696 12:14303254-14303276 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1093058667 12:14580184-14580206 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1093128616 12:15361262-15361284 GTTGTATTTTTAGTAAAGATGGG - Intronic
1093156835 12:15696466-15696488 TTTGTATTTTTAGTAAAAATGGG - Intronic
1093559995 12:20527088-20527110 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1093617961 12:21250980-21251002 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1093869982 12:24279017-24279039 GTGGTAATTTTACCCACAAGAGG + Intergenic
1093925665 12:24906015-24906037 TTTGTATTTTTACCAGAGACAGG - Intronic
1094192197 12:27709242-27709264 GTTGTATGCTTACCAAGAATCGG + Intergenic
1094392115 12:29963125-29963147 GTTGTATTTTTAGCAGAGACGGG + Intergenic
1094402140 12:30073580-30073602 GTTGTATTTTTAGTAGAGAGGGG - Intergenic
1094409127 12:30150515-30150537 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1094663076 12:32490568-32490590 TTTGTATTTTTAGCAAAGACAGG + Intronic
1095468584 12:42513131-42513153 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1095471951 12:42546580-42546602 TTTGTATTTTTAGTAAAAACAGG - Intronic
1095784789 12:46098216-46098238 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1096005883 12:48170982-48171004 TTTGTATTTTTAGTAAAAATGGG - Intronic
1096161633 12:49383188-49383210 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1096400720 12:51304071-51304093 TTTGTATTTTTACTAAAGACAGG - Intronic
1096539162 12:52294663-52294685 GTTCTATTTTTTCCTATAAGTGG - Intronic
1096656385 12:53095129-53095151 ATTGTATTTTTAGCAGAGAGGGG - Intergenic
1096671759 12:53203474-53203496 TTTGTATTTTTAGCAAAGATGGG - Intronic
1096695828 12:53347575-53347597 TTTGTATTTTTACCAGAGACGGG + Intergenic
1096902440 12:54899180-54899202 TTTGTATTTTTAGCAGAAAGGGG - Intergenic
1096923624 12:55117151-55117173 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1097067202 12:56329500-56329522 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1097092499 12:56518388-56518410 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1097115499 12:56693813-56693835 TTTGTATTTTTAGGAAAAACAGG - Intergenic
1097494273 12:60310580-60310602 GTTTTAATTTTACAAAAAATTGG - Intergenic
1097495009 12:60320785-60320807 TTTGTTTTTTAACCAAAAAGGGG + Intergenic
1098219443 12:68253027-68253049 GATGAATTTTTCCCAAAGAGCGG - Intronic
1098306704 12:69109652-69109674 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1098586784 12:72163938-72163960 TTTGTATTTTTACCAGAGACAGG - Intronic
1098786703 12:74767476-74767498 TTTGGATATTTACCAAAAAGTGG - Intergenic
1099118117 12:78652590-78652612 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1099454277 12:82845054-82845076 GTTGTATTTTTAGTAGAAATGGG - Intronic
1099600160 12:84725245-84725267 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1100235598 12:92657752-92657774 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1100265397 12:92970884-92970906 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1100341797 12:93686126-93686148 TTTGTATTTTTAGTAAAAATGGG - Intronic
1100976693 12:100130129-100130151 TTTGTATTTTTAGCAGAAACGGG + Intronic
1101058693 12:100948008-100948030 GTTGTATTTTTAGTAAAGACAGG - Intronic
1101085979 12:101236794-101236816 GTGTTATTTTTAACCAAAAGTGG - Intergenic
1101454040 12:104810911-104810933 GTTCTATTTTTACTAAAACAAGG - Intronic
1101545517 12:105708613-105708635 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1101762595 12:107671126-107671148 GTTGTTGTTTTAGCAAAGAGAGG + Intergenic
1101908796 12:108847626-108847648 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1102022059 12:109690281-109690303 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1102335016 12:112071189-112071211 TTTGTATTTTTAGCAGAAACGGG + Intronic
1102342682 12:112135968-112135990 GTTGTATTTTTAACAGAGACAGG - Intronic
1102486584 12:113262236-113262258 TTTGTATTTTTACCAGAGATGGG - Intronic
1102808278 12:115801337-115801359 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1102883491 12:116504240-116504262 ATTTTCTTTTTACCAAAAAGTGG - Intergenic
1103355221 12:120314914-120314936 TTTGTATTTTTAATAAAAACGGG - Intergenic
1103498899 12:121385187-121385209 TTTGTATTTTTACTAGAAATGGG + Intronic
1103510313 12:121469064-121469086 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1103544799 12:121692450-121692472 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1103546507 12:121705519-121705541 GTTGTTTTTTTAGGAAAAGGTGG + Intergenic
1103593912 12:122011496-122011518 TTTGTATTTTTAATAAAAATGGG - Intergenic
1103832931 12:123794975-123794997 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1104233632 12:126910297-126910319 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1104411979 12:128566059-128566081 TTTGTATTTTTAGCAGAAATGGG + Intronic
1104422696 12:128650415-128650437 GTTTTATTTTTAAAAAAAGGTGG + Intronic
1104439409 12:128782641-128782663 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1104560429 12:129839297-129839319 TTTGTATTTTTAGTAAAAACGGG + Intronic
1104863380 12:131937545-131937567 TTTGTATTTTTAGTAAAAATGGG + Intronic
1104995376 12:132651045-132651067 GTTGTATTTTTAGTAAAGATGGG + Intronic
1105020864 12:132816023-132816045 TTTGTATTTTTAGCAAAGATGGG - Intronic
1105036727 12:132929771-132929793 GTTGTATTTTTAGTAGAAATGGG - Intronic
1105466757 13:20650421-20650443 GGAGTATTTTTATCACAAAGCGG - Intronic
1105973569 13:25453296-25453318 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1106043229 13:26113934-26113956 TTTGTATTTTTACCAGAGACAGG + Intergenic
1106125396 13:26896673-26896695 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1106177454 13:27343302-27343324 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1106557869 13:30825701-30825723 TTTGTATTTTTACCAGAGACAGG - Intergenic
1106627523 13:31435785-31435807 GTTGTATTCTTGCCAAGAGGTGG + Intergenic
1106732896 13:32560449-32560471 TTTGTATTTTTACTAAAGATAGG - Intergenic
1107478763 13:40767326-40767348 TTTGTATTTTTAGCAAAGATGGG + Intronic
1107615503 13:42162630-42162652 TTTGTATTTTTAGTAAAAACGGG - Intronic
1107785313 13:43950210-43950232 CTTGTGTCTTTACCAAGAAGTGG + Intergenic
1107943049 13:45391643-45391665 TTTGTATTTTTACTAGAAACAGG - Intergenic
1108017969 13:46096050-46096072 TTTGTATTTTTAGTAAAAACGGG + Intronic
1108110237 13:47063773-47063795 TTTGTATTTTTACTAAAGACAGG + Intergenic
1108145702 13:47474150-47474172 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1108634322 13:52317476-52317498 GTTGTATTTTTACTAAAGACAGG + Intergenic
1109407800 13:61923852-61923874 GTTGTGCATTTACCAGAAAGAGG + Intergenic
1109415983 13:62041139-62041161 GTTTTATTTTTGCCACAAATAGG - Intergenic
1109756246 13:66763968-66763990 GTTGTATTTTTAGTAGAAATGGG + Intronic
1109792822 13:67271782-67271804 GTTGGATTTACACAAAAAAGTGG + Intergenic
1109827517 13:67741659-67741681 GTGGTATTGTTACCAGAAAGGGG - Intergenic
1109934189 13:69259656-69259678 GTGGGATTGTTACCAGAAAGGGG - Intergenic
1109967776 13:69724007-69724029 TTTGTATTTTTAGTAAAAACAGG + Intronic
1110260182 13:73475901-73475923 GGTGTATTTATACCAGAAAAGGG - Intergenic
1110288659 13:73778942-73778964 GTTTCATATTTACCAAACAGTGG + Intronic
1110316911 13:74119159-74119181 TTTGTATTTTTAGTAAAAATGGG - Intronic
1110752812 13:79135754-79135776 TGTGTATTTTTTCCAAAAAATGG - Intergenic
1110811315 13:79813376-79813398 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1110961627 13:81633453-81633475 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1110983334 13:81932384-81932406 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1111031965 13:82612081-82612103 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1111209884 13:85063964-85063986 TTTGTATTTTTAATAAAAACGGG + Intergenic
1111742637 13:92223513-92223535 GTTGTATTTTTGCAAACAAATGG - Intronic
1111931935 13:94521496-94521518 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1112107809 13:96260809-96260831 TTTGTATTTTTAGTAAAAATGGG + Intronic
1112270936 13:97968993-97969015 TTTGTATTTTTAGTAAAAACGGG + Intronic
1112419054 13:99230875-99230897 TTTGTATTTTTACTAGAAATGGG - Intronic
1112754131 13:102611502-102611524 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1113211764 13:107991100-107991122 GATGTATTTTTCCCAAAATTTGG + Intergenic
1113575462 13:111392161-111392183 TTTGTATTTTTAGTAGAAAGCGG - Intergenic
1113829112 13:113280918-113280940 TTTGTATTTTTAGCAAAGATGGG - Intergenic
1113982676 13:114289350-114289372 TTTGTATTTTTAGTAAAAACGGG - Intronic
1114465168 14:22917037-22917059 GTTGTATTTTTAGCAGAGACGGG + Intronic
1114541569 14:23464123-23464145 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1114571881 14:23675400-23675422 CTAGTATATTTTCCAAAAAGTGG + Intergenic
1114859568 14:26498237-26498259 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1114953915 14:27793864-27793886 TTTGTATTTTTACTAGAGAGGGG - Intergenic
1114994462 14:28330947-28330969 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1115064407 14:29239511-29239533 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1115074499 14:29370557-29370579 TTTGGATTTTTACTAAAAAGAGG + Intergenic
1115126985 14:30007626-30007648 GTTGTATTTTTAGCAGAGATGGG + Intronic
1115292101 14:31783687-31783709 GTTGTATTTTTAGCAGAGACAGG + Intronic
1115531774 14:34334353-34334375 GTTGTTTATTTACCCAAAAGGGG - Intronic
1115540459 14:34414616-34414638 TTTGTATTTTTAGCAAAGATGGG - Intronic
1115817476 14:37178510-37178532 TTTGTATTTTTACTAGAAACGGG + Intergenic
1115925496 14:38428879-38428901 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1115986999 14:39112447-39112469 TTTGTATTTTTACCAAAGACGGG + Intergenic
1116053488 14:39834347-39834369 TTTGTATTTTTAGTAGAAAGAGG - Intergenic
1116481546 14:45397322-45397344 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1116649293 14:47568430-47568452 GATGTATTTTTGCTAAAAATTGG - Intronic
1116728118 14:48588299-48588321 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1116779100 14:49216135-49216157 AATCTGTTTTTACCAAAAAGGGG - Intergenic
1116826103 14:49675253-49675275 TTTGTATTTTTAACAAAGACGGG + Intronic
1117143400 14:52812161-52812183 TTTGTATTTTTACTAAAGACAGG - Intergenic
1117218889 14:53581464-53581486 CATGTATTTTAACCAAAATGTGG + Intergenic
1117231652 14:53725245-53725267 GTTGTATTTTTAGCAGAGACAGG - Intergenic
1117370129 14:55070604-55070626 TTTGTATTTTTACTAGAAATGGG + Intergenic
1117382438 14:55178077-55178099 TTTGTATTTTTAGCAAAGACGGG - Intronic
1117392380 14:55273975-55273997 TTTGTATTTTTAGCAAAGACGGG + Intronic
1117563821 14:56972808-56972830 GTTGTATTTTTAGTAAAGACGGG - Intergenic
1117654142 14:57937237-57937259 TTTGTATTTTTACCAGAGACGGG + Intronic
1117771283 14:59136626-59136648 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1117886395 14:60368824-60368846 TTTGTATTTTTACTAGAAACAGG - Intergenic
1118099949 14:62586697-62586719 GTTGTATTTTTACTAGAGACGGG + Intergenic
1118114313 14:62757972-62757994 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1118211887 14:63772948-63772970 TTTGTATTTTTAGTAAAATGGGG + Intergenic
1118428115 14:65689708-65689730 GTTGTATTTTTAGTAGAAATGGG + Intronic
1118467413 14:66043527-66043549 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1118733801 14:68688095-68688117 TTTGTATTTTTAGTAAAAACGGG - Intronic
1118870240 14:69735301-69735323 TTTGTTTTTTTACAAAAGAGGGG - Intronic
1119067799 14:71547869-71547891 GTTGTATTTTTACTAGAAACAGG - Intronic
1119091120 14:71782157-71782179 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1119228593 14:72962667-72962689 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1119232527 14:72992078-72992100 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1119380588 14:74225763-74225785 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1119392665 14:74301726-74301748 TTTGTATTTTTAGCAAAGATGGG - Intronic
1119911270 14:78351788-78351810 TTTTTTTTTTTGCCAAAAAGAGG + Intronic
1120077801 14:80179876-80179898 GTTGTATTTTTAGCAGAGACGGG + Intergenic
1120236265 14:81894770-81894792 TTTGTATTTTTACCAGATACGGG + Intergenic
1120445827 14:84594229-84594251 GTTGTATTTTTAGTAAAGATGGG - Intergenic
1120459247 14:84772968-84772990 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1120790188 14:88573598-88573620 TTTGTATTTTTAGCAAAGACAGG + Intronic
1120911473 14:89670678-89670700 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1121141848 14:91549487-91549509 TTTGTATTTTTAGCGAAACGGGG - Intergenic
1121153950 14:91665696-91665718 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1121666956 14:95679900-95679922 GCTGTAGTGTTACCAGAAAGGGG - Intergenic
1122208079 14:100158235-100158257 TTTGTATTTTTACTAGAAACAGG - Intronic
1122397921 14:101447859-101447881 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1122454449 14:101839177-101839199 TTTGTATTTTTAGCAGAAATGGG - Intronic
1122472724 14:101982417-101982439 TTTGTATTTTTACAAACACGGGG - Intronic
1122749497 14:103922096-103922118 TTTGTATTTTTAGCAAAGACGGG + Intronic
1123183807 14:106495007-106495029 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1202901148 14_GL000194v1_random:40531-40553 GCTTTATTTTTATCAAAAAGGGG - Intergenic
1202871485 14_GL000225v1_random:168992-169014 GTTGTATTTTTAGCAGACACGGG + Intergenic
1123862587 15:24484272-24484294 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1124047140 15:26160868-26160890 GTTGTATTTTTACTAGAGACGGG + Intergenic
1124108299 15:26762002-26762024 TTTGTATTTTTAGCAGAAATGGG + Intronic
1124335738 15:28855702-28855724 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1124486907 15:30125759-30125781 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1124541989 15:30594736-30594758 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1124548635 15:30656527-30656549 TTTGTATTTTTAGTAAAAACGGG - Intronic
1124606916 15:31176285-31176307 TTTGTATTTTTACTAGAAACCGG + Intergenic
1124756618 15:32412564-32412586 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1124807010 15:32894311-32894333 TTTGTATTTTTAGCAGAAACGGG - Intronic
1124899900 15:33812449-33812471 GTTATATTTTTAAAAAGAAGGGG + Intronic
1124942996 15:34235607-34235629 TTTGTATTTTTAGTAAAAACAGG + Intronic
1125133718 15:36315234-36315256 TTTGTATTTTTACTAAAGACGGG - Intergenic
1125150864 15:36530725-36530747 GTTGTATTTTTAGCAGAGACAGG - Intergenic
1125191344 15:36997652-36997674 TTTGTATTTTTACTAAAGACGGG + Intronic
1125319090 15:38463317-38463339 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1125358539 15:38841694-38841716 TTTGTATTTTTACCAGAGATGGG + Intergenic
1125631278 15:41149166-41149188 TTTGTATTTTTAATAAAATGGGG + Intergenic
1125645710 15:41270940-41270962 TTTGTATTTTTACTAGAAATGGG - Intronic
1125787848 15:42337887-42337909 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1125810784 15:42539304-42539326 TTTGTATTTTTAGTAAAATGGGG - Exonic
1125871008 15:43101794-43101816 TTTGTATTTTTAGTAAAGAGAGG - Intronic
1126041679 15:44597281-44597303 TTTGTATTTTTACTAAAGACGGG + Intronic
1126566057 15:50100344-50100366 GTGGTATATTTACCTACAAGTGG - Intronic
1126635414 15:50775106-50775128 GTTGTATTTTTAGTAGAAATGGG + Intergenic
1126759143 15:51953447-51953469 TTTGTATTTTTACCAGAGATGGG - Intronic
1127111390 15:55675408-55675430 CCTGTTTTTTAACCAAAAAGAGG + Intronic
1127230465 15:56987284-56987306 TTTGTATTTTTAGTAAAGAGAGG + Intronic
1127231266 15:56998283-56998305 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1127333580 15:57962537-57962559 GTTGTATTGATAGTAAAAAGAGG + Intronic
1127420548 15:58801143-58801165 TTTGTATTTTTACTAGAAACAGG + Intronic
1127432791 15:58927440-58927462 TTTGTATTTTTAGTAAAAACGGG + Intronic
1127475053 15:59325205-59325227 GTTGTATTTTTAGTAGAGAGAGG + Intronic
1127759170 15:62121200-62121222 GTAGTCATGTTACCAAAAAGTGG + Intergenic
1127800584 15:62473920-62473942 TTTGTATTTTTAGTAAAAACAGG - Intronic
1127921802 15:63500625-63500647 TTTGGATTTTTTCCAAAAGGTGG + Intergenic
1127944703 15:63739367-63739389 TTTGTATTTTTAGTAAAAAAGGG + Intronic
1128116921 15:65113574-65113596 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1128203196 15:65827673-65827695 TTTGTATTTTTAGCAGAAAGGGG - Intronic
1128306518 15:66602513-66602535 TTTGTATTTTTAGCAAAGACAGG + Intronic
1128343087 15:66836304-66836326 GTTGTATTTTTAGTAGAAATGGG + Intergenic
1128472310 15:67965214-67965236 TTTGTATTTTTTGCAGAAAGGGG + Intergenic
1128824356 15:70697877-70697899 TTTGTATTTTTAGCAGAAACGGG - Intronic
1128979772 15:72177897-72177919 GTTGTATTTTTAGCAGAGACGGG + Intronic
1129760830 15:78128503-78128525 TTTGTATTTTTAGTAAAAACAGG - Intronic
1129843529 15:78757939-78757961 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1130234744 15:82123887-82123909 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1130240301 15:82182084-82182106 TTTGTATTTTTAGTAAAAATGGG - Intronic
1130295301 15:82643455-82643477 TTTGTATTTTTACTAAGATGGGG - Intronic
1130387160 15:83422015-83422037 TTTGGATTTATACCTAAAAGTGG + Intergenic
1130575997 15:85093666-85093688 CTGTTATTTTTACCCAAAAGAGG - Intronic
1130632876 15:85586752-85586774 TTTGTATTTTTAGTAAAAACAGG - Intronic
1130809293 15:87359564-87359586 GTTGTATTTTTAATAAAGACAGG + Intergenic
1131191716 15:90322287-90322309 TTTGTATTTTTACTAGAAATGGG - Intergenic
1131467302 15:92666051-92666073 GTTGTATTTTTAGTAAAGACGGG + Intronic
1131516290 15:93079646-93079668 ATTGTATTTTTAGTAAAAATGGG - Intronic
1131586631 15:93702672-93702694 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1131710796 15:95054199-95054221 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1131923115 15:97351857-97351879 TTTTTTTTTTTACAAAAAAGGGG + Intergenic
1132353513 15:101155088-101155110 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1132460307 16:50128-50150 TTTGTATTTTTAGCAGAAATGGG + Intronic
1132523275 16:401319-401341 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1132620189 16:862313-862335 TTTGTATTTTTAGCAAAGATGGG + Intronic
1132731589 16:1365163-1365185 TTTGTATTTTTACTAAGACGGGG + Intronic
1132816716 16:1832477-1832499 CTTATATTTTTAAGAAAAAGAGG - Intronic
1133068348 16:3227110-3227132 TTTGTATTTTTAGTAAAAATGGG + Intronic
1133120538 16:3604056-3604078 TTTGTATTTTTACTAGAAATGGG - Intronic
1133215720 16:4291167-4291189 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1133223854 16:4330896-4330918 GTTGTAGGTTTACCAGAATGAGG + Intronic
1133251212 16:4482854-4482876 TTTGTATTTTTACTAGAAATGGG - Intronic
1133393990 16:5431544-5431566 GTTGTATTTTTACTAGAGACGGG + Intergenic
1133429868 16:5727085-5727107 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1133673686 16:8048900-8048922 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1133743888 16:8673243-8673265 TTTGTATTTTTAATAGAAAGGGG + Intergenic
1133806664 16:9130668-9130690 TTTGTATTTTTACTAAAGACGGG - Intergenic
1133816575 16:9202153-9202175 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1133887334 16:9842763-9842785 TTTGTATTTTTAGTAAAAATGGG - Intronic
1134185041 16:12078301-12078323 CTTGTATTTTTACTAGAAATGGG - Intronic
1134490435 16:14691993-14692015 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1134495816 16:14731110-14731132 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1134761582 16:16719372-16719394 GTTGTATTTTTAGTAGAGAGGGG + Intergenic
1134790037 16:16981540-16981562 GCTCTATTGTTACCACAAAGGGG + Intergenic
1134984475 16:18639798-18639820 GTTGTATTTTTAGTAGAGAGGGG - Intergenic
1135019132 16:18948937-18948959 TTTGTATTTTTAACAAAGTGTGG + Intergenic
1135048235 16:19171494-19171516 TTTGTATTTTTAGAAAAGAGGGG + Intronic
1135337544 16:21616072-21616094 TTTGTATTTTTTCCTAAAACTGG + Intronic
1135406929 16:22205434-22205456 TTTGTATTTTTACTAAAGACAGG + Intergenic
1135502573 16:23009859-23009881 GTTTTTTTTTTAACAAAAACAGG + Intergenic
1135722795 16:24831547-24831569 TTTGTATTTTTAGTAAAGAGAGG + Intergenic
1136379289 16:29884740-29884762 TTTGTATTTTTAGTAAAAATGGG - Intronic
1136386410 16:29929138-29929160 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1136542148 16:30933921-30933943 TTTGTATTTTTAGTAAAAACGGG + Intronic
1136582480 16:31161492-31161514 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1136594376 16:31237625-31237647 TTTGTATTTTTAGTAAAGAGAGG + Intergenic
1136848754 16:33597107-33597129 TTTGTATTTTTACCACAGATGGG - Intergenic
1136852261 16:33621502-33621524 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1137042766 16:35628417-35628439 ATTATATTTTTACCAGAAAGGGG - Intergenic
1137045199 16:35649985-35650007 TTTGTGTTTTTAGCTAAAAGAGG + Intergenic
1137656910 16:50167826-50167848 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1137823626 16:51468955-51468977 TTCGTATTTTTAGCAGAAAGGGG - Intergenic
1138212065 16:55171878-55171900 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1138486605 16:57349190-57349212 GTTGTATTTTTAGCAGATATGGG - Intergenic
1138564962 16:57826292-57826314 GTTGTACTTTTTTCAAAGAGTGG + Intronic
1139046389 16:63065047-63065069 TTTGTATTTTTAGCAGAAACAGG + Intergenic
1139111995 16:63903317-63903339 TTTGTATTTTTAATAAAAACTGG + Intergenic
1139613821 16:68077080-68077102 TTTGTATTTTTAGGAAAACGGGG - Intronic
1139628044 16:68207633-68207655 TTTGTATTTTTAGTAAAAACGGG + Intronic
1139718370 16:68832646-68832668 TTTGTATTTTTAGTAAAAACGGG - Intronic
1140183000 16:72738997-72739019 GTTGTATTTTTAGCAGAGATGGG + Intergenic
1140316271 16:73901174-73901196 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1140392628 16:74600558-74600580 TTTGTATTTTTAGTAAAACGGGG - Intronic
1140523004 16:75598246-75598268 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1140565225 16:76034539-76034561 TTTGTATATATACCAAGAAGTGG - Intergenic
1140656372 16:77144107-77144129 TTTGTATTTTTACCAGAGACGGG - Intergenic
1140832951 16:78768416-78768438 GTTGTATTTTTAGTAGAGAGCGG - Intronic
1140985109 16:80151320-80151342 ATTTTATTTTTCCCAGAAAGTGG + Intergenic
1141056372 16:80819044-80819066 GTTGTATTTTTAGTAGAGAGAGG + Intergenic
1141108491 16:81252935-81252957 TTTGTATTTTTACTAGAGAGGGG - Intronic
1141189760 16:81815888-81815910 TTTGTATTTTTAGTAAAAAACGG - Intronic
1141201158 16:81899014-81899036 TTTGTATTTTTACTAAAGATAGG - Intronic
1141301260 16:82817630-82817652 TTTGTATTTTTAGCAAAGACAGG - Intronic
1141365086 16:83435213-83435235 ATTGTATTTTTAGCAGAAACGGG + Intronic
1141642905 16:85351816-85351838 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1141872386 16:86796483-86796505 GTTGTATTTTTAGTAAAGACAGG + Intergenic
1142046076 16:87926049-87926071 TTTGTATTTTTAGCAGAAATGGG - Intronic
1203110461 16_KI270728v1_random:1445757-1445779 TTTGTATTTTTACCACAGATGGG - Intergenic
1142484903 17:240713-240735 GAAGTATTATAACCAAAAAGTGG - Intronic
1142517939 17:445189-445211 CTTGTATTTTGAACAAAATGGGG - Intronic
1142615582 17:1132548-1132570 GTTGTATTTTTAGTAAAGACGGG + Intronic
1142637603 17:1267886-1267908 TTTGTATTTTTACCAGAGACGGG - Intergenic
1142886514 17:2915869-2915891 TTTGTATTTTTACTAGAAACGGG + Intronic
1143072572 17:4309086-4309108 TTTGTATTTTTACTAAAGACAGG - Intronic
1143441811 17:6980559-6980581 TTTGTATTTTTAGCAAAGACAGG - Intronic
1143489374 17:7275982-7276004 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1143573399 17:7775512-7775534 TTTGTATTTTTAGCAGAAACGGG - Intronic
1143713527 17:8750535-8750557 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1143828147 17:9629759-9629781 TTTGTATTTTTAGTAAAAACGGG + Intronic
1143849477 17:9799218-9799240 TTTGTATTTTTAGTAAAAATGGG - Intronic
1143924942 17:10361463-10361485 TTTGTATTTTTACTAGAGAGAGG + Intronic
1144008670 17:11124686-11124708 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1144179995 17:12742741-12742763 TTTGTATTTTTACCAGAGACAGG + Intronic
1144341727 17:14315649-14315671 TTTGTATTTTTAGCAGAAACAGG - Intronic
1144527021 17:15999368-15999390 TTTGTCTTTTTACGAACAAGAGG + Exonic
1144544319 17:16178324-16178346 TTTGTATTTTTAGCAGAAATGGG - Intronic
1144549218 17:16224827-16224849 TTTGTATTTTTAGCAGAAATAGG + Intronic
1144934477 17:18887105-18887127 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1145031212 17:19506746-19506768 TTTGTATTTTTACTAGAAATGGG - Intronic
1145127843 17:20316538-20316560 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1145376569 17:22354633-22354655 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1145725611 17:27120252-27120274 GTTGCATTTTCACTAAAAAAAGG + Intergenic
1145860880 17:28208986-28209008 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1145962455 17:28895432-28895454 TTTGTATTTTTAACAGAAACGGG + Intronic
1146025223 17:29314595-29314617 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1146036354 17:29410422-29410444 TTTGTATTTTTAGCAGAAACGGG + Intronic
1146060472 17:29603020-29603042 TTTGTATTTTTAGTAAAAATGGG + Intronic
1146439972 17:32885325-32885347 TTTGTATTTTTAGCAAAGATGGG - Intergenic
1147234708 17:39048782-39048804 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1147289396 17:39429522-39429544 TTTGTATTTTTACCAGAGACAGG - Intronic
1147470627 17:40656836-40656858 GTTGTATTTTTGGAAAAAAACGG + Intronic
1147604761 17:41768225-41768247 TTTGTATTTTTAGTAAAAATGGG - Intronic
1147619755 17:41857987-41858009 GTTGTATTTTTAGTAGAAATAGG + Intronic
1147696544 17:42359106-42359128 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1147801995 17:43098538-43098560 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1147832516 17:43306784-43306806 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1147985701 17:44306727-44306749 TTTGTATTTTTACTAAAGACAGG - Intergenic
1147993221 17:44347778-44347800 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1148025742 17:44586423-44586445 TTTGTATTTTTACTAGAGAGGGG + Intergenic
1148060458 17:44832463-44832485 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1148181637 17:45609984-45610006 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1148267214 17:46235714-46235736 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1148272353 17:46271931-46271953 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1148321884 17:46761504-46761526 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1148423382 17:47568340-47568362 TTTGTATTTTTAGTAAAAATGGG + Intronic
1148838147 17:50477383-50477405 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1148933810 17:51148760-51148782 GCAGTATTGTTACCAGAAAGGGG + Intergenic
1149048678 17:52278529-52278551 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1149415842 17:56459280-56459302 TTTGTATTTTTACCAGAGACAGG + Intronic
1149520470 17:57314741-57314763 TTTGTATTTTTAGTAAAAACGGG + Intronic
1149915826 17:60608466-60608488 TTTGTATTTTTAGTAAAAACTGG - Intronic
1149923567 17:60680817-60680839 TTTGTATTTTTAGCAAAGACGGG + Intronic
1150050422 17:61957216-61957238 TTTGTATTTTTAGCAGAGAGGGG + Intronic
1150094925 17:62365397-62365419 GTTGTATTTTTAGTAAAAACAGG - Intergenic
1150303120 17:64062841-64062863 ATTTTATTTTTACCAAATAACGG - Intronic
1150447227 17:65235968-65235990 GTAGAATTGTTACCAGAAAGGGG - Intergenic
1150661366 17:67083026-67083048 TTTGTATTTTTAGCAAAGAAGGG + Intronic
1150683062 17:67298624-67298646 TTTGTATTTTTAGTAAAGAGAGG - Intergenic
1150891804 17:69160433-69160455 GTTGTATTTTTAGTAGAGAGGGG - Intronic
1150893212 17:69178799-69178821 GTTGCATTTTCACCAGAAACAGG - Intronic
1150910177 17:69379684-69379706 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1151010824 17:70493844-70493866 TTTGTATGTATACCCAAAAGTGG - Intergenic
1151066456 17:71156197-71156219 GTTGTTTTTTTTAAAAAAAGAGG + Intergenic
1151279098 17:73058549-73058571 GTTGTATTTTTAGTAGAGAGGGG - Intronic
1151578977 17:74967364-74967386 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1151607778 17:75150557-75150579 GTTGTATTTTTAGTAAAGACAGG + Intronic
1151721149 17:75856693-75856715 GTTGTATTTGTATAAAAAATAGG + Intergenic
1151866705 17:76808178-76808200 GTTGTATTTTTAGTAAAGATGGG - Intergenic
1152136818 17:78509136-78509158 TTTGTATTTTTAGCAAAGATGGG + Intronic
1152137874 17:78515878-78515900 GTTGTCTTTTTACCAGTCAGTGG - Intronic
1152384214 17:79960582-79960604 TTTGTATTTTTAGCAGAAACGGG - Intronic
1152399915 17:80059729-80059751 TTTGTATTTTTAGTAAAAACAGG + Intronic
1152651653 17:81496978-81497000 ATTGTATTTTTAGCAGAAATGGG - Intergenic
1152715341 17:81897302-81897324 GTTGTATTTTTAGCAGAGACAGG + Intronic
1152866086 17:82724119-82724141 TTTGTATTTTTACTAGAGAGAGG - Intronic
1203166964 17_GL000205v2_random:106351-106373 GTTGTATTTTTATAATAAAGTGG + Intergenic
1153648219 18:7214369-7214391 TTTGTATTTTTACTAAAGATGGG + Intergenic
1153712787 18:7817144-7817166 TTTGTATTTTTACTAGAAACAGG + Intronic
1153912816 18:9719096-9719118 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1153992417 18:10412288-10412310 TTTGTATTTTTATCAGAAACAGG + Intergenic
1154379553 18:13837175-13837197 GTTGTATTTTTAGTAAAGACGGG + Intergenic
1154380410 18:13844766-13844788 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1154927034 18:20946707-20946729 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1154968070 18:21379375-21379397 TTTGTATTTTTAGTAGAAAGCGG + Intronic
1154979581 18:21491534-21491556 TTTGTATTTTTAGTAAAAACGGG - Intronic
1155029823 18:21974309-21974331 TTTGTATTTTTACCAGAGATGGG - Intergenic
1155194290 18:23458651-23458673 GTTAGATTTTTTACAAAAAGCGG + Intronic
1155240968 18:23863271-23863293 TTTGTATTTTTAGTAAAAACAGG - Intronic
1155603342 18:27574791-27574813 TTTGTATTTTTACCAGAAATGGG + Intergenic
1155904730 18:31436305-31436327 TTTGTATGTTTATCAAAAAGGGG - Intergenic
1155950909 18:31912317-31912339 TTTGTATTTTTAGCAGAGAGAGG - Intronic
1155990296 18:32272792-32272814 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1156125848 18:33904307-33904329 GGCATATTTTGACCAAAAAGAGG + Intronic
1156355465 18:36336663-36336685 TTTGTATTTTTAGCAGAAACAGG - Intronic
1156721766 18:40078762-40078784 GTTGTATTTTTAGTAAAGACAGG - Intergenic
1156737830 18:40283154-40283176 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1157002063 18:43538744-43538766 ATTTTATTTTTACCAAATACAGG - Intergenic
1157104267 18:44758553-44758575 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1157673130 18:49547565-49547587 GTGATAGTTTTTCCAAAAAGTGG + Intergenic
1157878407 18:51295065-51295087 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1158047249 18:53171054-53171076 TTTGTATTTTTACTAGAGAGAGG + Intronic
1158151447 18:54377206-54377228 GTTGTATTTTTAATAAAGATGGG + Intronic
1158571867 18:58603202-58603224 GTTGGATTATTACGGAAAAGGGG - Intronic
1158700473 18:59741304-59741326 GTTGTATTTTTAGTAGAGAGGGG + Intergenic
1159246507 18:65812138-65812160 TTTGTATTTTTACTAGAAATGGG + Intronic
1159415843 18:68148131-68148153 CTTGTATTTTTACCAAAGCTTGG - Intergenic
1159665841 18:71158851-71158873 GTTATATTTTTACTAAAACTTGG - Intergenic
1160769580 19:824382-824404 TTTGTATTTTTAGTAGAAAGAGG + Intergenic
1160884757 19:1340600-1340622 TTTGTATTTTTACCAGAGACGGG - Intergenic
1161165460 19:2784891-2784913 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1161387322 19:4002486-4002508 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1161641946 19:5429552-5429574 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1161695004 19:5761907-5761929 GTTGTATTTTTAGTAGAAATGGG + Intronic
1161783715 19:6310397-6310419 TTTGTATTTTTAGCAGAAATGGG - Intronic
1161825552 19:6561800-6561822 TTTGTATTTTTACTAGAAATGGG + Intergenic
1161965204 19:7543984-7544006 TTTGTATTTTTACTAGAGAGGGG + Intronic
1162176698 19:8835221-8835243 TTTGTATTTTTAGCAGAGAGAGG + Intronic
1162418285 19:10551524-10551546 TTTGTATTTTTAGTAAAAATGGG - Intronic
1162563154 19:11429579-11429601 TTTGTATTTTTAGTAAAAACAGG + Intronic
1162761094 19:12888558-12888580 TTTGTATTTTTAGCAGAGAGAGG - Intergenic
1162840402 19:13352232-13352254 TTTGTATTTTTAGTAAAAATGGG - Intronic
1162852154 19:13439279-13439301 GTTGTATTTTTAATAAAGACGGG + Intronic
1163081540 19:14947187-14947209 GTTGTATTTTTAGTAAAGACGGG + Intergenic
1163107902 19:15137444-15137466 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1163316753 19:16545781-16545803 TTTGTATTTTTAGTAAAAACGGG + Intronic
1163337642 19:16683797-16683819 TTTGTATTTTTAGCAGAAATGGG - Intronic
1163340922 19:16706552-16706574 TTTGTATTTTTACTAGAGAGGGG - Intergenic
1163421658 19:17216805-17216827 TTTGTATTTTTACTAAAGACGGG - Intronic
1163449055 19:17364942-17364964 TTTGTATTTTTAGCAAAGACGGG + Intronic
1163449760 19:17369461-17369483 TTTGTATTTTTAGCAAAGATGGG - Intronic
1163494565 19:17638654-17638676 TTTGTATTTTTAGTAAAAACGGG - Intronic
1163542618 19:17920110-17920132 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1163594984 19:18215999-18216021 TTTGTATTTTTAGTAAAAACAGG + Intronic
1163656618 19:18549658-18549680 TTTGTATTTTTACTAGAGAGGGG - Intergenic
1163656708 19:18550294-18550316 TTTGTATTTTTACTAGAAACAGG - Intergenic
1163760481 19:19133641-19133663 TTTGTATTTTTACCAGAGACAGG + Intronic
1163931769 19:20400617-20400639 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1164042556 19:21506284-21506306 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1164066114 19:21718794-21718816 GTTGTATTTTTAGTAAAGATGGG + Intergenic
1164122400 19:22278299-22278321 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1164177773 19:22792157-22792179 TTTGTATTTTTAGCAGAAACAGG + Intergenic
1164293063 19:23884827-23884849 TTTGTATTTTTAACAGAAATGGG + Intergenic
1164492102 19:28724586-28724608 TTTGTATTTTTTCTAAAGAGAGG - Intergenic
1164565424 19:29322782-29322804 TTTGTATTTTTACAAGAAACAGG + Intergenic
1164654060 19:29907907-29907929 GTTGTATTTTTAGTAGAAACGGG + Intergenic
1164873195 19:31664130-31664152 GTTGTATTTTTAGTAGAGAGGGG - Intergenic
1164995073 19:32715222-32715244 GTTGTATTTTTAGCAGAGACAGG + Intergenic
1165007055 19:32815820-32815842 TTTGTATTTTTAGTAAAAACGGG - Intronic
1165338160 19:35188131-35188153 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1165990088 19:39805882-39805904 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1166145875 19:40834872-40834894 TTTGTATTTTTAGTAAAAAAGGG - Intronic
1166187774 19:41152876-41152898 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1166248472 19:41548182-41548204 GTTTTATTTTTACTAAAGAGGGG - Intergenic
1166289831 19:41855607-41855629 TTTGTATTTTTTGCAGAAAGGGG - Intergenic
1166514050 19:43432298-43432320 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1166766685 19:45255387-45255409 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1166801227 19:45458540-45458562 GTTGTATTTTTAGTAAAGATGGG + Intronic
1166868550 19:45856180-45856202 GTTGTATTTTTACTAGAGATGGG - Intronic
1166951947 19:46434768-46434790 TTTGTATTTTTACCAGAGATGGG - Intergenic
1166962643 19:46508047-46508069 TTTGTATTTTTACTAAGACGGGG - Intronic
1167021302 19:46878192-46878214 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1167392348 19:49203954-49203976 TTTGTATTTTTAGTAAAAAGGGG - Intronic
1167447713 19:49548169-49548191 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1167919538 19:52771647-52771669 TTTGTATTTTTACCAGAGATGGG + Intronic
1167995861 19:53401702-53401724 TTTGTATTTTTAGCAGAAACGGG - Intronic
1168001403 19:53449156-53449178 TTTGTATTTTTAGCAGAAACGGG - Intronic
1168147106 19:54425885-54425907 GTTGTATTTTTAGTAAAGACGGG + Intronic
1168433605 19:56301054-56301076 GTGGTTTTGTTACCAGAAAGGGG + Intronic
1168540767 19:57207895-57207917 TTTGTATTTTTAATAAAAATGGG + Intronic
1168558110 19:57360727-57360749 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1168558665 19:57364567-57364589 TTTGTATTTTTACTAAAGACGGG - Exonic
1168613323 19:57818352-57818374 TTTGTATTTTTACCAGAGACGGG + Intronic
925770684 2:7280076-7280098 TTTGTATTTTTAGCAAAGACAGG + Intergenic
925774708 2:7323525-7323547 GTTGTGTTTTAACAAAAAGGCGG + Intergenic
926095302 2:10077651-10077673 TTTGTATTTTTAGCAGAAACAGG - Intronic
926214512 2:10896056-10896078 TTTGTATTTTTAGCAGAAACGGG + Intergenic
926463348 2:13161189-13161211 TTTGTATTTTTACCAGAGATGGG - Intergenic
926764321 2:16310513-16310535 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
927109585 2:19854857-19854879 TTTGTATTTTTAGTAAAAACAGG + Intergenic
927382202 2:22491896-22491918 TATGTATTTTTAGAAAAAAGCGG - Intergenic
927724552 2:25411415-25411437 GTTATTTTTTTTCCAAAAAGAGG - Intronic
927755368 2:25704336-25704358 TTTGTATTTTTAGTAAAAACAGG + Intergenic
927794524 2:26036485-26036507 TTTGTATTTTTAGTAAAAACGGG - Intronic
927801839 2:26107622-26107644 GTTGTATTTTTAGTAGAAATGGG - Intronic
928045230 2:27924553-27924575 TTTGTATTTTTACTAAAGATGGG + Intronic
928499532 2:31875856-31875878 TTTGTATTTTTAGGAGAAAGGGG + Intronic
928551547 2:32376010-32376032 TTTGTATTTTTAGCAAAGATGGG - Intronic
928776748 2:34774289-34774311 GGTGTATATTTGCCAAAAAAGGG - Intergenic
928949461 2:36801634-36801656 TTTGTATTTTTAGTAGAAAGAGG - Intronic
929147239 2:38717569-38717591 TTTGTATTTTTAGCAGAAACAGG + Intronic
929678706 2:43966579-43966601 TTTGTATTTTTACCAGAGACGGG + Intronic
929790168 2:45016447-45016469 TTTGTATTTTTACCAGAGATGGG - Intergenic
931332758 2:61305150-61305172 GTTGTATTTTTAGTAGAAACAGG - Intronic
931387514 2:61810629-61810651 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
931521103 2:63098283-63098305 TTTGTATTTTTACTAGAAACGGG - Intergenic
932036177 2:68249299-68249321 GTTTTTTTTTTTCTAAAAAGTGG + Intronic
933459609 2:82564775-82564797 TTTGTATTTTTAGTAAAAATGGG + Intergenic
933677467 2:85069523-85069545 TTTGTATTTTTACTAAAGAAGGG + Intergenic
934137034 2:89005978-89006000 TTTGTATTTTTACTACAAACGGG - Intergenic
934175187 2:89572571-89572593 TTTGTATTTTTACTAGAGAGGGG - Intergenic
934234073 2:90214512-90214534 TTTGTATTTTTACTACAAACGGG + Intergenic
934245251 2:90300024-90300046 TTTCTATTTTGACCAGAAAGAGG - Intergenic
934263493 2:91497007-91497029 TTTCTATTTTGACCAGAAAGAGG + Intergenic
934285503 2:91646925-91646947 TTTGTATTTTTACTAGAGAGGGG - Intergenic
934497364 2:94818518-94818540 TTTGTATTTTTAGTAAAAATAGG - Intergenic
934942258 2:98511230-98511252 TTTGTATTTTTAGTAGAAAGGGG + Intronic
935058035 2:99584294-99584316 TTTGTATTTTTAGCAGAGAGGGG - Intronic
935122022 2:100191347-100191369 GTTGTATTTTTAGTAAAGACGGG + Intergenic
935665465 2:105508356-105508378 GTTGTGTTTAAACCAAAAAAGGG + Intergenic
935764565 2:106353030-106353052 TTTGTATTTTTAGTAAAAACAGG + Intergenic
935774090 2:106455431-106455453 TTTGTATTTTTAGCAGAAACGGG - Intronic
935905976 2:107840482-107840504 TTTGTATTTTTAGCAGAAACGGG + Intronic
936070498 2:109367451-109367473 GTTGTATTTTTAATAGAAACGGG + Intronic
936119430 2:109728625-109728647 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
936409861 2:112248152-112248174 GTTGTATTTTTAGCAGAGACAGG - Intronic
936466402 2:112755309-112755331 TTTGTATTTTTAGTAAAAACAGG + Intronic
937473561 2:122194331-122194353 CTTGTTTTTTCACAAAAAAGGGG + Intergenic
937586958 2:123564407-123564429 GTTTTATATTTACAGAAAAGGGG + Intergenic
937808436 2:126172590-126172612 GCTGTATTTTTAGCAGAGAGAGG + Intergenic
937998697 2:127714848-127714870 ATTGTATGTTAACCAAAAATAGG - Intronic
938207473 2:129436475-129436497 GTTGGATTTTCAACATAAAGGGG - Intergenic
938219724 2:129555203-129555225 GTTGGATATATACCTAAAAGTGG + Intergenic
938417830 2:131119081-131119103 TTTGTATTTTTAGCAAAGACGGG - Intronic
938893246 2:135726530-135726552 TTTGTATTTTTAGCAGAAACAGG + Intergenic
938952863 2:136272331-136272353 TTTGTATTTTTACTAGAAACGGG - Intergenic
939415196 2:141887165-141887187 TTTGTATTTTTAGTAGAAAGGGG + Intronic
940213411 2:151279653-151279675 TTTGTATTTTTAGCAAAGACAGG + Intronic
940222779 2:151370897-151370919 TTTGTATTTTTAGTAAAAACAGG - Intronic
940509743 2:154598379-154598401 TTTGTATTTTTACTAGAAATGGG + Intergenic
941152396 2:161931100-161931122 TTTGTATTTTCAGCAGAAAGGGG + Intronic
941226743 2:162859080-162859102 ATTATATTTTGACCAAGAAGAGG - Intergenic
941324861 2:164101867-164101889 TTTGTATTTTTAGCAAAGACGGG - Intergenic
941907938 2:170734997-170735019 TTTGTATTTTTAGTAAAGAGAGG - Intergenic
942020182 2:171859937-171859959 TTTGTATTTTTAGTAAAAACGGG + Intronic
942025402 2:171905686-171905708 TTTGTATTTTTAGCAGAGAGAGG + Intronic
942037443 2:172024311-172024333 CTTGGATTAATACCAAAAAGGGG + Intronic
942159186 2:173164129-173164151 GTTGTATTTTTAGCAGAAACAGG + Intronic
942569401 2:177298133-177298155 TTTGTATTTTTAGCAGAGAGAGG + Intronic
942913548 2:181275628-181275650 GTTGGTTTTTCACCAATAAGAGG + Intergenic
942936872 2:181568086-181568108 GTTGCATTTGCACCAAAGAGGGG - Intronic
942968569 2:181928081-181928103 TTTGTATTTTTTCCAAAAACAGG + Intronic
943001079 2:182329560-182329582 TTTGTATTTTTAGTAGAAAGGGG + Intronic
943761050 2:191609751-191609773 ATTATATTTATACCAAAAAGTGG - Intergenic
943900296 2:193425449-193425471 GTTGTATTTTTAGTAAAGACAGG - Intergenic
943943129 2:194024350-194024372 TTTGTATTTTTAGTAAAAACAGG + Intergenic
944146331 2:196511135-196511157 TTTGTATTTTTAGCAAAGAGAGG + Intronic
944235891 2:197441161-197441183 TTTGTATTTTTAGCAAAGACAGG - Intergenic
944253083 2:197597687-197597709 TTTGTATTTTTAGCAAAGACGGG + Intronic
944259409 2:197659644-197659666 TTTGTATGTTTAGCAAAAACAGG - Intronic
944525091 2:200611025-200611047 TTTGTATTTTTAGCAGAGAGAGG + Intronic
944546333 2:200802611-200802633 TTTGTATTTTTAGTAAAAACAGG + Intergenic
944580842 2:201131405-201131427 ATTGTATTTTTACTAGAAACAGG + Intronic
944714781 2:202367563-202367585 GTTGTATTTTTAGTAAAGACAGG + Intergenic
944742567 2:202626667-202626689 TTTGTATTTTTAGCAGAAACGGG + Intergenic
944797526 2:203203344-203203366 TTTGTATTTTTAGCAGAAATGGG + Intronic
945151342 2:206795403-206795425 TTTGTATTTTTAGCAGAAACAGG + Intergenic
945258586 2:207823471-207823493 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
946233730 2:218309243-218309265 TTTGTATTTTTAATAAAAACAGG - Intronic
946293476 2:218764275-218764297 TTTGTATTTTTACTAAAGACAGG + Intergenic
946442251 2:219706679-219706701 GTTTTATTTTTTAGAAAAAGAGG + Intergenic
946444502 2:219726810-219726832 GTTGTTTTTTTGGCAAAAGGAGG + Intergenic
946986524 2:225280036-225280058 GTTGTATTGATACCAGAAAGAGG - Intergenic
947061512 2:226171701-226171723 GTTGTATTTTTAGTAGAGAGGGG - Intergenic
947176867 2:227376175-227376197 TTAGTATTGTTACCAAAAATGGG - Intronic
947420044 2:229933855-229933877 GTTGTATTTTTAGTAAAGATGGG + Intronic
947429487 2:230013586-230013608 TTTGTATTTTTAGTAAAAACAGG + Intergenic
947539511 2:230965988-230966010 GTTGTATTTTTATCATGAATGGG - Intergenic
947620474 2:231587433-231587455 TTTGTATTTTTAGTAAAATGGGG + Intergenic
947699666 2:232222112-232222134 TTTGTATTTTTAGCAGAAACAGG + Intronic
947699942 2:232224665-232224687 TTTGTATTTTTAGTAGAAAGAGG - Intronic
947761322 2:232605742-232605764 TTTGTATTTTTAGCAGAAATGGG - Intergenic
947888239 2:233593441-233593463 GTTGTGTTTATACCACAAAAGGG + Intergenic
947959995 2:234228468-234228490 GTTGTATTTTTAGTAGAAACAGG - Intergenic
948451650 2:238078862-238078884 GTTGTATTTTTAGTAGAAACAGG + Intronic
1168831426 20:847164-847186 GTTTTATTTTAAGCATAAAGAGG + Intronic
1168846867 20:951318-951340 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1168858374 20:1026732-1026754 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1169119560 20:3086854-3086876 TTTGTATTTTTACTAAAGATGGG + Intergenic
1169243777 20:4008717-4008739 GTTGTATTTTTAGTAAGATGGGG + Intronic
1169249736 20:4051216-4051238 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1169323034 20:4650933-4650955 TTTGTATTTTTAGTAAAATGAGG + Intergenic
1169410381 20:5364297-5364319 GTTGTATTGTAACCTCAAAGGGG + Intergenic
1169481257 20:5983526-5983548 TTTGTATTTTTACTAAAGACGGG - Intronic
1170209539 20:13834996-13835018 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1170255761 20:14341464-14341486 TTTGTATTTTTACTAGAAACGGG - Intronic
1170422665 20:16208043-16208065 TTTGTATTTTTAGTAGAAAGAGG - Intergenic
1170638686 20:18132333-18132355 TTTGTATTTTTAGCAGATAGAGG - Intergenic
1170812102 20:19682079-19682101 GTTGTATTTTTAGTAAAGATGGG - Intronic
1171032507 20:21690408-21690430 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1171132946 20:22671839-22671861 TTTGTATTTTTAGCAAAGATGGG - Intergenic
1171190284 20:23154091-23154113 GTGGTATCTTTAACAATAAGAGG - Intergenic
1171338623 20:24409739-24409761 CTTTTCTTTTTACCAACAAGTGG + Intergenic
1171541153 20:25957973-25957995 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1171799916 20:29602367-29602389 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1171844169 20:30254318-30254340 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1171893233 20:30736060-30736082 GCTTTATTTTTATCAAAAAGGGG + Intergenic
1171985193 20:31655328-31655350 TTTGTATTTTTACCAGAGACGGG + Intergenic
1172136756 20:32691697-32691719 TTTGTATTTTTAGCAGAAACAGG + Intergenic
1172138181 20:32702235-32702257 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1172346406 20:34204388-34204410 TTTGTATTTTTAGTAAAAATGGG + Intronic
1172371747 20:34398568-34398590 TTTGTATTTTTAGTAAAAACGGG + Intronic
1172708806 20:36903721-36903743 TTTGTATTTTTACTAGAAATGGG + Intronic
1172788842 20:37488338-37488360 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1172928276 20:38561149-38561171 TTTGTATTTTTAGTAAAAACGGG - Intronic
1173206599 20:40999623-40999645 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1173344324 20:42184805-42184827 TTTGTATTTTTACCAGAGATGGG + Intronic
1173593398 20:44242560-44242582 TTTGTATTTTTACTAGAAACGGG + Intergenic
1173601357 20:44297672-44297694 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1173837231 20:46133974-46133996 GTTGTATTTTTAGCAGAGATGGG - Intergenic
1173886139 20:46460639-46460661 ATTTTTTTTTTACCAAAAATGGG - Intergenic
1174204016 20:48826681-48826703 TTTGTATTTTTATCAGAGAGGGG - Intronic
1174460256 20:50677541-50677563 TTTGTATTTTTAGTAAAAATGGG + Intronic
1174466748 20:50723704-50723726 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1174607507 20:51771659-51771681 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1174811348 20:53648416-53648438 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1174944531 20:54970660-54970682 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1175024268 20:55885021-55885043 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1175027043 20:55913564-55913586 GTTGTATTTTTAGTAAAGATGGG - Intergenic
1175085812 20:56457841-56457863 TTTGTATTTTTAGCAGAAATGGG - Intronic
1175188672 20:57197071-57197093 GTTGTATTTTTAGTAAAGACGGG + Intronic
1175359741 20:58399542-58399564 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1176404793 21:6352748-6352770 GTTGTATTTTTATAATAAAGTGG - Intergenic
1176409910 21:6443526-6443548 TTTGTATTTTTACCAGAGACGGG - Intergenic
1176432364 21:6636356-6636378 GTTGTATTTTTATAATAAAGTGG + Intergenic
1176620522 21:9055309-9055331 GCTTTATTTTTATCAAAAAGGGG - Intergenic
1176727153 21:10447587-10447609 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1177004553 21:15655376-15655398 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1177164102 21:17580444-17580466 TTTGTATTTTTACCAGAGACAGG - Intronic
1177437540 21:21075689-21075711 GTTTTATTTTTATCATAAATGGG + Intronic
1177570832 21:22884275-22884297 CTTGTATCTTTACAAAAATGGGG + Intergenic
1177702491 21:24656445-24656467 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1177801258 21:25831056-25831078 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1178569019 21:33717366-33717388 TTTGTATTTTTACTAGAAACAGG + Intronic
1179360173 21:40698696-40698718 TTTGTATTTTTAGTAAAAATGGG - Intronic
1179673657 21:42967115-42967137 TTTGTATTTTTACAAACATGGGG + Intergenic
1179685403 21:43051848-43051870 TTTGTATTTTTACCAGAGACGGG - Intergenic
1179837612 21:44047350-44047372 TTTGTATTTTTAGTAAAAATGGG + Intronic
1179877884 21:44280607-44280629 TTTGTATTTTTACTAAAGATGGG + Intergenic
1179975345 21:44862346-44862368 TTTGTATTTTTAACAAAGATGGG - Intronic
1180617157 22:17135875-17135897 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1180634244 22:17251740-17251762 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1180825869 22:18860876-18860898 TTTGTATTTTTAGCAAAGATAGG - Intronic
1181095078 22:20499376-20499398 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1181123578 22:20689072-20689094 TTTGTATTTTTACTAGAAAGGGG + Intergenic
1181183350 22:21082711-21082733 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1181186864 22:21113674-21113696 TTTGTATTTTTAGCAAAGATAGG + Intergenic
1181212338 22:21296819-21296841 TTTGTATTTTTAGCAAAGATAGG - Intergenic
1181611461 22:24015781-24015803 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1181675394 22:24448052-24448074 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1181693453 22:24580156-24580178 TTTGTATTTTTACTAGAAACGGG - Intronic
1181747449 22:24965565-24965587 TTTGTATTTTTAGCAAAGACAGG - Intronic
1181787380 22:25236939-25236961 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1181947673 22:26530835-26530857 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1182015398 22:27035154-27035176 GTTGTATTTTTAGCAGAGACGGG + Intergenic
1182565011 22:31191657-31191679 TTTGTATTTTTAGCAGAAACGGG - Intronic
1182758603 22:32702302-32702324 TTTGTATTTTTAGTAAAAACAGG - Intronic
1182843109 22:33408154-33408176 TTTGTATTTTTAACAAAGACGGG + Intronic
1183276915 22:36904276-36904298 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1183426775 22:37744179-37744201 TTTGTATTTTTACCAGAGACGGG + Intronic
1183453576 22:37909529-37909551 GTTGTATTTTTAGCAGAGACGGG + Intronic
1183767241 22:39889750-39889772 GTTGTATTTTTACCAAAAAGAGG - Intronic
1183846662 22:40546980-40547002 TTTGTATTTTTAGTAAAAACAGG - Intronic
1184367104 22:44058724-44058746 TTTGTATTTTTAGTAAAAATGGG + Intronic
1184422106 22:44388096-44388118 TTTGTATTTTTACCAGAGACAGG + Intergenic
1184533896 22:45073390-45073412 GATGTATTTTGACTAAAAAGTGG + Intergenic
1184592899 22:45497053-45497075 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1184848706 22:47105307-47105329 GGTGTATTCATACCAAAAACAGG - Intronic
1185187475 22:49410694-49410716 TTTGTATTTTTACTAAAGACAGG + Intergenic
1185386879 22:50537041-50537063 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1203276011 22_KI270734v1_random:86781-86803 TTTGTATTTTTAGCAAAGATAGG - Intergenic
949222232 3:1649610-1649632 TTTGTATTTTTAGTAAAAACGGG + Intergenic
949275591 3:2276343-2276365 TTTGTATTTTTAGCAGAGAGAGG + Intronic
949331875 3:2932202-2932224 TTTGTATTTTTAGTAAAGAGAGG - Intronic
949566434 3:5249375-5249397 GTTGTATTTTTAGTAGAAACGGG - Intergenic
951073657 3:18363436-18363458 GTTATAATTTTACCAATAAAAGG + Intronic
951207148 3:19936694-19936716 TTTGTATTTTTAGTAGAAAGAGG - Intronic
951250253 3:20386252-20386274 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
951345498 3:21543138-21543160 TTTGTATTTTTACTAGAGAGGGG - Intronic
951420197 3:22474888-22474910 TTTGTATTTTTAGCAGACAGGGG + Intergenic
951703180 3:25516796-25516818 TTTGTATTTTTAGCAGAAATAGG + Intronic
951796506 3:26544742-26544764 TTTGTATTTTTAGTAGAAAGAGG - Intergenic
951942496 3:28094988-28095010 GTTGTATTTTTATCATGAAGTGG + Intergenic
952095351 3:29944824-29944846 ATTCTATTTATACAAAAAAGTGG + Intronic
952402022 3:32971980-32972002 GTTTTATTTTTATCATAAACTGG - Intergenic
952418023 3:33107228-33107250 TTTGTATTTTTAGTAAAAACGGG - Intergenic
952795449 3:37234461-37234483 GTTGTAGTTTAAAAAAAAAGAGG - Intergenic
953467901 3:43140507-43140529 TTTGTATTTTTAGCAGAAACAGG - Intergenic
953498977 3:43414602-43414624 ACTGTATTTTAACCAAAAACAGG - Intronic
953521327 3:43645978-43646000 TTTGTATTTTTGGTAAAAAGGGG + Intronic
953541631 3:43824182-43824204 GCTGTAGTTTTAGCTAAAAGTGG - Intergenic
953950258 3:47184105-47184127 TTTGTATTTTTAGCAGAAATGGG + Intergenic
954085659 3:48241981-48242003 GTTGTATTTTTAGTAGAGAGGGG + Intronic
954140503 3:48602692-48602714 TTTGTATTTTTACCAGAGACGGG + Intronic
954225754 3:49179964-49179986 TTTGTATTTTTAGTAAAAACGGG - Intronic
954226413 3:49184490-49184512 TTTGTATTTTTACCAGAGATAGG + Intronic
954245549 3:49328686-49328708 TTTGTATTTTTACTAGAAATGGG - Intronic
954535018 3:51353438-51353460 TTTGTATTTTTAGCAAAGATGGG - Intronic
954669788 3:52284020-52284042 GTTGTATTTTTAGTAGAAACGGG + Intronic
955127862 3:56132212-56132234 GTTGTAGCTTTACCAAGAACTGG + Intronic
955215950 3:56985258-56985280 TTTGTATTTTTAGCAGAGAGAGG + Intronic
955281840 3:57601279-57601301 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
955366628 3:58315845-58315867 TTTGTATTTTTAGTAAAAATGGG + Intronic
955570383 3:60298652-60298674 GTTCTGTTTTTATCACAAAGTGG + Intronic
955602650 3:60663606-60663628 TTTGTATTTTTACAAGAGAGGGG + Intronic
955664238 3:61333211-61333233 TTTGTATTTTTAGCAGAAATGGG - Intergenic
955921679 3:63963584-63963606 GTGATAGTTTTACAAAAAAGTGG + Intronic
955999593 3:64714960-64714982 TTTGTATTTTTAGTAAAAACGGG - Intergenic
956020393 3:64927628-64927650 TTTTTTTTTTTAACAAAAAGGGG + Intergenic
956192908 3:66624045-66624067 TTTGTATTTTTACTAGAAACGGG + Intergenic
956650635 3:71501464-71501486 TTTGTATTTTTAGTAGAAAGAGG + Intronic
956935737 3:74099520-74099542 CTTATATATTTACCAAAAAGGGG - Intergenic
956941865 3:74171745-74171767 GTTTTATTTATGCCTAAAAGAGG + Intergenic
956962838 3:74422833-74422855 GTTGTATTATGAGTAAAAAGAGG - Intronic
957031172 3:75243339-75243361 GTTGTGGTTTTATCAAAGAGAGG - Intergenic
957483757 3:80831650-80831672 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
957507022 3:81135099-81135121 TTTGTATTTTTATTAAAAAATGG + Intergenic
957629344 3:82698511-82698533 ATTTTTTTTTTACCAAAAACAGG + Intergenic
957782904 3:84842572-84842594 GTTGTATTTTTTACAAATTGAGG + Intergenic
957812789 3:85248445-85248467 GTTGTATTTTTACTAAAGAAGGG + Intronic
957817832 3:85325536-85325558 TTTGTATTTTTAGCAGAAACGGG - Intronic
958530690 3:95326704-95326726 GTTGTATTTTTAGTAAAGACAGG + Intergenic
958874126 3:99596313-99596335 TTTGTATTTTTAGCAGAGAGAGG + Intergenic
959292721 3:104494884-104494906 GTTGTATTTTTACTAGAGATGGG + Intergenic
959687704 3:109165620-109165642 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
959872988 3:111350048-111350070 TTTGTATTTTTAGTAAAAAAGGG - Intronic
959910839 3:111761965-111761987 CTTGTATGTTCACCTAAAAGGGG + Intronic
960041024 3:113149981-113150003 GTAGTACTGTTACCAGAAAGGGG - Intergenic
960184393 3:114620461-114620483 GTTGTATTTTTAGTAGAGAGGGG + Intronic
960220818 3:115106404-115106426 TTTGTATTTTTAGCAGAAACGGG + Intronic
961024427 3:123541097-123541119 TTTGTATTTTTAGCAAAGATGGG - Intronic
961252186 3:125516667-125516689 TTTGTATTTTTAGTAAAGAGGGG - Intronic
961696876 3:128711476-128711498 TTTGTATTTTTTGTAAAAAGGGG + Intergenic
961776218 3:129287884-129287906 TTTGTATTTTTACTAAAGACGGG - Intronic
962181684 3:133212692-133212714 TTTGTATTTTTAGCAGAAACAGG - Intronic
962234489 3:133695417-133695439 TTTGTATTTTTAGCAGAGAGAGG + Intergenic
962560601 3:136602473-136602495 CTTGTATTTCTACCTAAAGGTGG + Intronic
962800288 3:138884591-138884613 TTTGTATTTTTACTAAAGATGGG + Intergenic
962911368 3:139854145-139854167 TTTGTATTTTTACTAGAAATAGG - Intergenic
963012180 3:140780861-140780883 TTTGTATTTTTAGTAAAAATGGG - Intergenic
963020788 3:140871277-140871299 GATGTATTCTTACCAGAGAGTGG + Intergenic
963134761 3:141891449-141891471 CATGAATTTTTACAAAAAAGAGG - Intronic
963178753 3:142330987-142331009 TTTGTATTTTTAGTAGAAAGGGG + Intronic
963292593 3:143507378-143507400 TTTGTATTTTTAGCAGAAACGGG + Intronic
963668056 3:148215527-148215549 GTTGTATTTTCACCAGATAAAGG + Intergenic
963792780 3:149601367-149601389 ATTGTATTTTTAGTAAAGAGGGG + Intronic
964347695 3:155770843-155770865 TTTGTATTTTTAGTAGAAAGGGG + Intronic
964501312 3:157351272-157351294 TTTGTATTTTTATTAAAAATGGG - Intronic
964703077 3:159590402-159590424 TTTGTATTTTTAGCAGAAATGGG - Intronic
965201494 3:165664145-165664167 TTTGTATTTTTACTAGAAATGGG + Intergenic
965481618 3:169225779-169225801 TTTGTATTTTTAGTAAATAGGGG + Intronic
965823520 3:172708526-172708548 TTTGTATTTTTAGTAGAAAGAGG + Intronic
965830371 3:172779732-172779754 GTTTTATTTTTTGCAAAAATGGG - Intronic
966524439 3:180905596-180905618 TTTGTATTTTTACTAAAGATGGG + Intronic
966762542 3:183430114-183430136 TTTGTATTTTTAGTAAAATGGGG - Intergenic
967081958 3:186058040-186058062 GGGGTATTATTACCAAACAGTGG + Intronic
967587853 3:191236321-191236343 GAGGTATTGTTACCAGAAAGGGG + Intronic
967601330 3:191392907-191392929 TTTGTATTTTTAGTAAAGAGCGG + Intronic
967783759 3:193468004-193468026 TTTGTATTTTTACAAAACTGGGG - Intronic
968017807 3:195355033-195355055 TTTGTATTTTTACCAGAGACGGG + Intronic
968072777 3:195797069-195797091 TTTGTATTTTTACCAGAGACGGG - Intronic
968386725 4:147140-147162 CTTGTATTTTTAGTAGAAAGAGG + Intronic
968586332 4:1418074-1418096 GATGTATTTTTAGCAGAAAAAGG - Intergenic
968799178 4:2731022-2731044 TTTGTATTTTTAGTAGAAAGAGG - Intronic
970524837 4:16920897-16920919 TTTGTATTTTTAGTAAAAACGGG + Intergenic
970731342 4:19107426-19107448 TTTGTATTTTTAGTAGAAAGAGG + Intergenic
971020334 4:22528995-22529017 TTTGTATTTTTAGTAAAAACGGG + Intergenic
971174765 4:24271548-24271570 GTTGTATTTTTAGTAGAAATGGG + Intergenic
971265780 4:25095337-25095359 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
971348247 4:25831694-25831716 TTTGTATTTTTACCAGAGACGGG + Intronic
971881633 4:32382297-32382319 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
971951721 4:33359084-33359106 TTTGTATTTTTACTAAAGACGGG + Intergenic
972164926 4:36272029-36272051 TTTGTAATTTTAGTAAAAAGGGG - Intergenic
972200873 4:36713543-36713565 TTTGTATTTTTAGCAAAGACGGG + Intergenic
972272966 4:37530251-37530273 GTTGTTGTTTTTCCAAGAAGAGG + Intronic
972283491 4:37625640-37625662 GTTGTAATTTTTCCTGAAAGAGG - Intronic
972283660 4:37627825-37627847 GTTGTATTTTTTCCTGAAAGAGG - Intronic
972516891 4:39817454-39817476 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
972546910 4:40088669-40088691 TTTGTATTTTTACTAGAAACGGG + Intronic
972559178 4:40211443-40211465 GTTGTATTTTTAGCAGAGACGGG + Intronic
972597347 4:40541564-40541586 GTTGTATTTTTAGTAAAGATGGG - Intronic
973576815 4:52298039-52298061 GTTGTATTTTTACTAGAGACGGG + Intergenic
973642232 4:52914797-52914819 TTTTTATTTTTACAAAAAAAGGG + Intronic
973890265 4:55361308-55361330 TTTGTATTTTTAGTAAAAACGGG - Intronic
973996384 4:56463520-56463542 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
974088616 4:57287324-57287346 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
974402186 4:61421913-61421935 GATGTTTTTAGACCAAAAAGCGG - Intronic
974407654 4:61496490-61496512 TTTGTATTTTTAGCAGAGAGGGG - Intronic
975088185 4:70368119-70368141 GTTGTATTTTTAGCAGAGATGGG + Intergenic
975155432 4:71067031-71067053 GTTGTATTTTTGACCGAAAGAGG + Intergenic
975344648 4:73280370-73280392 GTTGTATTTTTAGTAAAGACAGG + Intergenic
975607538 4:76170555-76170577 GTTTTGTTTTTACCAAAGACAGG + Intronic
975725574 4:77288320-77288342 GCCATATTTTTACCAAAAAAAGG - Intronic
976185776 4:82441447-82441469 TTTGTATTTTTAGCAGAAACGGG - Intronic
976306186 4:83561795-83561817 TTTTTTTTTTTACCAAAAAAGGG - Intronic
976343592 4:83973436-83973458 TTTGTATTTTTAGCAGAAACGGG - Intergenic
976349427 4:84043885-84043907 GTTGCATATTTACAAAACAGAGG - Intergenic
976727629 4:88230162-88230184 GTTGTATTTTTAGTAAAGACAGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976911700 4:90315016-90315038 TTTGTATTTTTAGCAGAGAGGGG + Intronic
977061538 4:92263837-92263859 GAGGTATTTTTTACAAAAAGAGG - Intergenic
977096260 4:92748833-92748855 TTTGTATTTTTACTAAAGAAGGG + Intronic
977172543 4:93781078-93781100 GATATAATTTTCCCAAAAAGTGG + Intergenic
977239356 4:94547971-94547993 GTTTACTTTTTACCAAAAAAAGG + Intronic
977590158 4:98817284-98817306 TTTGTATTTTTAGCAGAGAGAGG - Intergenic
977697890 4:99987238-99987260 GTTGTATTTTTAAAAATATGTGG + Intergenic
977846867 4:101777222-101777244 AATGTATTTTTAACAAAATGTGG + Intronic
977851897 4:101840483-101840505 GTTGTGTGTTTACCAGAATGAGG + Intronic
978076883 4:104542022-104542044 GTTTTCTTTTTAGCAGAAAGGGG + Intergenic
978808775 4:112828403-112828425 TTTGTATTTTTAGTAAAGAGGGG + Intronic
978965805 4:114739816-114739838 GTAGGATTTTAACCTAAAAGTGG + Intergenic
979094947 4:116536021-116536043 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
979632138 4:122915296-122915318 GTTGTATTTTTTGCAAAGATAGG - Intronic
979689062 4:123541436-123541458 TTTGTATTTTTAGTAAAAATGGG - Intergenic
979862514 4:125711522-125711544 GTTGTCTTTTTAATGAAAAGTGG - Intergenic
979892989 4:126123018-126123040 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
980052450 4:128052011-128052033 TTTGTATTTTTAGCAAAGATGGG + Intergenic
980061372 4:128133866-128133888 TTTGTATTTTTAGTAGAAAGGGG + Intronic
980101705 4:128547776-128547798 TTTGTATTTTTACTAAAGACGGG - Intergenic
980348110 4:131651236-131651258 TTTGTATTTTTACCAGAGACCGG + Intergenic
980728417 4:136796265-136796287 TTTGTATTTTTACTAAAGACGGG - Intergenic
980826266 4:138077167-138077189 TTTGTATTTTTAGCAGAGAGAGG - Intergenic
980933500 4:139203929-139203951 TTTGTATTTTTAGCAGAAACGGG + Intergenic
980967031 4:139531918-139531940 TTTGTATTTTTAGTAAAATGGGG - Intronic
981261065 4:142719493-142719515 TTTGTATTTTTAGTAAAAATGGG + Intronic
981477178 4:145198729-145198751 TTTGTATTTTTACTAGAAACGGG + Intergenic
981620626 4:146693824-146693846 TTTGTATTTTTAGCAAAGATGGG + Intergenic
982003120 4:151039212-151039234 GTGATATTGTTACCAGAAAGGGG - Intergenic
982059123 4:151585349-151585371 TTTGTATTTTTAGTAAAAACGGG + Intronic
982268015 4:153557940-153557962 TTTGTATTTTTAGCAGAAACAGG + Intronic
982522707 4:156439455-156439477 TTTGTATTTTTAGTAAAAACGGG + Intergenic
982525890 4:156477474-156477496 TTTAGATTTTTACCAAAAAATGG + Intergenic
982547091 4:156747624-156747646 TTTGTATTTTTAATAAAGAGGGG - Intergenic
982690083 4:158538640-158538662 TTTGTATTTTTAGCAGAAATGGG - Intronic
982869510 4:160559854-160559876 TTTGTATTTTTACTAAAGACGGG + Intergenic
982887184 4:160796426-160796448 GTTGTATATTTTTTAAAAAGTGG - Intergenic
983376418 4:166934314-166934336 TTTGTATTTTTAGTAAAGAGGGG - Intronic
983498152 4:168467993-168468015 TTTGTATTTTTAGCAAAGATGGG - Intronic
983512326 4:168621965-168621987 TTTGTATTTGCGCCAAAAAGTGG + Intronic
983746749 4:171210226-171210248 TTTTTATTTCTACCAGAAAGAGG + Intergenic
983853999 4:172618893-172618915 GTTGTATTTTTAATAAAGACGGG + Intronic
984301746 4:177928556-177928578 TTTGTATTTTTACCAGAGACGGG - Intronic
984342633 4:178477591-178477613 GTTCTATTTTTCCCTAAAAGTGG - Intergenic
984427700 4:179608889-179608911 TTTGTATTTTTACAAAACACAGG - Intergenic
984448223 4:179865743-179865765 TTTGTATTTTTACCAGAGACGGG - Intergenic
984464540 4:180081245-180081267 GTTGGATTTTAACCAGAGAGAGG - Intergenic
984678010 4:182572071-182572093 TTTGTATTTTTAGTAAAAACGGG + Intronic
984718984 4:182952776-182952798 TTTGTATTTTTACTAGAAACGGG - Intergenic
984721895 4:182980251-182980273 CTTGTATTTTTAGTAAAAACAGG - Intergenic
985180660 4:187258093-187258115 TTTGTATTTTTAGCAGAAACGGG + Intergenic
985732970 5:1560890-1560912 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
986691260 5:10315813-10315835 TTTGTATTTTTAGTAAAAACGGG + Intergenic
986842744 5:11717037-11717059 GTTGTATTTTTAGTAAAGACGGG + Intronic
986979814 5:13434438-13434460 TTTGTAGTTTTAGCACAAAGAGG + Intergenic
987108223 5:14661811-14661833 GTTGTATTTTTAGTAGAAACGGG + Intergenic
987148249 5:15013302-15013324 TTTGTATTTTTAGCAGAAATGGG - Intergenic
987149058 5:15020518-15020540 GTTGTATTTTTAGCAGAAACGGG - Intergenic
987183762 5:15393228-15393250 GTTGTATTTTATCCAATAAATGG + Intergenic
987228430 5:15867930-15867952 TTTGTATTTTTACCAGAGACGGG - Intronic
987361733 5:17113235-17113257 TTTGTATTTTTAGTAAAAACGGG - Intronic
987384333 5:17314537-17314559 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
987614257 5:20252177-20252199 TTTGTATTTTTAGTAGAAAGGGG - Intronic
987963369 5:24839306-24839328 GTTTCATTTTTAGGAAAAAGTGG + Intergenic
988047371 5:25973608-25973630 TTTGTATTTTTAGCAAAGAAGGG - Intergenic
988171901 5:27669006-27669028 TTTGTATTTTTAGCAGAAATGGG - Intergenic
988324799 5:29749630-29749652 TTTGAATTTCTTCCAAAAAGAGG - Intergenic
988356538 5:30183594-30183616 TTTGTATTTTTAGTAAAAACGGG + Intergenic
988506620 5:31829486-31829508 TTTGTATTTTTAGTAAAAACAGG + Intronic
988658953 5:33243073-33243095 GTTTTCTTTTTAGCATAAAGAGG + Intergenic
988709793 5:33762019-33762041 GTTGTATTTTTAGTAGAAATGGG - Intronic
988825820 5:34933442-34933464 TTTGTATTTTTAGCAGAAACGGG + Intronic
988905329 5:35782146-35782168 GTTGTATTTCTTCCAAGAAATGG + Intronic
988995448 5:36710636-36710658 GTTGTATTTTTTCTAGGAAGGGG + Intergenic
989152415 5:38312914-38312936 TTTGTATTTTTACTACAGAGGGG - Intronic
989389460 5:40885423-40885445 TTTGTATTTTTAGTAAAAATGGG - Intergenic
989416832 5:41188253-41188275 TGTGAATTTTTACCAAAAAAAGG - Intronic
989619794 5:43372970-43372992 TTTGTATTTTTAGCAAAGATGGG + Intergenic
989700227 5:44255238-44255260 TTTGTATTTTTAGTAAAAACGGG - Intergenic
989737454 5:44725870-44725892 TGTGTATTTTTAGTAAAAAGGGG - Intergenic
989794398 5:45448940-45448962 TTTGTATTTTTAGTAAAAACAGG - Intronic
990095267 5:52103704-52103726 TTTGTATTTTTACCAGACATGGG + Intergenic
990190977 5:53259979-53260001 GTTGCATTTACACCTAAAAGTGG + Intergenic
990389115 5:55300499-55300521 TTTGTATTTTTACTAGAAATGGG - Intronic
990651508 5:57905512-57905534 GTTGACTATTAACCAAAAAGGGG + Intergenic
990691594 5:58370248-58370270 GTATTATTATTACCAGAAAGTGG - Intergenic
990812126 5:59739246-59739268 TTTGTATTTTTAGTAAAAATGGG - Intronic
990929336 5:61070370-61070392 GTAGTATTTATTCCAAAAAAAGG + Intronic
991096439 5:62744806-62744828 TTTGTATTTTTAGCAAAGACAGG - Intergenic
991154610 5:63416871-63416893 GTTGTTTTTTTAAAAAAAATGGG + Intergenic
991282224 5:64927981-64928003 TTTGTATTTTTAGTAAAAATGGG - Intronic
991318243 5:65337090-65337112 GTTGTATTTATACTATAAATTGG + Intronic
991344110 5:65644707-65644729 TTTGTATTTTTAGCAGAAACAGG - Intronic
991986100 5:72288382-72288404 TTTGTATTTTTAGCAAAGACGGG + Intronic
992057057 5:73000602-73000624 TTTGTATTTTTAGCAGAAATGGG - Intronic
992101218 5:73409706-73409728 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
992653075 5:78880656-78880678 GTTTTATTTTTACCATGAAGTGG + Intronic
992731269 5:79671929-79671951 TTTGTATTTTTAGTAGAAAGGGG - Intronic
992794363 5:80242444-80242466 TTTGTATTTTTAGTAAAAATGGG - Intronic
993114935 5:83709048-83709070 TTTGTATTTTTAGCAAAGACGGG + Intronic
993359515 5:86956490-86956512 GTTGTATTTTTAGTAAAGATGGG - Intergenic
993488913 5:88522480-88522502 TTTGTATTTTTACTAAAGACGGG + Intergenic
993667447 5:90717820-90717842 TTTGTATTTTTAGTAAAAATGGG + Intronic
994128198 5:96193667-96193689 GTTGTATTTTTAAGTAACAGTGG + Intergenic
994540616 5:101091272-101091294 TTTGTATTTTTACTAAAGACAGG - Intergenic
994626277 5:102224012-102224034 TTTCTATTTTTACCAGAAGGTGG - Intergenic
994788849 5:104198817-104198839 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
994968705 5:106707969-106707991 TTTGTATTTTTAGTAAAAACGGG + Intergenic
995033789 5:107510554-107510576 ATTGTAGTATTACCAGAAAGGGG - Intronic
995037947 5:107556572-107556594 TTTGTATTTTTACTAGAAACGGG - Intronic
995172719 5:109136082-109136104 TTTGTATTTTTAGTAAAAACAGG - Intronic
995206749 5:109488440-109488462 TTTGTATTTTTACCAGAGACAGG + Intergenic
995331690 5:110954148-110954170 TTTGTATTTTTAGTAAAAATGGG - Intergenic
995424296 5:112003109-112003131 GTAGAATTTCTACCAAAAGGAGG - Intergenic
995508705 5:112886326-112886348 GTTGTACTTTTTCTAAAGAGTGG + Intronic
995592724 5:113716219-113716241 GTTGTGGCTTTACCAAAATGAGG + Intergenic
995657474 5:114443117-114443139 TTTGTATTTTTAGCAAAGACAGG - Intronic
995700180 5:114927169-114927191 TTTGTATTTTTAGTAAAAATGGG - Intergenic
995726608 5:115187565-115187587 GTTCTAGCTCTACCAAAAAGAGG + Intergenic
995780127 5:115766205-115766227 GTTATAATGTTACCAAGAAGAGG + Intergenic
996169272 5:120268540-120268562 CTTGTATTTTTAGTAAAAACAGG + Intergenic
996695566 5:126391167-126391189 TTTGTATTTTTACTAGAAATGGG - Intronic
996698488 5:126424315-126424337 GTTGTTTTTTTCCTACAAAGTGG + Intronic
997099257 5:130950236-130950258 GTTGTATTTTTAGTAAAGACAGG - Intergenic
997115829 5:131124703-131124725 TTTGTATTTTTACTAGAAACGGG + Intergenic
997307807 5:132852370-132852392 TTTGTATTTTTAGTAGAAAGCGG - Intergenic
997488995 5:134256900-134256922 TTTTTATTCTTACAAAAAAGAGG + Intergenic
997575405 5:134972007-134972029 GTTGTGTTTTTAGAAAAAAAAGG + Intronic
997778829 5:136636758-136636780 TTTGTATTTTTAATAAAGAGGGG + Intergenic
998008099 5:138670924-138670946 TTTGTATTTTTAGCAGAGAGGGG - Intronic
998008644 5:138675252-138675274 GTTGTATTTTTAGCAGAGACGGG + Intronic
998090928 5:139368160-139368182 GTTGTATTTTTAGTAAAGACGGG - Intronic
998559864 5:143161181-143161203 GTTGTATTTTTAGCAGAGACGGG + Intronic
998677153 5:144422432-144422454 GTTGTATTTTTCACACAAATAGG - Intronic
998711836 5:144834815-144834837 TTTGTATTTTTACTAGAAACGGG - Intergenic
999059423 5:148617638-148617660 TTTGTATTTTTAGTAAAGAGAGG + Intronic
999100961 5:149025793-149025815 GATTTATTTTTACAAAAATGAGG + Intronic
999545533 5:152624557-152624579 GTTGTATTTTTACTAGAGACTGG - Intergenic
999627881 5:153539333-153539355 CTTTTATTTTAAACAAAAAGAGG - Intronic
999733614 5:154495225-154495247 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
999754854 5:154656783-154656805 TTTGTATTTTTACTAGAGAGGGG + Intergenic
999934549 5:156472587-156472609 TTTGTATTTTTAGCAGAAATGGG + Intronic
1000007929 5:157204524-157204546 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1000313941 5:160071014-160071036 TTTGTATTTTTACTAAAGATAGG - Intronic
1000633688 5:163619410-163619432 ATTGTATTTTTAATATAAAGGGG - Intergenic
1000795003 5:165654243-165654265 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1001162246 5:169330690-169330712 GTTTTATCTTTGCCATAAAGGGG + Intergenic
1001338722 5:170824328-170824350 TTTGTATTTTTACTAGAAACAGG + Intergenic
1001729098 5:173935746-173935768 GTTATAATTTTTCCAATAAGAGG - Intronic
1001927070 5:175645539-175645561 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1002141304 5:177141500-177141522 TTTGTATTTTTAGCAGAGAGAGG + Intronic
1002307986 5:178294968-178294990 GTTGTATTTTTAATAAAGACAGG - Intronic
1002378856 5:178810130-178810152 TTTGTATTTTTAGTAAAGAGCGG - Intergenic
1002494221 5:179600866-179600888 TTTGTATTTTTAACTAAAGGAGG + Intronic
1003008604 6:2405157-2405179 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1003507952 6:6755236-6755258 TTTGTATTTTTAGTAAAAACTGG + Intergenic
1003795432 6:9597376-9597398 GTTGTATTTTTAGTAGAAACGGG + Intronic
1003875271 6:10430625-10430647 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1003911266 6:10746180-10746202 GTTTTGTTTTTCCCACAAAGAGG - Intergenic
1004037636 6:11939157-11939179 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1004076388 6:12347633-12347655 GTTGTATTTTTAGTAAAGACAGG - Intergenic
1004360959 6:14970789-14970811 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1004815623 6:19309042-19309064 TTTGTATTTTTAGTAAATAGGGG + Intergenic
1005262963 6:24081649-24081671 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1005632854 6:27724992-27725014 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1005650497 6:27880604-27880626 TTTGTAGTTTTACCAAAGACGGG + Intergenic
1005758398 6:28946050-28946072 TTTGTATTTTTACCAGAGACGGG + Intergenic
1005933610 6:30501973-30501995 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1006213203 6:32414904-32414926 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1006213440 6:32416828-32416850 GTTGTATTTTAACATAAAATTGG + Intergenic
1006351929 6:33527245-33527267 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1006495790 6:34422484-34422506 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1006632443 6:35439133-35439155 GTTGTATTTTTAGTAAAGACAGG + Intergenic
1006657876 6:35612217-35612239 TTTGTATTTTTAGCAAAGACGGG - Intronic
1006777221 6:36604532-36604554 GTTGTAGTTTTACCAAGCACAGG + Exonic
1008106918 6:47449089-47449111 TTTGTATTTTTAGCAAAGATAGG - Intergenic
1008164743 6:48122421-48122443 GTTGTATTTTTAGCAGAGATGGG - Intergenic
1008228491 6:48953419-48953441 ATTGAATTTTTTCAAAAAAGAGG + Intergenic
1008268508 6:49462104-49462126 GTTGTGTTTTTATCTAAAAATGG - Intronic
1008358681 6:50588321-50588343 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1008370482 6:50724836-50724858 GTTGTTTTTTTAAAAAAAAGTGG + Intronic
1008377847 6:50811412-50811434 TTTGTATTTTTAGCAGAAACAGG + Intergenic
1008827010 6:55708316-55708338 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1008877899 6:56349451-56349473 GTTGCATTCTTGCCAGAAAGTGG + Intronic
1009180004 6:60505986-60506008 CTTGTATTGTTTTCAAAAAGGGG - Intergenic
1009271103 6:61615059-61615081 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1009360046 6:62800295-62800317 TTTGTATTTTTAGCAAAGACAGG + Intergenic
1009582947 6:65559209-65559231 TTTGTATTTTTAGCAGAAATGGG - Intronic
1010376576 6:75177263-75177285 TTTGTATTTTTAGTAGAAAGAGG - Intronic
1010523387 6:76869519-76869541 GTTGTATTTTTAGTAAAGACAGG - Intergenic
1010551234 6:77224443-77224465 CTTGTATTTTTACTGTAAAGGGG + Intergenic
1011463554 6:87631662-87631684 TTTGTATTTTTACTAGAGAGGGG + Intronic
1011524826 6:88253247-88253269 GTTGTATTTTTAGTAGAGAGGGG + Intergenic
1011936190 6:92781100-92781122 GTTGTATTTGTACTAAAATATGG - Intergenic
1012158404 6:95850454-95850476 GTTGTATATTGATCTAAAAGAGG + Intergenic
1012302241 6:97603769-97603791 TTTGTATTTTTACCAGAGATGGG + Intergenic
1012729271 6:102860215-102860237 TTTTTTTTTTTACCAAAAAAAGG - Intergenic
1013113951 6:107086441-107086463 GTTGTATTTTTAGTAGAGAGAGG - Intronic
1013230038 6:108154273-108154295 TTTGTATTTTTAGCAGAAACAGG - Intronic
1013251284 6:108336142-108336164 GATCTACTTTTATCAAAAAGTGG + Intronic
1013348657 6:109286690-109286712 TTTGTATTTGAACCCAAAAGGGG + Intergenic
1013429172 6:110040648-110040670 TTTGTATTTTTAGCAAATACGGG + Intergenic
1013557913 6:111275579-111275601 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1013888053 6:114994946-114994968 CTTATATTTCTACCAGAAAGGGG - Intergenic
1014201037 6:118608780-118608802 GGGGTATTTTTGCCAAATAGTGG + Intronic
1014302187 6:119695440-119695462 TTTGCAGTTTTATCAAAAAGAGG + Intergenic
1014941150 6:127440495-127440517 TTTGTATTTTTAGCAGAGAGGGG + Exonic
1015010569 6:128342079-128342101 TTTGTATTTTTAGTAAAAACGGG - Intronic
1015537611 6:134282478-134282500 TTTGTATTTTTAGCAGAGAGGGG - Intronic
1015975792 6:138789651-138789673 TTTGTATTTTTAGTAAAGAGAGG - Intronic
1016057715 6:139595917-139595939 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1016127318 6:140420683-140420705 GTTGTATTTGTAAAAAAAATTGG - Intergenic
1016192866 6:141292579-141292601 GGTTTATTTTTACCAAAATTTGG + Intergenic
1016482681 6:144498824-144498846 TTTGTATTTTTTACAAAATGAGG + Intronic
1016770380 6:147843029-147843051 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1016804375 6:148198019-148198041 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1016998113 6:149975316-149975338 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1017010389 6:150059408-150059430 TTTGTATTTTTAGCAAAAACAGG + Intergenic
1017209305 6:151837269-151837291 TTTGTATTTTTACCAGAGATGGG + Intronic
1017455752 6:154599789-154599811 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1017616227 6:156249699-156249721 TTTGTATTTTTACTACAGAGGGG + Intergenic
1017651624 6:156588672-156588694 TTTGTTTTTCTACCAAAAATGGG - Intergenic
1018018668 6:159736089-159736111 GTTTTAGATTTACAAAAAAGTGG - Intronic
1018072990 6:160182443-160182465 TTTGTATTTTTACCAGAGACCGG + Intronic
1019697826 7:2457360-2457382 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1019716243 7:2540782-2540804 GATGTATCTTCACCAACAAGAGG + Intronic
1019720137 7:2564425-2564447 GTTGTATTTTTAGTAGAAATGGG - Intronic
1019806612 7:3130997-3131019 GCAGTACTGTTACCAAAAAGGGG + Intergenic
1020024203 7:4887154-4887176 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1020043311 7:5020674-5020696 TTTGTATTTTTACTAAAGACAGG + Intronic
1020150965 7:5681321-5681343 TTTGTATTTTTTCCTAAAACAGG - Intronic
1020504041 7:8960787-8960809 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1020847222 7:13301306-13301328 TTTGTATTTTTAGCAGAAACAGG + Intergenic
1020996874 7:15277134-15277156 GTTGTATTTTTACTAGAGATAGG - Intronic
1021106187 7:16642693-16642715 TTTATATTTGTGCCAAAAAGAGG - Intronic
1021402624 7:20226783-20226805 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1021456318 7:20832823-20832845 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1021511883 7:21442208-21442230 TTTGTATTTTTAGCAGAGAGGGG + Intronic
1021649646 7:22821236-22821258 TTTGTATTTTTACTAGAAACGGG - Intronic
1021666483 7:22986672-22986694 TTTGTATTTTTACTAAAGACGGG - Intronic
1021708905 7:23395752-23395774 GTTGTATTTTTAGTAAAGACAGG - Intronic
1021835810 7:24673092-24673114 GTTGGCTTTTTACCAAGAAAGGG + Intronic
1021883118 7:25112879-25112901 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1022200294 7:28110252-28110274 TTTGTATTTTTATCAGAAATGGG - Intronic
1022668416 7:32432263-32432285 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1023070357 7:36425465-36425487 TTTGTATTTTTAGCAGAGAGGGG + Intronic
1023523235 7:41070281-41070303 TTTGTATTTTTAGCAGAAATGGG + Intergenic
1023640701 7:42254046-42254068 TTTGTATTTTTAGCAAAGATAGG - Intergenic
1023947732 7:44817022-44817044 TTTGTATTTTTAGCAAAGACAGG + Intronic
1023959996 7:44918528-44918550 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1024276260 7:47679431-47679453 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1024302704 7:47899781-47899803 TTTGTATTTTTAGTAAAAACAGG - Intronic
1024335847 7:48204380-48204402 TTTGTATTTTTAGTAAAGAGGGG + Intronic
1024402759 7:48944119-48944141 ATTGTATTTTTAGCAGAAATGGG + Intergenic
1024410332 7:49033441-49033463 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1024630083 7:51239689-51239711 GTAGTATTCTTACCAGAAAGGGG - Intronic
1024636095 7:51291587-51291609 TTTGTATTTTTAGCAGAGAGAGG - Intronic
1024710678 7:52011477-52011499 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1024822294 7:53346783-53346805 ATTGTCTTTTTACCAAATGGTGG - Intergenic
1024830870 7:53454436-53454458 TTTGTATTTTTAGCAAAGATAGG - Intergenic
1025108738 7:56194783-56194805 GTTGTATTTTTAGTAAAGACGGG - Intergenic
1025283471 7:57644909-57644931 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1025292594 7:57744209-57744231 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1025619897 7:63159009-63159031 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1025640623 7:63364334-63364356 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1025642076 7:63383752-63383774 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1025802338 7:64798110-64798132 TTTGTATTTTTACTAGAAATGGG + Intronic
1025804552 7:64818155-64818177 GTTGTATTTTTAGTAAAGATAGG + Intronic
1025825694 7:65008617-65008639 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1025898694 7:65726402-65726424 TTTGTATTTTTAGCAGAAATAGG - Intergenic
1026095257 7:67341710-67341732 ATTGTATTTTTACTAAAGAGGGG - Intergenic
1026179612 7:68027380-68027402 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1026259410 7:68741310-68741332 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1026264044 7:68780946-68780968 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1026357451 7:69571244-69571266 GTTGTATTTTTAGTAGAACGGGG - Intergenic
1026423384 7:70264377-70264399 GTTGTATTTTTAGTAGAGAGAGG + Intronic
1026511351 7:71029847-71029869 TTTGTATTTTTACTAGAAACAGG + Intergenic
1026562303 7:71460525-71460547 GTAGTAGTGTTACCAGAAAGGGG + Intronic
1026611109 7:71860612-71860634 GTGTTGTTGTTACCAAAAAGGGG - Intronic
1026855884 7:73754453-73754475 GTTGTATTTTTAGCAGAGACGGG - Intergenic
1026920747 7:74153618-74153640 TTTGTATTTTTAGCAGAGAGAGG - Intergenic
1026923024 7:74170290-74170312 TTTGTATTTTTACCAGAGATGGG + Intergenic
1027150543 7:75730508-75730530 TTTGTATTTTTACCAGAGACAGG + Intronic
1027196032 7:76030987-76031009 TTTGTATTTTTAGCAGAAACAGG - Intronic
1027480097 7:78684932-78684954 ATTGTATTTTTAACATACAGAGG + Intronic
1027514878 7:79129040-79129062 TTTGTATTTTTAGCAGAAACGGG + Intronic
1027520031 7:79195089-79195111 TTTATCTTTTTACAAAAAAGTGG - Intronic
1027825003 7:83100949-83100971 TTTGTACTTTTAGTAAAAAGGGG - Intronic
1027855148 7:83501622-83501644 TTTGTATTTTTAGCAGAAACAGG + Intronic
1027923324 7:84425797-84425819 ATTGTATTTTTAGCAAAGACGGG - Intronic
1027957454 7:84899206-84899228 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1028541655 7:91948920-91948942 TTTGTATTTTTAGCAGAAATGGG + Intronic
1028563589 7:92203680-92203702 TTTGTATTATTGCCAAAAATTGG + Intronic
1028912866 7:96228033-96228055 TTTGTATTTTTACTAAAGACAGG + Intronic
1028974839 7:96901299-96901321 GTTTTTTTTTTAAAAAAAAGAGG + Intergenic
1029315072 7:99704460-99704482 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1029397607 7:100319080-100319102 TTTGTATTTTTAGCATAAATGGG + Intronic
1029446865 7:100618259-100618281 GTTGTATTTTTAGCAGAGACAGG - Intergenic
1029557965 7:101283423-101283445 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1029584618 7:101462486-101462508 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1029612736 7:101635992-101636014 TTTGTATTTTTACTAGAAACAGG - Intergenic
1029949937 7:104573239-104573261 TTTGTATTTTTAACAAAGATGGG - Intronic
1030047616 7:105511587-105511609 TTTGTATTTTTACTAGAGAGGGG - Intronic
1030094201 7:105883412-105883434 TTTGTATTTTTACCAGAAGTGGG + Intronic
1030262322 7:107579197-107579219 GTTGTATTTTTAGCAGAGACAGG - Intergenic
1030383781 7:108844092-108844114 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1030911231 7:115251806-115251828 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1031348415 7:120698184-120698206 GTTGTATTTTTAGTATAAATGGG + Intronic
1031539833 7:122980859-122980881 TTTGTATTTTTAGTAGAAAGCGG + Intergenic
1031587345 7:123548212-123548234 GTGATAATTTTACCAAAAACAGG + Intronic
1032009324 7:128332524-128332546 TTTGTATTTTTAGTAAAAATGGG + Intronic
1032115817 7:129116319-129116341 TTTGTATTTTTAGTAGAAAGAGG + Intergenic
1032128983 7:129213758-129213780 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1032134191 7:129259903-129259925 TTTGTATTTTTAGCAAAGACAGG - Intronic
1032373622 7:131386183-131386205 TTTGTATTTTTAGTAAAAACGGG + Intronic
1033093109 7:138404883-138404905 TTTGTATTTTTAGCAAAGATGGG + Intergenic
1033104798 7:138511459-138511481 GTTGTATTTTTAGTAGAAACGGG + Intronic
1033160405 7:138991219-138991241 GTTGTATTTTTAGTAAAGACGGG - Intergenic
1033218395 7:139510923-139510945 TTTGTATTTTTAGCAGAGAGTGG - Intergenic
1033372806 7:140726938-140726960 ATTGTATCTTTAGCAAAATGAGG - Intronic
1033783160 7:144696979-144697001 ATTGTATTTTTACTAAAGATTGG + Intronic
1033810197 7:145002862-145002884 ATAGTATTTTTACAACAAAGTGG - Intergenic
1033811598 7:145019324-145019346 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1033902162 7:146156771-146156793 TTTGTATTTTTAGTAAAAACAGG + Intronic
1034102806 7:148465497-148465519 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1034157339 7:148966562-148966584 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1034289234 7:149915049-149915071 TTTGTATTTTTAGTAAAAACGGG + Intergenic
1034352558 7:150426768-150426790 GGTTTATTTTTCCCAAAAAGAGG - Intergenic
1034562842 7:151892663-151892685 GTTGTATTTTTAGTAGAAATGGG - Intergenic
1034661838 7:152777777-152777799 TTTGTATTTTTAGTAAAAACGGG - Intronic
1034670477 7:152853893-152853915 GTTGTATTTTTAGTAAAGATGGG + Intronic
1034790755 7:153965683-153965705 TTTGTATTTTTAGTAAAAACGGG + Intronic
1034856182 7:154549586-154549608 GTTGTTTTTTTAATCAAAAGAGG - Intronic
1034944000 7:155250299-155250321 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1035000318 7:155607384-155607406 TTTGTATTTTTAGTAAAAAAGGG - Intergenic
1035093556 7:156333824-156333846 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1035202339 7:157275723-157275745 GCTGTATTCTTACAATAAAGTGG - Intergenic
1035878067 8:3212999-3213021 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1035910779 8:3563715-3563737 TTTGTATTTTTACTAAAAACAGG - Intronic
1036082727 8:5575162-5575184 TTTGTATTTTTAGCAGAGAGGGG + Intergenic
1036623957 8:10449908-10449930 TTTGTATTTTTAATAAAAACGGG - Intergenic
1037131293 8:15410815-15410837 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1037607119 8:20447469-20447491 GTTGTATTTTTACTAAAGACGGG + Intergenic
1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG + Intergenic
1038241718 8:25815553-25815575 TTTGTATTTTTACTAAAGACGGG - Intergenic
1038578469 8:28726125-28726147 TTTGTATTTTTAGTAAAAACTGG + Intronic
1038792390 8:30679874-30679896 TTTGTATTTTTAGCAGAGAGAGG + Intronic
1038795643 8:30706961-30706983 TTTGTATTTTTACTAGAAACGGG - Intronic
1038839985 8:31175593-31175615 TCTGAAATTTTACCAAAAAGTGG - Intergenic
1038884574 8:31649124-31649146 TTTGTATTTTTAGTAAAAATGGG + Intronic
1038948650 8:32389929-32389951 TTTGTATTTTTAGTAGAAAGAGG + Intronic
1038977526 8:32716719-32716741 GTTATATTTAAACCAAAAAAGGG - Intronic
1039297248 8:36169751-36169773 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1039361859 8:36885381-36885403 TTTGTATTTTTACTAAAGACGGG - Intronic
1039527312 8:38228387-38228409 TTTGTATTTTTAGCAGAAACAGG + Intronic
1039528437 8:38236834-38236856 TTTGTATTTTTAGTAAAAATGGG + Intronic
1039641950 8:39233061-39233083 CTAGTATTGTTACCAGAAAGGGG + Intronic
1039827436 8:41186900-41186922 CTTGTTTTTTTACAAGAAAGAGG + Intergenic
1040023039 8:42757549-42757571 TTTGTATTTTTAGTAAAAATGGG - Intronic
1040099722 8:43488063-43488085 GTTGTATTTGTACAATAAACTGG + Intergenic
1040503381 8:48025105-48025127 GTTGTATTTTTAGTAGAAACGGG + Intronic
1040547643 8:48411698-48411720 GTTGTATTTTTAGTAGAGAGAGG - Intergenic
1040878657 8:52179842-52179864 CTTGTATTTTCTTCAAAAAGAGG + Intronic
1040883269 8:52231646-52231668 TTTGTATTTTTAGTAAAAATGGG + Intronic
1040932869 8:52753438-52753460 GTTGTATTTTTAGTAGAAACAGG - Intergenic
1041069564 8:54113683-54113705 TTTGTATTTTTAGTAAAGAGTGG + Intergenic
1041343842 8:56874705-56874727 TTTGTATTTAAACCTAAAAGAGG - Intergenic
1041530270 8:58857939-58857961 GTTGTATTTTTAGTAAAGACAGG + Intronic
1041658771 8:60380209-60380231 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1041722026 8:60984497-60984519 TTTGTATTTTTACCAGACATGGG + Intergenic
1041854314 8:62433122-62433144 GTTTTATTTGAATCAAAAAGTGG - Intronic
1041863280 8:62538345-62538367 GTTGTATTTTTGGCAGAAATGGG + Intronic
1041875568 8:62683205-62683227 GTTGTATTTTTAGTAGAAACGGG + Intronic
1042379617 8:68097656-68097678 GTTGTATGCATACCAAATAGTGG - Intronic
1042390184 8:68225480-68225502 TTTGTATTTTAACAAAAAATAGG + Intronic
1042522060 8:69723942-69723964 TTTGTATTTTTAGTAAAAATGGG + Intronic
1042575704 8:70216460-70216482 ATTGTATTCTTTACAAAAAGAGG - Intronic
1042827761 8:72995658-72995680 GTTGTATTTTTAGTAGAAACAGG + Intergenic
1042914013 8:73856876-73856898 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1042989471 8:74622430-74622452 TTTGTATTTTTAGTAAAAACAGG - Intronic
1043051454 8:75390872-75390894 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1043146095 8:76656949-76656971 TTTGTATTTTTAGTAAAAATGGG - Intergenic
1043182349 8:77101657-77101679 CTTGTATTTTTTTCAAAATGAGG - Intergenic
1043264377 8:78245096-78245118 GTTTTGTTTTTAGCAAAAATTGG - Intergenic
1043311917 8:78871459-78871481 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1043920130 8:85973071-85973093 GTTGTATGATTACTAGAAAGTGG + Intergenic
1043937471 8:86157884-86157906 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1043955511 8:86354649-86354671 TTTGTATTTATAACAAAATGTGG + Intronic
1044236285 8:89834411-89834433 TTTGTATTTATACCCAGAAGTGG - Intergenic
1044421421 8:92000132-92000154 TTTGTATTTTTACCAGAGACGGG - Intronic
1044743235 8:95348634-95348656 GTTGTATTTTTAGCAGAGACAGG - Intergenic
1044838695 8:96319557-96319579 TTTATATTTTCACCAAAAACGGG + Intronic
1044848971 8:96409235-96409257 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1044969698 8:97606913-97606935 TTTGTATTTTTAGTAAAAATAGG - Intergenic
1045043963 8:98256787-98256809 TTTGGATATGTACCAAAAAGTGG - Intronic
1045088813 8:98717061-98717083 GTTTTATTTTTTCCCAAGAGTGG - Intronic
1045297812 8:100887636-100887658 GTTGTATTTTTAGTAAAGATGGG - Intergenic
1045843506 8:106606481-106606503 TTTGTATTTTTACTAGAAACAGG + Intronic
1046754582 8:117960037-117960059 TTTGTATTTTTACAAAAGATGGG - Intronic
1046805434 8:118474556-118474578 TTTGTATTTTTAGTAGAAAGGGG + Intronic
1046887639 8:119385365-119385387 TTTGTATTTTTAGCAAAGATGGG - Intergenic
1047021473 8:120779329-120779351 TTTGTATTTTTAGCAGAAATGGG - Intronic
1047115663 8:121839262-121839284 TTTGTATTTTTAACAAAAATAGG - Intergenic
1047474807 8:125216466-125216488 TTTGTATTTTTAGTAGAAAGCGG - Intronic
1048616925 8:136085234-136085256 GTTGTTTTTTTAAGAAAAGGAGG - Intergenic
1049039495 8:140101305-140101327 TTTGTATTTTTACTAGAAATGGG + Intronic
1049497202 8:142941645-142941667 GTTGTATTTTTAGTAGAAACGGG - Intergenic
1049736986 8:144213615-144213637 TTTGTATTTTTAGCAGAAACGGG - Intronic
1049869940 8:144966645-144966667 TTTGTATTTTTACCAGAGACAGG - Intergenic
1049994347 9:1020431-1020453 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1050556221 9:6791849-6791871 TTTGTATTTTTAGTAAAAATGGG - Intronic
1050880149 9:10689075-10689097 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1050955851 9:11658867-11658889 CTTGTATTTTTAGTAAAAATGGG - Intergenic
1050963748 9:11770149-11770171 TGAGTGTTTTTACCAAAAAGAGG - Intergenic
1051030713 9:12673564-12673586 AGTATATTTTTACCAAAAACAGG + Intergenic
1051072811 9:13193385-13193407 GTTTTATGTTTACCCAAAAGTGG + Intronic
1051640878 9:19223514-19223536 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1051891027 9:21943162-21943184 ATTGTGTTTATACCAAGAAGGGG + Intronic
1052074636 9:24125918-24125940 GTTGTACTTTTACAAATATGTGG + Intergenic
1052118644 9:24680578-24680600 TTTGTATTTTTAGCAAAGAAAGG + Intergenic
1052309251 9:27046999-27047021 TTTGTATTTTTACCAGAGACAGG - Intronic
1052669177 9:31533778-31533800 GTTGTGTTTTTCTCAAGAAGGGG - Intergenic
1052783007 9:32800257-32800279 ATAGTATTTCTGCCAAAAAGTGG + Intergenic
1052871289 9:33509909-33509931 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1053171931 9:35893313-35893335 GTTGTATTTCTACTGAATAGTGG - Intergenic
1053177622 9:35939621-35939643 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1053212494 9:36242909-36242931 TTTGTATTTTTACTAGAAATGGG + Intronic
1053241291 9:36497847-36497869 TTTGTATTTTTACTAGAAACGGG - Intergenic
1053258081 9:36636329-36636351 TTTGTATTTTTACTAGAAACGGG - Intronic
1053507318 9:38654279-38654301 GATGTATTTTAAATAAAAAGCGG + Intergenic
1053522938 9:38799704-38799726 TTTGTATTTTTAGTAAAGAGTGG + Intergenic
1053659787 9:40261937-40261959 TTTGTATTTTTAGTAAAAATAGG + Intronic
1053674216 9:40406031-40406053 GTTATATTTTTAGGAAAAAAAGG + Intergenic
1053910158 9:42891294-42891316 TTTGTATTTTTAGTAAAAATAGG + Intergenic
1054163927 9:61701514-61701536 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1054195164 9:62024125-62024147 TTTGTATTTTTAGTAAAGAGTGG + Intergenic
1054355405 9:64056661-64056683 ACTTTATTTTTATCAAAAAGAGG - Intergenic
1054371917 9:64408232-64408254 TTTGTATTTTTAGTAAAAATAGG + Intronic
1054510405 9:65970259-65970281 GTTATATTTTTAGGAAAAAAAGG - Intergenic
1054524811 9:66114280-66114302 TTTGTATTTTTAGTAAAAATAGG - Intronic
1054643244 9:67564564-67564586 TTTGTATTTTTAGTAAAGAGTGG - Intergenic
1054679536 9:67897947-67897969 TTTGTATTTTTAGTAAAAATAGG + Intronic
1054866505 9:70007688-70007710 GTTGCATTTGTGCCAAAATGTGG + Intergenic
1054946684 9:70803621-70803643 TTTGTATTTTTAGCAAAGACGGG + Intronic
1054983325 9:71232670-71232692 TTTGTATTTTTAACAGAAATGGG + Intronic
1054997211 9:71406100-71406122 GTTGTATTTTTAGTAGAAACAGG - Intronic
1055032809 9:71787914-71787936 TTTGTATTTTTAGCAAAGACAGG + Intronic
1055055331 9:72018387-72018409 TTTGTATTTTTACTAGAAATGGG - Intergenic
1055060299 9:72061677-72061699 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1055202022 9:73676139-73676161 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1055214531 9:73842444-73842466 GTTGTAATTTTACCAAAATTGGG + Intergenic
1055288708 9:74759520-74759542 GATATCTTTTTACCAAAAAATGG + Intronic
1055297717 9:74851574-74851596 GTTGTATTTTTAGCAGAGATGGG - Intronic
1055584762 9:77746968-77746990 TTTGTATTTTTATCAAATAATGG - Intronic
1055894500 9:81159630-81159652 GTTGTATTTTTAGTAGACAGGGG + Intergenic
1056145421 9:83724055-83724077 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1056166280 9:83943846-83943868 TTTGTATTTTTAGCAGAAACGGG - Intronic
1056206301 9:84322671-84322693 TTTGTATTTTTAATAAAAACAGG - Intronic
1056400055 9:86218253-86218275 GAGGTACTTTTTCCAAAAAGAGG + Intergenic
1056995398 9:91452601-91452623 TTTGTATTTTTAGTAAAAACGGG - Intergenic
1057027517 9:91746246-91746268 TTTGTATTTTTAGTAGAAAGAGG + Intronic
1057039374 9:91836366-91836388 TTTGTATTTTTAGTAGAAAGGGG - Intronic
1057299297 9:93868041-93868063 TTTGTATTTTTACTAAAGACAGG + Intergenic
1057771029 9:97968258-97968280 TTTGTATTTTTACTAGAAACAGG - Intergenic
1057777446 9:98022359-98022381 TTTGTATTTTTACTAGAGAGGGG + Intergenic
1058381478 9:104381878-104381900 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1058680616 9:107437374-107437396 GTTGTATTTTTAGTAGAAATAGG - Intergenic
1058760601 9:108127883-108127905 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1059153768 9:111972082-111972104 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1059293428 9:113248145-113248167 GTTGTATTTTTAGCAGAAACGGG - Intronic
1059319651 9:113458921-113458943 TTTGTATTTTTAGCAAACATGGG + Intronic
1060440705 9:123636486-123636508 TTTGTATTTTTAGCAAAGACAGG + Intronic
1060485413 9:124043386-124043408 TTTGTATTTTTAGCAAAGACGGG + Intergenic
1060519914 9:124288453-124288475 TTTGTATTTTTAGTAAAAATGGG + Intronic
1060586269 9:124788127-124788149 TTTGTATTTTTAGCAGAAACAGG - Intronic
1060645015 9:125270770-125270792 TTTGTACTTTTACCAGAAACGGG - Intronic
1060751499 9:126172720-126172742 TTTGTATTTTTACTAAAGACAGG + Intergenic
1060765042 9:126288995-126289017 TTTGTATTTTTAACAGAAATGGG - Intergenic
1060993808 9:127864273-127864295 GTTTTTTTTTTAACAAAAATTGG - Intergenic
1061076960 9:128347553-128347575 TTTGTATTTTTAGTAAAAACAGG - Intronic
1061113005 9:128588796-128588818 TTTGGATTTTTAGCAACAAGTGG + Exonic
1061124293 9:128664131-128664153 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1061521995 9:131124185-131124207 GTTGTATTTTTAGCAGAGACGGG + Intergenic
1061554449 9:131358359-131358381 TTTGTATTTTTACTAGAAACGGG - Intergenic
1061604608 9:131699413-131699435 TTTGTATTTTTACTAAAGACAGG + Intronic
1061682080 9:132247771-132247793 TTTGTATTTTTAGCAGAAACGGG - Intergenic
1061857504 9:133450259-133450281 GTTGTATTTTTAGTAAAGATGGG - Intronic
1061978558 9:134086479-134086501 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1062319778 9:135985137-135985159 TTTGTATTTTTAGTAGAAAGGGG - Intergenic
1203439174 Un_GL000195v1:172356-172378 GTTGTATTTTTATAATAAAGTGG - Intergenic
1203732960 Un_GL000216v2:107607-107629 GTTGTATTTTTAGCAGACACGGG - Intergenic
1203743732 Un_GL000218v1:25758-25780 ACTTTATTTTTATCAAAAAGGGG - Intergenic
1203566377 Un_KI270744v1:93777-93799 GCTTTATTTTTATCAAAAAGGGG + Intergenic
1185499987 X:589344-589366 TTTGTATTTTTACTAGAAACGGG + Intergenic
1185534687 X:851498-851520 TTTCTATTTTGACCAGAAAGAGG - Intergenic
1185675223 X:1843887-1843909 TTTGTATTTTTACTAGAAATGGG + Intergenic
1185742233 X:2542825-2542847 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1186164422 X:6811484-6811506 TTTGTATTTTTACCAGAGATGGG + Intergenic
1186206068 X:7202080-7202102 GATGTATTCTTAACAAAATGGGG - Intergenic
1186556415 X:10564647-10564669 GTTTTGTTTTTATCACAAAGAGG + Intronic
1186936278 X:14453139-14453161 GTTTTATATTTCCCAAAAAAGGG + Intergenic
1186941046 X:14507863-14507885 TTTGTATTTTTAGAAGAAAGGGG + Intergenic
1187100681 X:16188118-16188140 TTTGTATTTTTACTAGAAACGGG + Intergenic
1187119235 X:16387389-16387411 TTTGTATTTTTACTAAAGACGGG + Intergenic
1187186367 X:16990436-16990458 TTTGTATTTTTAGTAAAAACAGG - Intronic
1187194207 X:17066698-17066720 TTTGTATTTTTAACAAAGACAGG - Intronic
1187694323 X:21903349-21903371 TTTGTATTTTTAATAGAAAGGGG + Intergenic
1187710753 X:22051357-22051379 TTTGTATTTTTAGGAAAAACAGG - Intronic
1187923108 X:24225017-24225039 GTTGTATTTTTAGTAGAGAGGGG - Intergenic
1187953293 X:24491781-24491803 TTTGTATTTTTAGTAAAGAGGGG - Intronic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1188176858 X:27001716-27001738 TTTGTATTTTTAGTAAAAACAGG - Intergenic
1188295675 X:28445471-28445493 GTTGTGTTTTTGCGAATAAGGGG - Intergenic
1188747719 X:33867216-33867238 GTTGTGTTTTTATCATGAAGAGG - Intergenic
1189385026 X:40530244-40530266 TTTGTATTTTTACTAAAGACGGG - Intergenic
1189503686 X:41589039-41589061 GTTGTATTTCTATCATAAATAGG + Intronic
1189702865 X:43730020-43730042 TTTGTATTTTTAGCAGAAATGGG - Intronic
1189767968 X:44391533-44391555 TTTGTATTTTTACTAAAGATGGG - Intergenic
1189791851 X:44612371-44612393 TTTGTATTTTTAGTAGAAAGAGG + Intergenic
1189932704 X:46031961-46031983 GTTGACTTTTTATCAACAAGTGG - Intergenic
1190359846 X:49638437-49638459 TTTGTATTTTTAGTAAAACGAGG + Intergenic
1191070483 X:56395289-56395311 GTTTTTTTTTTTCCAAAATGGGG + Intergenic
1191100035 X:56716831-56716853 GTTTTTTTTTTAACAAGAAGGGG - Intergenic
1191199172 X:57760545-57760567 TTTGTATTTTTACTAAAGACGGG - Intergenic
1192001192 X:67153448-67153470 GGTGTATTTCAACCAAAAACAGG - Intergenic
1192530030 X:71875757-71875779 TTTGTATTTTTAGCAAAGACAGG - Intergenic
1192821703 X:74653283-74653305 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1192981756 X:76351529-76351551 TTTGTATTTTTAACAGAAACGGG - Intergenic
1193552233 X:82909353-82909375 GTTTTATTTTTTCCAAATTGAGG + Intergenic
1193579753 X:83250367-83250389 GTTGGATATATACCCAAAAGTGG - Intergenic
1193588150 X:83353056-83353078 GTTGTATTTTTAGTAGAAACTGG + Intergenic
1194227930 X:91284828-91284850 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1194750811 X:97682209-97682231 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1195300719 X:103527579-103527601 GTCCTATTTCTACCAACAAGGGG + Intergenic
1196608424 X:117683015-117683037 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1196792767 X:119479380-119479402 TTTGTATTTTTAGCAAAGACGGG - Intergenic
1197091491 X:122543322-122543344 GTTGTATATTTAACATAATGGGG - Intergenic
1197212562 X:123840336-123840358 TTTGTATTTTTAGCAGAAACGGG + Intergenic
1197479256 X:126962553-126962575 GTTGTAGTTCTACCAGAATGAGG + Intergenic
1197986156 X:132268610-132268632 TTTGTATTTTTAGTAAAGAGGGG + Intergenic
1198124790 X:133632269-133632291 TTTGTATTTTTAGTAAAAACGGG + Intronic
1198195560 X:134357470-134357492 TTTGTATTTTTAGTAAAAACAGG + Intergenic
1198386714 X:136135596-136135618 GTTGTATTCCTGCCAAAAATGGG + Intergenic
1199295908 X:146158345-146158367 TTTGTATTTTTACTAAAGACAGG - Intergenic
1199805233 X:151293219-151293241 TTTGTATTTTTACCAGAGACGGG + Intergenic
1199914338 X:152322703-152322725 TTTGTATTTTTAGTAAAAATGGG + Intronic
1200748753 Y:6925588-6925610 TTTGTATTTTTATCAGAATGGGG + Intronic
1200777985 Y:7186891-7186913 TTGGTATTGTTACCAGAAAGGGG - Intergenic
1200853233 Y:7908184-7908206 GTTGTATTTCCAAAAAAAAGTGG + Intergenic
1200862046 Y:8003421-8003443 TTTGTATTTTTACCACAGATGGG + Intergenic
1200963732 Y:9017864-9017886 GTTTTGTTTTTTCCAAAGAGAGG + Intergenic
1201149294 Y:11086931-11086953 TTTGTATTTTTAGTAAAAATGGG + Intergenic
1201157057 Y:11140739-11140761 ACTTTATTTTTATCAAAAAGGGG - Intergenic
1201280995 Y:12341884-12341906 CTTGTATTTTTAGTAAAGAGAGG + Intergenic
1201293925 Y:12447692-12447714 TTTGTATTTTTACCAGAGACGGG - Intergenic
1201363264 Y:13176186-13176208 TTTGTATTTTTAGTAGAAAGGGG + Intergenic
1201714680 Y:17031415-17031437 TTTGTATTTTTACTAGAGAGGGG + Intergenic
1201849163 Y:18458569-18458591 GTTGTACTTTTAGTAAAAATGGG - Intergenic
1201884155 Y:18861806-18861828 GTTGTACTTTTAGTAAAAATGGG + Intergenic
1201988947 Y:20003146-20003168 TTTGTATTTTTAGCAGAGAGGGG - Intergenic
1201990368 Y:20017323-20017345 GTAGTATTTTGACCTAAAAGTGG + Intergenic
1202042813 Y:20702581-20702603 TTTGTATTTTTAGCAGAAACAGG - Intergenic
1202093239 Y:21215947-21215969 TTTGTATTTTTAGTAAAGAGGGG - Intergenic
1202114817 Y:21461545-21461567 TTTGTATTTTTAGCAGAAATGGG - Intergenic
1202255843 Y:22919604-22919626 GTTTTATTTATTCCTAAAAGCGG + Intergenic
1202408834 Y:24553357-24553379 GTTTTATTTATTCCTAAAAGCGG + Intergenic
1202461949 Y:25116721-25116743 GTTTTATTTATTCCTAAAAGCGG - Intergenic
1202627984 Y:56880062-56880084 GTTGTATTTTTAGCAGACACGGG + Intergenic