ID: 1183768794

View in Genome Browser
Species Human (GRCh38)
Location 22:39905125-39905147
Sequence CAATTAGCGAGTACTCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183768794 Original CRISPR CAATTAGCGAGTACTCTCAG GGG Intronic
909894125 1:81044924-81044946 AATTTAGAGAGAACTCTCAGAGG - Intergenic
910761742 1:90739651-90739673 CAGTTAGCCAGGATTCTCAGTGG + Intergenic
918965156 1:191335359-191335381 CAAATAGTGTGTATTCTCAGGGG + Intergenic
923424909 1:233859167-233859189 CAATGAATGAGTACTCTCAGGGG - Intergenic
1070938514 10:80321382-80321404 GAATTAGCCAGTAATTTCAGAGG + Intergenic
1078527031 11:12109347-12109369 CAGTCAGCTTGTACTCTCAGAGG - Intronic
1079829463 11:25244693-25244715 CAATTAGCAAGTGATATCAGGGG + Intergenic
1080784788 11:35464970-35464992 CCATTAGCGAGTCCTCTTAAAGG - Intronic
1088451156 11:109982661-109982683 CAATAAGGGAGTTCACTCAGTGG + Intergenic
1088512628 11:110593887-110593909 CAATTATCGTGCACTCTCACTGG - Intronic
1095281496 12:40356344-40356366 CAATCAGCAAGTATTTTCAGAGG - Intronic
1100255806 12:92881661-92881683 CCATTAGTGAGTAGTTTCAGTGG + Intronic
1116567254 14:46464580-46464602 CAATTACAGAGTACTCTGAAGGG - Intergenic
1125274343 15:37975310-37975332 CAATTATCTAATACTGTCAGTGG + Intergenic
1126729405 15:51666948-51666970 CAATTAGCAAGTAATCTGTGGGG + Intergenic
1136232048 16:28892043-28892065 TAATTAGGGAGTTCTCGCAGTGG + Intronic
1141990491 16:87606427-87606449 CAATCAGGGAGTACCCTAAGGGG - Intronic
1159752288 18:72318030-72318052 CACTTAGCGGGTAGTATCAGGGG - Intergenic
944621988 2:201525033-201525055 CAATGAGCTAATACTCTCAGTGG - Intronic
946478703 2:220033385-220033407 CAATTTGGGACAACTCTCAGGGG + Intergenic
946617689 2:221527504-221527526 CAATGAGAGTGGACTCTCAGTGG - Intronic
946695395 2:222352584-222352606 CAATAAGCTGGTACACTCAGAGG + Intergenic
1178786180 21:35655837-35655859 CATTTGGCTAGTACTTTCAGGGG + Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1183768794 22:39905125-39905147 CAATTAGCGAGTACTCTCAGGGG + Intronic
957754676 3:84470118-84470140 CCATTGGCGAGTACTCACATGGG - Intergenic
957877138 3:86161810-86161832 CATTTGGCGAGGAATCTCAGGGG + Intergenic
958497257 3:94861146-94861168 CAATTATCTAATACTGTCAGTGG + Intergenic
966529689 3:180962002-180962024 AAATTATCGAGTAATGTCAGTGG - Intronic
969975616 4:11098234-11098256 TAACTAGCGAGTGCCCTCAGGGG + Intergenic
979888012 4:126056231-126056253 CAATTTGCAAGCAGTCTCAGTGG - Intergenic
980792207 4:137634083-137634105 CAATGATCTAGTACTTTCAGTGG - Intergenic
982843481 4:160221482-160221504 CAATGATCTAATACTCTCAGTGG + Intergenic
985130001 4:186729425-186729447 GAATCAGCTTGTACTCTCAGAGG + Intergenic
990528584 5:56652303-56652325 CAATTACAGAGAAATCTCAGGGG + Intergenic
1022555902 7:31295762-31295784 CAAATATAGAGTACTCTAAGTGG - Intergenic
1024109996 7:46134870-46134892 CAATTTGCAAGTAGCCTCAGTGG - Intergenic
1037567849 8:20132580-20132602 CAGCTAGCGAGTACTCTCAGTGG + Intergenic
1039088247 8:33801022-33801044 CAATTAGCCAGCTTTCTCAGTGG - Intergenic
1046141941 8:110105468-110105490 CAAATAGGGAGTTCACTCAGTGG - Intergenic
1047029034 8:120856194-120856216 CATTTAGTCAGTATTCTCAGTGG - Intergenic
1052446722 9:28571841-28571863 AAATTAGCTATTACTCACAGAGG + Intronic
1055340660 9:75279051-75279073 CAATTAGTAAGTAATCTCTGGGG + Intergenic
1188096707 X:26032469-26032491 CAATTAACAAGTACTCCCACTGG + Intergenic
1192161674 X:68793045-68793067 GAATTAGTGAGTGGTCTCAGAGG + Intergenic
1192977972 X:76306538-76306560 CAGTTTGGCAGTACTCTCAGTGG - Intergenic
1197802012 X:130360500-130360522 CAATTAGCAAGTAATCTGTGGGG + Intronic
1201889480 Y:18926258-18926280 CAATTAGGGTGAATTCTCAGAGG + Intergenic