ID: 1183770424

View in Genome Browser
Species Human (GRCh38)
Location 22:39920493-39920515
Sequence CTGAGCTGCACCCCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183770424_1183770432 28 Left 1183770424 22:39920493-39920515 CCTGCAGCCGGGGTGCAGCTCAG No data
Right 1183770432 22:39920544-39920566 AGATGAGTGTTGACTTTCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183770424 Original CRISPR CTGAGCTGCACCCCGGCTGC AGG (reversed) Intronic
No off target data available for this crispr