ID: 1183771112

View in Genome Browser
Species Human (GRCh38)
Location 22:39926807-39926829
Sequence TCCCCTAATTGGCAGTGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183771112_1183771115 30 Left 1183771112 22:39926807-39926829 CCTGATCACTGCCAATTAGGGGA 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1183771115 22:39926860-39926882 ATAAATATATTTATCGTGATTGG 0: 1
1: 0
2: 1
3: 26
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183771112 Original CRISPR TCCCCTAATTGGCAGTGATC AGG (reversed) Intronic
906501413 1:46343760-46343782 TCCCCAAATTAGCAGAGGTCAGG + Intronic
906606804 1:47178591-47178613 TGCCCTAATTTACAGTGAACTGG + Intergenic
909725700 1:78832455-78832477 TCACATAATAGGCAGTGTTCAGG + Intergenic
916072007 1:161175934-161175956 TGCCCTATTTGGCCGAGATCAGG - Exonic
918211890 1:182358496-182358518 TCCCCTTAGTGTCAGTGACCTGG - Intergenic
921251921 1:213306241-213306263 TCACTTAATTGCCAGGGATCAGG + Intergenic
1062822862 10:548066-548088 TTGCCTCATTGGCTGTGATCAGG + Intronic
1064151946 10:12872636-12872658 TCCCCTTTTGGGCAGTGATGGGG + Intergenic
1078453662 11:11458639-11458661 TGCCCTCATTAGCAGTGCTCGGG - Intronic
1084803312 11:71561135-71561157 TCCCCTAATAGTTAGTGATGTGG + Intronic
1084968458 11:72756531-72756553 TCCCCTGAGTGTCAGGGATCAGG + Intronic
1092028853 12:5267000-5267022 TCCCCTAATGATCAGTGATGTGG - Intergenic
1101875191 12:108592779-108592801 TCCCACACTGGGCAGTGATCAGG - Intronic
1102951600 12:117035039-117035061 TCCTCTAATTGGCAGGGTTAGGG - Intergenic
1110289967 13:73794080-73794102 TCCACTACTTGGCAGTGAGGGGG + Intronic
1110452966 13:75657545-75657567 TCTTCTACTTGGCAGGGATCTGG - Intronic
1111134493 13:84023266-84023288 TCCCCTAATTGGCAATAGTAAGG - Intergenic
1119789007 14:77332398-77332420 TCCCATGCTTGGCAGTGTTCAGG + Intergenic
1126106574 15:45150756-45150778 TCCCCTGAATGGCTGGGATCAGG + Intronic
1126592079 15:50350712-50350734 TCCCCAATTTGTCAGTGAACAGG + Intronic
1128748335 15:70130676-70130698 TCTCCTAGTTGGCAGGGACCTGG - Intergenic
1130869498 15:87959237-87959259 TCCCCTAGTGGGCAGAGCTCTGG + Intronic
1130993783 15:88892840-88892862 TCCCCTCAGTGGTAGTGGTCAGG - Intronic
1131250648 15:90828040-90828062 TGCCCCACTTTGCAGTGATCTGG - Intergenic
1135846725 16:25925588-25925610 TCCCCTAAGTGCCAGTGACGGGG + Intronic
1136361369 16:29782129-29782151 GCCCCGTATTGGCAGTGATGAGG - Exonic
1140928686 16:79607285-79607307 TCCCGTCATTGGAGGTGATCAGG - Intergenic
1144142437 17:12362821-12362843 TGCCCTAATGGGAAGTGATGGGG + Intergenic
1149281863 17:55114103-55114125 TCCCTTAATTGGCACTCATTTGG + Intronic
1156581611 18:38383211-38383233 TCCATTAATAGGCAGTGATTAGG - Intergenic
1159286603 18:66362115-66362137 ACCTCTACTTGGCAGTGATGAGG + Intergenic
1162225472 19:9217837-9217859 TCCCCTAATTAACAATGATCCGG - Intergenic
1164807830 19:31130442-31130464 TCCCCTAAGGCACAGTGATCGGG + Intergenic
925028562 2:629042-629064 CCCCCGAATTGGAAGTGAGCAGG + Intergenic
927064059 2:19452096-19452118 TCTCCTATTTCCCAGTGATCTGG + Intergenic
929246585 2:39709293-39709315 TGCTGCAATTGGCAGTGATCTGG + Intronic
929922347 2:46181778-46181800 TCCCCTCATTAGCAGCCATCTGG + Intronic
931324238 2:61201908-61201930 ACCCATCATTGGCAGTAATCAGG - Intronic
932504397 2:72214717-72214739 TCCCATCAATGGCATTGATCTGG - Intronic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
939668507 2:144980265-144980287 TCCCCTAATTGGAAGTGAGTAGG - Intergenic
939790149 2:146562221-146562243 TCCACTAATTAGCAGTAATCTGG - Intergenic
940254245 2:151712580-151712602 TCCCAGACTTGGCAGTGCTCGGG - Intronic
941996540 2:171606557-171606579 TCACTAAATTTGCAGTGATCTGG - Intergenic
1171075945 20:22123376-22123398 AACCCTAATTGGCATGGATCAGG - Intergenic
1171142265 20:22753603-22753625 TCCCCAAACTGGCAGTGATTTGG - Intergenic
1178423627 21:32461416-32461438 CCTCCTAAATGGCAGTGCTCAGG - Intronic
1178666042 21:34547342-34547364 TCCCATACATGGCAGTGAGCAGG - Intronic
1178743463 21:35225006-35225028 TCCCCTAAATGGCAATGAGCTGG - Intronic
1178778134 21:35572117-35572139 TTCCCTAACTGGAAGTGTTCAGG - Intronic
1178951271 21:36987869-36987891 TCACTTAGTTGGTAGTGATCTGG - Intronic
1182396791 22:30041851-30041873 TCCCCTAACTGTAAGTGAGCAGG - Intergenic
1183771112 22:39926807-39926829 TCCCCTAATTGGCAGTGATCAGG - Intronic
953548268 3:43880753-43880775 TCCCCTATTTGACTGTGATGTGG - Intergenic
955031968 3:55230748-55230770 TCCCCAAATAGGCCCTGATCAGG + Intergenic
962171349 3:133104711-133104733 TCCCCAAAATGTCAGTGATTAGG - Intronic
975647457 4:76559276-76559298 TCCCCTACCTTGCAGAGATCCGG + Intronic
979139866 4:117158691-117158713 TCTCCTAGTTGGCAGTTGTCAGG + Intergenic
984093623 4:175407394-175407416 TCCCCTAATGCACAGTCATCTGG - Intergenic
999571860 5:152927615-152927637 TCCACTACTTGGCAGAAATCAGG + Intergenic
1001043511 5:168353753-168353775 GCCCTGACTTGGCAGTGATCGGG - Intronic
1001169266 5:169403181-169403203 TGCCCTGATTGGTAGTGACCTGG + Intergenic
1004758153 6:18636152-18636174 AGCCCTAACTGGCAGTGATACGG - Intergenic
1005231674 6:23709070-23709092 TTTCCTAATTTGCAGTGACCTGG - Intergenic
1006185218 6:32177773-32177795 TCCCCTGATTGGCCGACATCGGG - Intronic
1009664679 6:66660140-66660162 TTCCCAGAATGGCAGTGATCAGG - Intergenic
1024942519 7:54777286-54777308 TCCCCTGACTGGCTGTGCTCTGG + Intergenic
1034818973 7:154199146-154199168 TCCCCTAATTGCAAGTCGTCAGG + Intronic
1046275467 8:111954052-111954074 GCCCCTAATTGCCTGTTATCTGG - Intergenic
1047535835 8:125718897-125718919 TTCTCTAATTGGCAGTGAAAAGG - Intergenic
1053271687 9:36754367-36754389 TCCCCTCATGGGCAGATATCAGG + Intergenic
1055428286 9:76217996-76218018 TCCCCTACTTGGCAGGTATCAGG - Intronic
1060117074 9:120950418-120950440 GGCCCTAATTGGCAGTGATTTGG - Intergenic
1187203158 X:17155409-17155431 TCCCCAAAGTGGCAGTGTTGAGG - Intergenic
1195283209 X:103357147-103357169 TCACCTACCTGGCACTGATCGGG - Exonic
1195577650 X:106468614-106468636 TCTCCTCAGCGGCAGTGATCTGG - Intergenic