ID: 1183771340

View in Genome Browser
Species Human (GRCh38)
Location 22:39928554-39928576
Sequence CCTACTGTGTTGGGTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183771335_1183771340 -4 Left 1183771335 22:39928535-39928557 CCTGGCATTTATGGAGGAGCCTA 0: 1
1: 0
2: 2
3: 5
4: 93
Right 1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG 0: 1
1: 0
2: 0
3: 10
4: 129
1183771334_1183771340 -3 Left 1183771334 22:39928534-39928556 CCCTGGCATTTATGGAGGAGCCT 0: 1
1: 1
2: 0
3: 10
4: 117
Right 1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG 0: 1
1: 0
2: 0
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183771340 Original CRISPR CCTACTGTGTTGGGTGCTAT GGG Intronic
902854630 1:19192284-19192306 CCTACTGCGTTGGCTGATAAGGG - Exonic
903073566 1:20743537-20743559 CCTCCTGAGTTGGGTCCTACAGG - Exonic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
908891357 1:68852106-68852128 CATACTATTTTGGTTGCTATAGG + Intergenic
917602685 1:176593796-176593818 CGTACTGCGGTGGGTGGTATTGG + Intronic
918364517 1:183793048-183793070 CATACTGTTTTGGTTACTATAGG - Intronic
919225701 1:194698123-194698145 TCTTCTGGGTTGAGTGCTATTGG + Intergenic
919561405 1:199124611-199124633 CCTGCAGTGTTGGCTGCTAATGG - Intergenic
920049669 1:203155832-203155854 CCTGCTGTGCTGGGAGCTGTAGG - Intronic
920642718 1:207769306-207769328 CCTCCTGAGTTGAGTGCTGTAGG + Intronic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
921838586 1:219804101-219804123 GCTAGTGTGTAGGGTGCTTTGGG - Intronic
923729937 1:236540397-236540419 GCTAGTGTTTTGGGTGCTTTCGG + Intronic
924638288 1:245809386-245809408 CCAACTGAGGTGGGTGCTATTGG - Intronic
1063775696 10:9261201-9261223 GCTAATGTGTTGGATGTTATGGG + Intergenic
1064644888 10:17450930-17450952 CCCACTGTGTTGCCTGCCATAGG - Intronic
1069912010 10:71765579-71765601 CCTACTGCTGCGGGTGCTATGGG - Intronic
1072692609 10:97581672-97581694 CTCACTGTGTTGGGGGCTTTGGG + Intronic
1075038307 10:119087637-119087659 CCCACTGTTTTCAGTGCTATGGG - Intergenic
1075092244 10:119450367-119450389 CCAACTGTTTTGTGTGCCATGGG - Intronic
1075171040 10:120114868-120114890 TCTACTTTCCTGGGTGCTATAGG + Intergenic
1078494505 11:11802360-11802382 TCTACTGTGTTGTGAGATATTGG + Intergenic
1080767179 11:35307754-35307776 CCTACTGTGCTGGTTCCCATAGG + Intronic
1084864546 11:72045128-72045150 CCTAGTGTGCTAGGTGTTATGGG - Intronic
1087348162 11:96997575-96997597 GCTAATGTGTTGGGGGCTGTTGG + Intergenic
1091105867 11:132919357-132919379 CCTACTGAGTTGGAAGCTCTGGG + Intronic
1094229423 12:28085799-28085821 CCTGGTGTCCTGGGTGCTATAGG + Intergenic
1097069287 12:56343127-56343149 CCTGCTGTGCTGGGAGGTATAGG - Exonic
1098593502 12:72242514-72242536 CCCTCTGTTTTGGGTGCTGTAGG + Intronic
1101657456 12:106735732-106735754 AGTCCTGTGCTGGGTGCTATGGG + Intronic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1108878778 13:55082909-55082931 CGTGCTGTTTTGGTTGCTATAGG + Intergenic
1112300967 13:98229871-98229893 TCTACTGTATTGGCTGTTATGGG + Intronic
1114286280 14:21246781-21246803 CTTACTGTCTTGGGTGGTTTAGG - Intronic
1115662802 14:35513271-35513293 TCAACTGTTTTAGGTGCTATGGG + Intergenic
1119627084 14:76187305-76187327 CCTACTGTGTTGTGAGCTCCTGG + Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1127281470 15:57497080-57497102 CCTGCTGTGTTTGGCGGTATGGG + Intronic
1133196861 16:4177239-4177261 CTGTCTGTGTTGGGTGTTATGGG + Intergenic
1136485731 16:30570889-30570911 TCAACTGTGTTGGGTACTAGAGG - Intronic
1138236351 16:55386451-55386473 CCTGCTGTGCTAGGTGCTCTGGG - Intergenic
1140984970 16:80149749-80149771 CTGAGTGTGTTAGGTGCTATAGG + Intergenic
1143879553 17:10019604-10019626 CCCACTGTGCTGGGTGGTAGGGG - Intronic
1147963920 17:44183158-44183180 CCTCCTGTGATAGGTACTATAGG - Intergenic
1151971637 17:77460473-77460495 CCCACTGTGCTGGGTGACATAGG - Intronic
1152153562 17:78618034-78618056 CTGACTGTGTTGGATGATATCGG + Intergenic
1153334790 18:3912294-3912316 CCTACTGTGTTAAGTTCTGTGGG + Intronic
1155237905 18:23840040-23840062 CCTACTGAGTTGGAAGCTCTGGG + Intronic
1156687637 18:39669221-39669243 CCCACTGTGTTGGATGGGATGGG - Intergenic
1157919344 18:51698967-51698989 GGTAATGTGTTGGGTACTATGGG - Intergenic
1160212880 18:76897655-76897677 AGTACTGTGTTTGGTACTATGGG - Intronic
1162418999 19:10555198-10555220 GCCCCTGTGTTGGGTGCTCTGGG + Intronic
1163697659 19:18772135-18772157 CCTACGGTGCTGGGTGCAACAGG - Intronic
1168242932 19:55096261-55096283 CCTTCTGTGTTTGCTGCTAGAGG + Exonic
928336586 2:30403813-30403835 ACTATTGTGCTAGGTGCTATTGG - Intergenic
928345191 2:30486918-30486940 CATTATGTGTTTGGTGCTATTGG + Intronic
928951082 2:36813505-36813527 CCAACACTGTTGGGTGCTACAGG - Intronic
936019678 2:108985354-108985376 CCTACTGTGTTTGGAGCAGTAGG + Intronic
939378614 2:141404187-141404209 CCTACAGTATTGCATGCTATTGG - Intronic
941603872 2:167571541-167571563 CCCTCTGTGTGAGGTGCTATGGG - Intergenic
946511982 2:220367770-220367792 CCGACTGAGGTGGGTGCTAGAGG - Intergenic
1173036385 20:39415113-39415135 CCTTCTGTGCTGGGTCCTTTTGG + Intergenic
1174447895 20:50602617-50602639 CCTGCTGTGTTGGCTGCTGTAGG + Exonic
1175389016 20:58614694-58614716 CCTACTGCCTTCGGTGCCATTGG - Intergenic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1184790699 22:46698036-46698058 CCTGCCGTGTTGGATGCTCTGGG + Intronic
1184915364 22:47565163-47565185 CATCCTGTGTTGGGTGCTGAGGG + Intergenic
1185109578 22:48893615-48893637 TCTACTGTGCTGGGTGGTGTCGG + Intergenic
1185126617 22:49014733-49014755 CCTTCTGTGCTGGGAGCTCTGGG - Intergenic
950211335 3:11125809-11125831 TCATCTGTGATGGGTGCTATTGG - Intergenic
950267307 3:11583850-11583872 CCTCCTGGGTTGGGTGCGTTGGG - Intronic
950350777 3:12349748-12349770 CAGAATGTGGTGGGTGCTATAGG + Intronic
950473124 3:13198762-13198784 CTTGCTGTGTTGGGTGCTTTGGG - Intergenic
953143264 3:40249050-40249072 TCTACTGTGATAGGAGCTATAGG - Intronic
957889023 3:86330918-86330940 CCTACTGATTTGGCTGCAATTGG - Intergenic
963941551 3:151100849-151100871 TCCACTGTGTTAGGTGATATGGG + Intronic
966668291 3:182497460-182497482 CCTCCTGTGTTGTGTGCAGTAGG - Intergenic
966691281 3:182744184-182744206 CCTCTAGTGCTGGGTGCTATGGG + Intergenic
966863332 3:184242526-184242548 CTTGCTGTGTTGGGTGCTCTTGG + Exonic
967609985 3:191492857-191492879 ACTACTGTGTTTGGTTCTATAGG + Intergenic
968791150 4:2663267-2663289 CCTGCTGTGTTGGGTAGGATGGG - Exonic
969051643 4:4377459-4377481 CGAACTGGATTGGGTGCTATGGG - Intronic
969854769 4:9990365-9990387 GCTGCTGTGTTGGGTGCTAGGGG + Intronic
970773451 4:19643305-19643327 CTTATTGTGTTGGTTACTATAGG + Intergenic
972042482 4:34621171-34621193 CCAACTGGATTGTGTGCTATTGG + Intergenic
972582037 4:40403604-40403626 CCTACTGTGTTACCTGCTATAGG + Intergenic
976407980 4:84680977-84680999 CCTACTCAGTAGGGGGCTATTGG + Intronic
977819828 4:101458614-101458636 CCTGCTCTGTGGGGAGCTATGGG - Intronic
982040004 4:151388016-151388038 CCTATTGTTATTGGTGCTATTGG - Intergenic
983888292 4:173005082-173005104 CCTCCTGTGTTGGGAGCTGGGGG + Intronic
984232529 4:177115863-177115885 TCTTCTGTGTTGATTGCTATGGG + Intergenic
985560168 5:581581-581603 CCTACTGTATTGGGCTCCATAGG + Intergenic
986178920 5:5375733-5375755 CTTGCTGTGTTGGATGCTCTTGG + Intergenic
987584147 5:19832905-19832927 CCTGCTGTTTTGGTTACTATAGG + Intronic
991517676 5:67456940-67456962 CCTACAGTGTTGAGTTCTGTTGG - Intergenic
992203900 5:74411200-74411222 CCTACTGTGATTCTTGCTATGGG - Intergenic
993331083 5:86600859-86600881 CATACTGTCTTGGTTGCTATAGG - Intergenic
998058751 5:139102653-139102675 TTTTCTGTCTTGGGTGCTATGGG - Intronic
1000655931 5:163877745-163877767 GATACTGTTTTGGGTGCTAAAGG - Intergenic
1002877528 6:1224848-1224870 CCTACTGAGTTGTGTGATCTTGG - Intergenic
1003368244 6:5498036-5498058 CCTACTGTGCTGGGGGCCCTGGG + Intronic
1005066348 6:21821545-21821567 CCCACTGTGGTGGGTAGTATGGG - Intergenic
1006803050 6:36771612-36771634 GGCACTGTGTTGGGTGCTGTGGG - Intronic
1009953632 6:70425002-70425024 CTTACTGAGTTAGGTGGTATGGG + Intronic
1013471155 6:110467515-110467537 CACACTGTGCTGGGTGCTACAGG - Intronic
1013633231 6:112005265-112005287 CCTCTTGTGTTGGGTGGTGTTGG + Intergenic
1015263383 6:131263861-131263883 GCTACTGTGGTGTGTGCTTTGGG + Intronic
1020013260 7:4817666-4817688 CCTGCTATGTTGGGTGCAGTTGG - Intronic
1021008860 7:15437251-15437273 CCAACTGTATTTGCTGCTATAGG - Intronic
1021064384 7:16155481-16155503 CTTACTGTGTTGGGTGGCAGAGG - Intronic
1022799158 7:33759192-33759214 TCTAAGGTGTTGGGTGCCATTGG - Intergenic
1023836684 7:44072776-44072798 CCTACTGTCTGGTGTGCTGTAGG - Exonic
1026194474 7:68161039-68161061 CCCACTGAGTTGAGTGTTATTGG + Intergenic
1028300964 7:89200323-89200345 CTTACTGTGTTAGGGGCTATAGG - Intronic
1033426967 7:141253313-141253335 CCCACTGTGTTGGGTCCTGATGG + Intronic
1034854289 7:154526462-154526484 GGTACTGTGTTGGATGCTGTGGG - Intronic
1038598548 8:28913664-28913686 AGAACTGTGCTGGGTGCTATGGG - Intronic
1042499465 8:69492535-69492557 GCTACTGTGTCGGGTGCTCAGGG + Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1053002709 9:34586066-34586088 CCTACTGTGTGGGCTCCCATGGG + Intronic
1053528937 9:38858904-38858926 CCTACTGTGTTCTGTGTTCTAGG + Intergenic
1054201165 9:62083339-62083361 CCTACTGTGTTCTGTGTTCTAGG + Intergenic
1054637194 9:67505025-67505047 CCTACTGTGTTCTGTGTTCTAGG - Intergenic
1055971898 9:81919943-81919965 TGTACTGTGTTGGGAGGTATAGG + Intergenic
1055973651 9:81935015-81935037 TGTACTGTGTTGGGAGGTATAGG + Intergenic
1056583826 9:87915094-87915116 TCTTCTGTGTGGGGTGATATGGG + Intergenic
1056584318 9:87918563-87918585 TCTTCTGTGTGGGGTGATATGGG + Intergenic
1056612551 9:88134359-88134381 TCTTCTGTGTGGGGTGATATGGG - Intergenic
1056613043 9:88137827-88137849 TCTTCTGTGTGGGGTGATATGGG - Intergenic
1056664887 9:88573472-88573494 CATACTATCTTGGGTGATATTGG + Intronic
1058611548 9:106781739-106781761 CCTACTGTTATTGCTGCTATGGG + Intergenic
1187373470 X:18729540-18729562 CCTACTGGTTAGGTTGCTATGGG + Intronic
1188447568 X:30272135-30272157 GATACTGTGTTTGGTGCTGTTGG - Intergenic
1191047144 X:56150599-56150621 CCTGCTGTGTTGGATGCTCTTGG + Intergenic
1193390172 X:80917063-80917085 CATACTGTTTTGATTGCTATAGG - Intergenic
1197151253 X:123222237-123222259 AGTACTGTGCTGGATGCTATGGG - Intronic
1197436984 X:126442032-126442054 CATACTGTTTTGCTTGCTATAGG + Intergenic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1199601616 X:149544531-149544553 CGTACTGGGCTGGGTGCTCTTGG + Intronic
1199648760 X:149934952-149934974 CGTACTGGGCTGGGTGCTCTTGG - Intronic