ID: 1183773226

View in Genome Browser
Species Human (GRCh38)
Location 22:39944872-39944894
Sequence ATTCACCTTAATAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183773226_1183773228 -9 Left 1183773226 22:39944872-39944894 CCATCCTGCTTATTAAGGTGAAT 0: 1
1: 0
2: 2
3: 13
4: 330
Right 1183773228 22:39944886-39944908 AAGGTGAATTTGCATACAAATGG 0: 1
1: 0
2: 1
3: 19
4: 263
1183773226_1183773229 -8 Left 1183773226 22:39944872-39944894 CCATCCTGCTTATTAAGGTGAAT 0: 1
1: 0
2: 2
3: 13
4: 330
Right 1183773229 22:39944887-39944909 AGGTGAATTTGCATACAAATGGG 0: 1
1: 0
2: 1
3: 15
4: 201
1183773226_1183773230 -1 Left 1183773226 22:39944872-39944894 CCATCCTGCTTATTAAGGTGAAT 0: 1
1: 0
2: 2
3: 13
4: 330
Right 1183773230 22:39944894-39944916 TTTGCATACAAATGGGACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 115
1183773226_1183773231 7 Left 1183773226 22:39944872-39944894 CCATCCTGCTTATTAAGGTGAAT 0: 1
1: 0
2: 2
3: 13
4: 330
Right 1183773231 22:39944902-39944924 CAAATGGGACCTTGGTCTTCAGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183773226 Original CRISPR ATTCACCTTAATAAGCAGGA TGG (reversed) Intronic
901293759 1:8145010-8145032 CTTCACCTTGTTAACCAGGATGG - Intergenic
902780156 1:18699756-18699778 TTTCACCTTATTAGCCAGGATGG + Intronic
903687320 1:25141327-25141349 TTTCACCTTGTTAACCAGGATGG - Intergenic
903880986 1:26509090-26509112 TTTCACCTTGTTAACCAGGATGG + Intergenic
904188082 1:28721562-28721584 TTTCACCGTATTAACCAGGATGG - Intergenic
906005874 1:42469659-42469681 ATTAACCTTGATCAGGAGGATGG + Intronic
906037496 1:42760848-42760870 ATTCACCATGTTAGGCAGGACGG + Intronic
906584147 1:46961637-46961659 AGGCACCTTGATAAGCAGGGTGG - Intergenic
906717912 1:47984118-47984140 AATAACCTTAATAGGGAGGAAGG + Intronic
909132057 1:71750188-71750210 TTTCACCTTGTTAACCAGGATGG + Intronic
910180855 1:84481060-84481082 ATTCAACTTAAATATCAGGAGGG - Intronic
910251833 1:85205668-85205690 TTTCACCGTATTAACCAGGATGG - Intergenic
910462891 1:87467407-87467429 TTTCACCATATTAACCAGGATGG - Intergenic
912754254 1:112311189-112311211 ATTCACAATAATAATCAGAAGGG + Intergenic
913548605 1:119894880-119894902 AATGACGTTTATAAGCAGGATGG - Exonic
913589727 1:120311811-120311833 TTTCACCGTGTTAAGCAGGATGG + Intergenic
913618458 1:120586555-120586577 TTTCACCGTGTTAAGCAGGATGG - Intergenic
915133009 1:153709205-153709227 TTTCACCGTGTTAAGCAGGATGG + Intergenic
916318256 1:163474222-163474244 TTTCACCTTGTTAACCAGGATGG + Intergenic
918138970 1:181704059-181704081 ATTGACTCTAATAAGCAGGATGG - Intronic
919468171 1:197947133-197947155 ATTCTCCCAAATGAGCAGGATGG + Intergenic
919921193 1:202167580-202167602 TTTCACCATAATAGCCAGGATGG + Intergenic
921222475 1:212982889-212982911 ATTCAGCTTAATGAGTAGGCAGG + Intronic
922458865 1:225799391-225799413 TTTCACCTTATTAGCCAGGATGG + Intergenic
923692604 1:236210290-236210312 ATTTTCCTTACTAAGAAGGAAGG - Intronic
923992238 1:239451678-239451700 ATTTAACTTAATAACCAGTAGGG + Intronic
924837272 1:247663643-247663665 TTTCACCGTGTTAAGCAGGATGG - Intergenic
1063185222 10:3644431-3644453 ATTCTCAGTAATAACCAGGAGGG - Intergenic
1063211856 10:3887971-3887993 ATTCCCCTTAGTGAGAAGGACGG - Intergenic
1064357447 10:14632412-14632434 ATTCACCGTGTTAATCAGGATGG - Intronic
1065202749 10:23330541-23330563 TTTCACCTTGTTAGGCAGGATGG - Intronic
1065332076 10:24612655-24612677 TTTCACCGTATTAACCAGGATGG - Intronic
1066419777 10:35254072-35254094 TTTCACCGTATTAACCAGGATGG + Intronic
1067813206 10:49447488-49447510 TTTCACCATATTAACCAGGATGG - Intergenic
1068890222 10:62140908-62140930 TTTCACCTTGTTAACCAGGATGG + Intergenic
1069443188 10:68447784-68447806 TTTCACCTTATTAGCCAGGATGG - Intronic
1069518313 10:69097622-69097644 TTTCACCTTATTAGCCAGGATGG + Intronic
1071792405 10:88969024-88969046 ATCCTCCTAAATAAGAAGGAAGG + Intronic
1074117677 10:110469500-110469522 TTTCACCATATTAACCAGGATGG + Intergenic
1075314446 10:121440924-121440946 TTTCACCATATTAGGCAGGATGG - Intergenic
1078290253 11:10003562-10003584 TTTCACCGTGTTAAGCAGGATGG + Intronic
1079378937 11:19919631-19919653 ATTCTCTTTCATAAGCAAGATGG - Intronic
1079694044 11:23456446-23456468 TTTCACCTTGTTAACCAGGATGG - Intergenic
1080082831 11:28241334-28241356 CTTCACCTTATTAGCCAGGATGG - Intronic
1080478804 11:32624134-32624156 TTTCACCTTATTAGACAGGATGG - Intronic
1080866390 11:36199095-36199117 TTTCACCTTATTAGCCAGGATGG + Intronic
1081092264 11:38887098-38887120 ATCCACTTTAATAAGCTGCATGG - Intergenic
1082723169 11:56704569-56704591 ATAGACCTTCCTAAGCAGGAGGG - Intergenic
1083562077 11:63681200-63681222 ATTCACATAAAGAGGCAGGAGGG + Intergenic
1083619929 11:64044008-64044030 ATTCACCATGTTAGGCAGGATGG + Intronic
1085110410 11:73882798-73882820 TTTCACCGTGTTAAGCAGGATGG + Intronic
1087355067 11:97082609-97082631 AATCACCTTTATAAGAAAGAAGG + Intergenic
1087417191 11:97871971-97871993 ATTCTCCTTAAGCAGAAGGAAGG + Intergenic
1088060644 11:105645101-105645123 ATGCAGCTTCATAATCAGGAAGG + Intronic
1089022655 11:115232909-115232931 ATTCAACTTGATCATCAGGATGG - Intronic
1090332480 11:125942733-125942755 ATTCAACTTAAAGAGAAGGAGGG + Intergenic
1090689868 11:129169432-129169454 TTTCACCGTATTAGGCAGGATGG - Intronic
1091765398 12:3117033-3117055 CTTCACCTTTACAAGCAGGATGG + Intronic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1093874004 12:24327787-24327809 TTTCACCATATTAACCAGGATGG + Intergenic
1096220444 12:49825714-49825736 CTTCACCTTCATAGGCAGCAGGG + Intronic
1097337755 12:58403364-58403386 AGTCAAGATAATAAGCAGGATGG - Intergenic
1098547329 12:71726339-71726361 TTTCACCATATTAGGCAGGATGG - Intergenic
1098612540 12:72478390-72478412 AATAGCCTTAAAAAGCAGGAGGG - Intronic
1099018806 12:77377992-77378014 TTTCACCTTATTAGCCAGGATGG - Intergenic
1099187587 12:79532825-79532847 TTTCACCTTATTAGCCAGGATGG + Intergenic
1099341266 12:81437955-81437977 ATTCAGCTTAGTAAACAGGATGG - Intronic
1102176725 12:110881234-110881256 ATTCAGCTTGACGAGCAGGAAGG - Exonic
1102310966 12:111844017-111844039 TTTCACCGTAATAGCCAGGATGG + Intronic
1102483267 12:113238594-113238616 CTTCAGCTAAATAAACAGGAAGG - Intronic
1102862848 12:116351487-116351509 TTTCACCGTATTATGCAGGATGG - Intergenic
1103086497 12:118065157-118065179 AATATCCTTAAGAAGCAGGAAGG + Exonic
1103452857 12:121041700-121041722 TTTCACCGTATTAACCAGGATGG - Intergenic
1103455725 12:121063771-121063793 TTTCACCTTGTTAACCAGGATGG - Intergenic
1104096265 12:125560623-125560645 TTTCACCTTATTAGCCAGGATGG - Intronic
1105708594 13:22983741-22983763 TTTCACCTTGTTAACCAGGATGG + Intergenic
1105814468 13:24021906-24021928 TTTCACCGTATTAGGCAGGATGG + Intronic
1107226624 13:38056913-38056935 ATACACCTAAATAAGAAGAAAGG - Intergenic
1108667315 13:52645541-52645563 TTTCACCTTGTTAACCAGGATGG - Intergenic
1109779096 13:67084091-67084113 ATGCACCATAAGAAGCAAGAAGG + Intronic
1111252958 13:85628693-85628715 ATTCACCGTATTAGCCAGGATGG + Intergenic
1111279735 13:86005688-86005710 TTTCACCGTATTAACCAGGATGG - Intergenic
1111544303 13:89710399-89710421 ATTCACATCAATACTCAGGAAGG - Intergenic
1111580306 13:90214009-90214031 TTTCACCATATTAGGCAGGATGG + Intergenic
1113139329 13:107129410-107129432 ATTCTCCTTAATAACATGGAAGG + Intergenic
1113961114 13:114126613-114126635 CTACACTTTAATAAGTAGGAGGG - Intronic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114241344 14:20871272-20871294 AGTAACCTTGATTAGCAGGAGGG + Intergenic
1114984976 14:28216035-28216057 ATTTACCTTAAAAAGGAGGAAGG - Intergenic
1115258342 14:31426788-31426810 TTTCACCTTGAAAGGCAGGAAGG + Intronic
1115655325 14:35438310-35438332 TTTCACCTTATTAGCCAGGATGG - Intergenic
1116813352 14:49560933-49560955 TTTCACCTTATTAGCCAGGATGG + Intergenic
1117983832 14:61367909-61367931 TTTCACCTTGCTAACCAGGATGG + Intronic
1118570726 14:67192143-67192165 ATTCATCTAATTAAGCAGGCAGG - Intronic
1120382716 14:83801945-83801967 TTTCACCGTGATAGGCAGGATGG + Intergenic
1120403941 14:84070490-84070512 TTTCACCATATTAACCAGGATGG + Intergenic
1120849194 14:89154070-89154092 ATTCACATTATAAAACAGGAAGG - Intronic
1121817871 14:96942322-96942344 TTTCACCCTAATGAGCAGGGAGG + Intergenic
1122222374 14:100248317-100248339 TTTCACCGTATTAACCAGGATGG + Intronic
1123670652 15:22653676-22653698 TTTCACCGTATTAGGCAGGATGG + Intergenic
1123737015 15:23195426-23195448 TTTCACCGTATTAGGCAGGATGG - Intergenic
1123851572 15:24362393-24362415 TTTCACCTTGTTAGGCAGGATGG + Intergenic
1124234792 15:27980322-27980344 TTTCACCTTGTTAACCAGGATGG + Intronic
1124287713 15:28418402-28418424 TTTCACCGTATTAGGCAGGATGG - Intergenic
1124288234 15:28424103-28424125 TTTCACCGTATTAGGCAGGATGG - Intergenic
1124294247 15:28486792-28486814 TTTCACCGTATTAGGCAGGATGG + Intergenic
1124294991 15:28493224-28493246 TTTCACCGTATTAGGCAGGATGG + Intergenic
1124815016 15:32981292-32981314 TTTCACCTTATTAACCAGGATGG - Intronic
1125471626 15:40010041-40010063 ATTTGCCTTAATAAGTAGGTTGG - Intronic
1125594864 15:40878300-40878322 ATTCACCTTGTTAGCCAGGATGG + Intergenic
1126616383 15:50585256-50585278 TTTCACCTTGTTAACCAGGATGG + Intronic
1126622577 15:50654798-50654820 TTTCACCTTATTAGCCAGGATGG - Intronic
1126731325 15:51686182-51686204 ATACCCCTTCATGAGCAGGAGGG + Intronic
1126949678 15:53867715-53867737 AATCATATTAATAGGCAGGAAGG - Intergenic
1127307739 15:57724513-57724535 TTTCACCTTGTTAACCAGGATGG - Intronic
1127367181 15:58302080-58302102 ATTCACCTGAAAAAGAGGGAGGG + Intronic
1128018068 15:64365197-64365219 TTTCACCTTGTTAGGCAGGATGG + Exonic
1128698141 15:69784250-69784272 TTTCACCGTATTAACCAGGATGG + Intergenic
1130018742 15:80209249-80209271 ATTAACCTTAATTACCAGGCAGG + Intergenic
1130211581 15:81927663-81927685 TTTCACCTTATTAGCCAGGATGG - Intergenic
1132525635 16:413079-413101 TTTCACCATAATAGCCAGGATGG + Intergenic
1133380994 16:5330359-5330381 AGTCATCTTAAAAAGCAAGAGGG - Intergenic
1133414650 16:5596887-5596909 GTTCACTTCAATAAGCTGGAGGG + Intergenic
1133503534 16:6388161-6388183 TTTCACCTTGTTAACCAGGATGG + Intronic
1133514947 16:6499606-6499628 ATTCAGCTTAAAAATCAGTAGGG + Intronic
1134086942 16:11363749-11363771 ATTCACCGTGTTAACCAGGATGG - Intronic
1134303425 16:13011716-13011738 TTTCACCGTATTAACCAGGATGG + Intronic
1135772124 16:25225604-25225626 TTTCACCGTATTAGGCAGGATGG + Intronic
1136125487 16:28176703-28176725 TTTCACCTTATTAGCCAGGATGG + Intronic
1136681980 16:31972769-31972791 GTTCACCTTGATAACTAGGATGG + Intergenic
1136782287 16:32914271-32914293 GTTCACCTTGATAACTAGGATGG + Intergenic
1136887499 16:33939580-33939602 GTTCACCTTGATAACTAGGATGG - Intergenic
1138911531 16:61405559-61405581 ATTATCATTAATGAGCAGGAGGG - Intergenic
1141184327 16:81776304-81776326 TTTCACCATGTTAAGCAGGATGG + Intronic
1203084952 16_KI270728v1_random:1178258-1178280 GTTCACCTTGATAACTAGGATGG + Intergenic
1143196761 17:5081796-5081818 TTTCACCGTAATAGGCAGGATGG + Intronic
1143262928 17:5613828-5613850 ATCCACCTTAGGAAGCAGTAAGG + Intronic
1145719535 17:27057207-27057229 TTTCACCTTATTAGCCAGGATGG - Intergenic
1145949951 17:28809050-28809072 ACTCACAGAAATAAGCAGGATGG + Intronic
1147577032 17:41608501-41608523 TTTCACCTTATTAGCCAGGATGG - Intergenic
1147665515 17:42144729-42144751 TTTCACCTTGTTAGGCAGGATGG - Intronic
1147694915 17:42344517-42344539 TTTCACCTTGTTAGGCAGGATGG - Intronic
1147729983 17:42593450-42593472 TTTCACCATATTAACCAGGATGG - Intronic
1150395400 17:64817518-64817540 TTTCACCGTATTAACCAGGATGG + Intergenic
1152872230 17:82761922-82761944 TTTCACCTTGTTAACCAGGATGG + Intronic
1153254476 18:3156804-3156826 ATTCACCGTATTAGCCAGGATGG + Intronic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154029483 18:10740262-10740284 ATTCATCTTTATGATCAGGAGGG + Intronic
1154307001 18:13237959-13237981 ATTGACCTTAAGAACCAGGGTGG - Intronic
1155130244 18:22927419-22927441 ATTTACTTAAAGAAGCAGGATGG - Intronic
1156375218 18:36508799-36508821 ATTCTACCTAATAAGCAAGAGGG + Intronic
1156606031 18:38668455-38668477 TTTCACCTTGTTAACCAGGATGG - Intergenic
1158216468 18:55105101-55105123 ATTCACCGTATTAGCCAGGATGG + Intergenic
1159192360 18:65062718-65062740 TTTCACCTTGTTAACCAGGATGG - Intergenic
1159271194 18:66153094-66153116 AGTCACCAAAACAAGCAGGAAGG - Intergenic
1159687929 18:71446763-71446785 TTTCACCATATTAACCAGGATGG - Intergenic
1160338478 18:78065112-78065134 TTTCACCGTATTAACCAGGATGG - Intergenic
1161178624 19:2864323-2864345 ATGCAACTTGATAAGCAAGAAGG + Intergenic
1162368452 19:10263944-10263966 TTTCACCGTATTAACCAGGATGG - Intergenic
1163519871 19:17785634-17785656 TTTCACCATATTAACCAGGATGG - Intronic
1163950899 19:20584880-20584902 TTTCACCATACTAACCAGGATGG - Intronic
1165086839 19:33355072-33355094 TTTCACCGTATTAACCAGGATGG + Intergenic
1166227324 19:41404484-41404506 TTTCACCTTATTAGCCAGGATGG + Intronic
1166237118 19:41464702-41464724 ATTCTCCTTAATATCCAGGAGGG - Intergenic
1167044815 19:47043390-47043412 TTTCACCTTATTAGCCAGGATGG - Intronic
1168004646 19:53476857-53476879 TTTCACCTTGTTAACCAGGATGG + Intronic
926461725 2:13138220-13138242 ATTCTACTTGATAAGCAAGATGG + Intergenic
928356784 2:30623249-30623271 TTTCACCTTATTAGCCAGGATGG + Intronic
928572867 2:32626627-32626649 TTTCACCTTGTTAGGCAGGATGG + Intergenic
928789113 2:34929883-34929905 ACTAACCTTAATAAACTGGATGG + Intergenic
928789122 2:34930000-34930022 ATTAACCTTAATAAACTGGGTGG + Intergenic
930454755 2:51592775-51592797 TTTCACCTTGTTAACCAGGATGG - Intergenic
932849021 2:75165503-75165525 TTTCACCTTGTTAGGCAGGATGG + Intronic
932988053 2:76750833-76750855 TTTCCCCTTAATAAGCAGAGAGG - Intronic
935241719 2:101184310-101184332 TTTCACCATGATAACCAGGATGG - Intronic
935812558 2:106813398-106813420 ATTCAGCATAATAAGCAGAATGG + Intronic
935989817 2:108709213-108709235 AATCACCTTCACAAGAAGGAAGG + Intergenic
939424036 2:142010880-142010902 ATACACATTAATCACCAGGAAGG + Intronic
943188090 2:184639803-184639825 TTTCACCATATTAACCAGGATGG - Intronic
943482253 2:188434377-188434399 AGTCACCATAATAACCAAGAAGG - Intronic
944679170 2:202061331-202061353 ATTCACCCTATTAGCCAGGATGG - Intergenic
945706847 2:213245906-213245928 TTTCACCATATTAACCAGGATGG - Intergenic
947927850 2:233937337-233937359 ATTCTCCCTGATAAGCACGATGG - Exonic
1168954328 20:1824326-1824348 TTTGACCTTATTAAGCATGATGG - Intergenic
1170082271 20:12490257-12490279 ATTCAACTGAATAATTAGGAAGG + Intergenic
1170235653 20:14102197-14102219 TTTCACCATGATAACCAGGATGG + Intronic
1172451345 20:35026076-35026098 ATTGATCATAATAAGCATGAGGG + Intronic
1173101757 20:40094549-40094571 TTTCACCTTCTTAGGCAGGATGG + Intergenic
1173810963 20:45955151-45955173 TTTCACCATGTTAAGCAGGATGG - Intronic
1175431434 20:58907105-58907127 AACCACCTGAATAAACAGGAGGG + Intronic
1177345219 21:19858785-19858807 AATGACCTTAATAAGTAGGCAGG + Intergenic
1177697170 21:24588388-24588410 TTTCACCATAATAGCCAGGATGG + Intergenic
1177732906 21:25051992-25052014 TTTCACCTTGATAGCCAGGATGG - Intergenic
1178440257 21:32592843-32592865 TTTCACCATGTTAAGCAGGATGG + Intronic
1182957133 22:34436970-34436992 TTTCACCGTAATAGCCAGGATGG + Intergenic
1183549950 22:38476413-38476435 TTTCACCTTATTAGCCAGGATGG + Intronic
1183773226 22:39944872-39944894 ATTCACCTTAATAAGCAGGATGG - Intronic
1183865083 22:40698019-40698041 AATGACCATAATAACCAGGATGG + Intergenic
1185407990 22:50666585-50666607 ATTCACCGTGTTAACCAGGATGG + Intergenic
1185427467 22:50781141-50781163 CTTCACCTTATTAGCCAGGATGG - Intronic
950015707 3:9753453-9753475 TTTCACCGTATTAGGCAGGATGG - Intronic
950784227 3:15420055-15420077 TTTCACCATATTAACCAGGATGG + Intronic
951049340 3:18076996-18077018 TTTCACCATATTAACCAGGATGG + Intronic
951411903 3:22375988-22376010 TTTCACCTTGTTAACCAGGATGG + Intergenic
952014193 3:28937670-28937692 TTTCACCTTGTTAACCAGGATGG + Intergenic
953584673 3:44188873-44188895 TTTCACCATAATGATCAGGATGG + Intergenic
953595030 3:44303026-44303048 ATTCACCATATTAACCAGGCTGG + Intronic
956964009 3:74437259-74437281 ATTCACCATGATAACCAGGACGG - Intronic
957943416 3:87033976-87033998 ATTAACCTTAATTATCTGGATGG + Intergenic
958090003 3:88865286-88865308 TTTCACCGTATTAGGCAGGATGG - Intergenic
959656320 3:108809117-108809139 TTTCACCTTGAGAAGCAAGAAGG - Intergenic
960122773 3:113964546-113964568 GTGCACCTTGATAAGCATGAAGG - Exonic
960765818 3:121128634-121128656 AATTACCATAATAAGCAGCAAGG + Intronic
961268511 3:125669511-125669533 TTTCACCGTATTAGGCAGGATGG + Intergenic
961271528 3:125693055-125693077 ATTTTTCCTAATAAGCAGGACGG - Intergenic
964177788 3:153846116-153846138 TTTCACCTTATTATCCAGGATGG - Intergenic
964885487 3:161477430-161477452 TTTCACCTTATTAGCCAGGATGG + Intergenic
966025574 3:175276498-175276520 TTTCACCATATTAACCAGGATGG + Intronic
966641375 3:182194527-182194549 CTTCTCCTTAATAAACTGGAAGG + Intergenic
966881389 3:184353142-184353164 GTTCACCTGCATAGGCAGGAAGG + Exonic
967099739 3:186206598-186206620 TTTCACCTGATTAAGCAGGTGGG - Intronic
967200844 3:187071255-187071277 ATTCACCTTAAAAAGCAGGCGGG - Intronic
967370916 3:188744987-188745009 GTTCTCCCTAAAAAGCAGGAAGG - Intronic
967514240 3:190348044-190348066 TTTCACCTTGTTAACCAGGATGG - Intronic
967610784 3:191503854-191503876 TTTCACCTTGTTAACCAGGATGG - Intergenic
968243379 3:197114783-197114805 TTTCACCTTGTTAACCAGGATGG - Intronic
970167625 4:13256436-13256458 AATCACCTTAAGAGGCAGCAAGG + Intergenic
970203225 4:13630185-13630207 TTTCACCGTATTAACCAGGATGG - Intergenic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
971799292 4:31267546-31267568 TTTCACCTTATTAGCCAGGATGG + Intergenic
972145576 4:36020517-36020539 ATTCACGTTGAGAAGCAGAATGG + Intronic
973084954 4:46046868-46046890 ATACACGTTTTTAAGCAGGATGG - Intronic
973829217 4:54741704-54741726 ATTCACCTTATTAAGCAGGGAGG + Intergenic
974933088 4:68382573-68382595 TTTCACCTTATTAGCCAGGATGG - Intergenic
975326196 4:73061509-73061531 TTTCACCATATTAACCAGGATGG - Intronic
976809386 4:89084390-89084412 TTTCACCTTATTAGCCAGGATGG + Intronic
979601415 4:122590174-122590196 ATTGACCTTTATAAGAATGAAGG + Intergenic
980433087 4:132729031-132729053 TTTCACCTTGTTAGGCAGGATGG + Intergenic
981351170 4:143731376-143731398 AAACAACTTAATAAGCAAGAAGG + Intergenic
982487070 4:155978703-155978725 TTTCACCATATTAACCAGGATGG - Intergenic
983888014 4:173002595-173002617 TTTCACCTTATTAGCCAGGATGG - Intronic
984082268 4:175262123-175262145 TTTCACCATGATAACCAGGATGG + Intergenic
984477827 4:180259369-180259391 AATCATCTCAATAAGGAGGAGGG + Intergenic
985777967 5:1855105-1855127 ATTCCCTTTAATCTGCAGGAGGG + Intergenic
986794923 5:11200874-11200896 TTTCACCGTATTAACCAGGATGG + Intronic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
987782687 5:22459767-22459789 TTTCACCGTATTAACCAGGATGG - Intronic
988303087 5:29459084-29459106 TTTCACCTTGTTAACCAGGATGG + Intergenic
988327250 5:29786295-29786317 TTTCACCTTGTTAACCAGGATGG - Intergenic
988553884 5:32220212-32220234 TTTCACCGTATTAGGCAGGATGG + Intergenic
988726042 5:33927455-33927477 CTTCACCTGGTTAAGCAGGATGG - Intergenic
989330915 5:40257466-40257488 TTTCACCTTGTTAACCAGGATGG + Intergenic
990074466 5:51826325-51826347 TTTCACCTTATTAGCCAGGATGG + Intergenic
990761761 5:59137721-59137743 TTTCACCGTATTAACCAGGATGG + Intronic
990859001 5:60304446-60304468 TTTCACCTTGTTAACCAGGATGG - Intronic
991702413 5:69328988-69329010 TTTCACCGTGTTAAGCAGGATGG + Intronic
992526995 5:77621280-77621302 TTTCACCTTATTAGCCAGGATGG - Intergenic
994236617 5:97370016-97370038 ATTCAGCTCCATAAGCAGCAAGG + Intergenic
995726615 5:115187668-115187690 ATTGACTTTGAGAAGCAGGAAGG + Intergenic
997048541 5:130349992-130350014 TTTCACCTTGTTAATCAGGATGG - Intergenic
998151811 5:139761850-139761872 ACTCACCTTAAAAGGCAGGCAGG - Intergenic
1002641172 5:180631274-180631296 TTTCACCGTGTTAAGCAGGATGG - Intronic
1002845910 6:944119-944141 TTTCACCGTATTAGGCAGGATGG - Intergenic
1004138973 6:12997755-12997777 TTTCACCTTATTAGCCAGGATGG - Intronic
1004602063 6:17159848-17159870 ATTCATCTTAATAAAAAAGAAGG + Intergenic
1004694914 6:18024684-18024706 TTTCACCATATTAACCAGGATGG + Intergenic
1004960873 6:20786692-20786714 TTTCACCGTATTAACCAGGATGG + Intronic
1005297857 6:24444460-24444482 ATTCACCTTTATAATCTGGGAGG + Intronic
1006641696 6:35492613-35492635 AAGCACATTAATAAGCAGGGCGG - Intronic
1009562984 6:65273025-65273047 AGTCAATTTAATAATCAGGATGG + Intronic
1010176614 6:73035040-73035062 TTTCACCTTATTAGCCAGGATGG + Intronic
1011053498 6:83180203-83180225 ATTCCACTTTATAAGCAGGTTGG + Intronic
1012027875 6:94020687-94020709 TTTCACCATATTAGGCAGGATGG + Intergenic
1014073550 6:117211094-117211116 TTTCACCATATTAACCAGGATGG + Intergenic
1014672431 6:124322156-124322178 TTTCATCTTAATAAGCAAAAAGG - Intronic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1015676417 6:135754973-135754995 TTTCACCGTATTAACCAGGATGG + Intergenic
1016723012 6:147324466-147324488 TTTCACCATATTAACCAGGATGG + Intronic
1020200476 7:6075978-6076000 TTTCACCTTGTTAACCAGGAGGG - Intergenic
1020843218 7:13247866-13247888 TTTCACCATGATAATCAGGATGG - Intergenic
1021404044 7:20243450-20243472 TTTCACCGTATTAACCAGGATGG + Intergenic
1021422992 7:20466368-20466390 ATCCACCCTAATATCCAGGATGG + Intergenic
1021841741 7:24726624-24726646 TTTCACCATATTAACCAGGATGG - Intronic
1022641294 7:32186297-32186319 TTTCACCTTATTAGCCAGGATGG + Intronic
1024393455 7:48840628-48840650 TTTCACCATATTGAGCAGGATGG + Intergenic
1024615412 7:51107814-51107836 AATCTCCTTAATAAACAGGAAGG + Intronic
1024826355 7:53395268-53395290 TTTCACCTTGTTAACCAGGATGG + Intergenic
1025480840 7:60981028-60981050 ATTCACCATATTAGCCAGGATGG + Intergenic
1026212975 7:68323338-68323360 AAGCAACTTAATAAGCAAGAGGG - Intergenic
1026437361 7:70411217-70411239 ATTCTCCTTAAAAAGGAAGAAGG + Intronic
1026667915 7:72359776-72359798 ATTCACCGTGTTCAGCAGGATGG - Intronic
1026912741 7:74100932-74100954 TTTCACCATATTAGGCAGGATGG + Intronic
1027768855 7:82381113-82381135 TTTCACCGTGTTAAGCAGGATGG - Intronic
1028005930 7:85567355-85567377 TTTCACCTTGTTAACCAGGATGG + Intergenic
1029881923 7:103822715-103822737 TTTCACCTTGTTAACCAGGATGG - Intronic
1030230315 7:107201821-107201843 ATACAGATTAATAAGCAGTAAGG - Exonic
1030569382 7:111203185-111203207 AGTCACCTTAATAGGCAAGACGG + Intronic
1031108073 7:117570153-117570175 CTTCACCTTCATAAGGTGGATGG - Intronic
1031562761 7:123257929-123257951 TTTCACCTTGTTAACCAGGATGG - Intergenic
1031750145 7:125561942-125561964 ATTCACCGTATTAGCCAGGAAGG + Intergenic
1031754795 7:125625268-125625290 TTTCACCTTGTTAACCAGGATGG + Intergenic
1033396325 7:140977205-140977227 ATTCTGCTTTATAAACAGGATGG + Intergenic
1033896049 7:146071982-146072004 TTTCACCTTGTTAACCAGGATGG + Intergenic
1034438824 7:151076446-151076468 ATTCACTTAAATAAAAAGGAGGG - Exonic
1035450145 7:158972725-158972747 TTTCACCTTGTTAACCAGGAAGG + Intergenic
1035890089 8:3333787-3333809 ATACACCGTAAAAAGCAAGAAGG + Intronic
1036968190 8:13324369-13324391 TTTCACCGTATTAACCAGGATGG - Intronic
1037160200 8:15760454-15760476 ATACACCATAAAAAGCTGGATGG - Intronic
1038778840 8:30553971-30553993 TTTCACCATAATAGCCAGGATGG + Intronic
1039267161 8:35838232-35838254 ATACATCTTAATAAGTGGGATGG - Intergenic
1042682746 8:71404719-71404741 TTTCACCGTGTTAAGCAGGATGG - Exonic
1042900437 8:73720707-73720729 TTTCACCTTGTTAACCAGGATGG + Intronic
1043310755 8:78856620-78856642 AAGCACCTTAATACCCAGGAAGG + Intergenic
1043312427 8:78876878-78876900 CTTCTCCTTAAGAAGAAGGAAGG + Intergenic
1044824708 8:96184997-96185019 ATTCACCCTTCTCAGCAGGAAGG + Intergenic
1044889279 8:96815436-96815458 ATACAACTTAACAAGCAGAATGG + Intronic
1045910483 8:107401932-107401954 ATCCAACATAATAAGCATGAAGG - Intronic
1046883226 8:119333312-119333334 ATTCACCGTATTAGCCAGGATGG - Intergenic
1048078834 8:131102697-131102719 TTTCACCGTATTAACCAGGATGG + Intergenic
1051281716 9:15447969-15447991 ATTTACCTAATAAAGCAGGAGGG + Intronic
1052926782 9:34023845-34023867 TTTCACCTTATTAGCCAGGATGG - Intronic
1054828269 9:69595377-69595399 AATTCCATTAATAAGCAGGAAGG - Intronic
1054873461 9:70070855-70070877 ATTTACCTTAAAAAGGAGGGAGG - Intronic
1054900572 9:70364659-70364681 ATTCACCATGTTAACCAGGATGG + Intergenic
1055168520 9:73226024-73226046 TTTCACCATGTTAAGCAGGATGG - Intergenic
1055198501 9:73626510-73626532 TTTCACCATGTTAAGCAGGATGG + Intergenic
1055392003 9:75832991-75833013 TTTCACCGTATTAACCAGGATGG - Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1061129165 9:128698379-128698401 TTTCACCTTGTTAACCAGGATGG + Intergenic
1185666262 X:1767665-1767687 TTTCACCTTGTTAGGCAGGATGG - Intergenic
1185979483 X:4760892-4760914 ATTTACCTTGATAAACAGAATGG + Intergenic
1186213140 X:7271399-7271421 TTTCCCCATAATAAGTAGGATGG + Intronic
1186553658 X:10534029-10534051 ATACACCTTAAAAGGCAGGCAGG + Intronic
1187229293 X:17405454-17405476 ATTCAGTTTAATCATCAGGAGGG + Intronic
1191006659 X:55717411-55717433 ATTAACAATAAAAAGCAGGAAGG + Intergenic
1191831807 X:65423126-65423148 TTTCACCTTGTTAACCAGGATGG + Intronic
1192785185 X:74327944-74327966 TTTCACCTTATTAGCCAGGAAGG + Intergenic
1193223301 X:78952713-78952735 ATTCATCTTGAGCAGCAGGAAGG + Intronic
1193975958 X:88118853-88118875 TTTCACCTTGTTAACCAGGATGG - Intergenic
1195932283 X:110090510-110090532 TTTCACCATATTAACCAGGATGG + Intronic
1196198303 X:112858004-112858026 ATTCACCGTGATAGCCAGGATGG - Intergenic
1196623309 X:117848991-117849013 ATTCACCTTCCTCAGAAGGAAGG + Intergenic
1197526236 X:127567334-127567356 AATCTCCTGAATAAACAGGAAGG - Intergenic
1201586057 Y:15562659-15562681 TTTCCCCATAATAAGTAGGATGG + Intergenic
1201673244 Y:16549780-16549802 TTTCACCTTGTTAACCAGGATGG + Intergenic
1202018687 Y:20440463-20440485 TTTCACCTTATTAACCAGGATGG - Intergenic