ID: 1183773671

View in Genome Browser
Species Human (GRCh38)
Location 22:39948332-39948354
Sequence TTGGGGTCTTACGAAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183773664_1183773671 8 Left 1183773664 22:39948301-39948323 CCTGACCCAGGAAAACCTGTCTG 0: 1
1: 0
2: 3
3: 12
4: 200
Right 1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1183773670_1183773671 -7 Left 1183773670 22:39948316-39948338 CCTGTCTGTCACTGCTTTGGGGT 0: 1
1: 0
2: 1
3: 14
4: 176
Right 1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1183773666_1183773671 2 Left 1183773666 22:39948307-39948329 CCAGGAAAACCTGTCTGTCACTG 0: 1
1: 1
2: 1
3: 18
4: 174
Right 1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1183773663_1183773671 11 Left 1183773663 22:39948298-39948320 CCTCCTGACCCAGGAAAACCTGT 0: 1
1: 0
2: 2
3: 21
4: 233
Right 1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1183773665_1183773671 3 Left 1183773665 22:39948306-39948328 CCCAGGAAAACCTGTCTGTCACT 0: 1
1: 0
2: 1
3: 17
4: 191
Right 1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183773671 Original CRISPR TTGGGGTCTTACGAAGCTCC TGG Intronic
902618464 1:17636822-17636844 CTGAGGTCTTATGAAGCCCCAGG - Intronic
907850777 1:58252781-58252803 TTGGGGTCATTTGAAGCACCTGG - Intronic
914807493 1:151002305-151002327 TGGGGGACTGAGGAAGCTCCTGG + Exonic
921825689 1:219669579-219669601 TTGGGTTCTTACGAAGATCTGGG + Intergenic
1066543119 10:36470568-36470590 TTGGTATCTTAGGAAGGTCCTGG - Intergenic
1067323134 10:45241234-45241256 TTGGGGTCTTCCAGAGCCCCTGG - Intergenic
1076915682 10:133422196-133422218 TTGGGGTCTGAGTTAGCTCCTGG + Exonic
1081292104 11:41339013-41339035 TTGGGCTGTTAGGAAGCTTCTGG + Intronic
1088117143 11:106325476-106325498 TTGAGCACTTACTAAGCTCCAGG + Intergenic
1088923280 11:114277290-114277312 TTGGGGTCTTACGATAACCCTGG - Intronic
1089595648 11:119577956-119577978 CTGGGCTCTTCCGGAGCTCCTGG - Intergenic
1096192323 12:49628002-49628024 TTTGGGTCCTACCAGGCTCCAGG - Intronic
1104654009 12:130559710-130559732 ATGTGGTCTCACGGAGCTCCAGG - Intronic
1108609125 13:52067183-52067205 TTGGCCACTTAAGAAGCTCCAGG + Intronic
1110734677 13:78922462-78922484 TTTGGTTCTTCCGAAGCACCTGG + Intergenic
1111222917 13:85228252-85228274 TTGGGGTCTTGCTAAACTCCAGG - Intergenic
1122773226 14:104106325-104106347 TTGGCGTCTTGGGGAGCTCCTGG + Intronic
1128522665 15:68386025-68386047 TTGGGGTCTTCTGAAGATCATGG + Intronic
1132373965 15:101316242-101316264 TGGGGTTCTTTCTAAGCTCCTGG - Intronic
1132676532 16:1123498-1123520 TTGTGGTCTTCGGAAGCCCCTGG + Intergenic
1133918166 16:10127851-10127873 TTGGTGTCTTACTAAGCCCTGGG + Intronic
1137336955 16:47559110-47559132 TTGGGGCCTAAGGGAGCTCCTGG + Intronic
1138538661 16:57674594-57674616 CTGGGGTGCTAAGAAGCTCCTGG - Intronic
1138724519 16:59120905-59120927 TTGGGGACTTAGGAAATTCCTGG - Intergenic
1140048100 16:71456014-71456036 TTGGAGGCTTACTATGCTCCAGG - Intronic
1147245034 17:39114536-39114558 TTGGGGTCTTACGATCTTACAGG - Intronic
1154268104 18:12896694-12896716 GTGGGGACTGACGCAGCTCCGGG - Intronic
928248217 2:29650480-29650502 TTGGGGTCTTAAGACGTCCCGGG + Intronic
933756770 2:85645579-85645601 TTGGGATTTTAAAAAGCTCCCGG - Intronic
933767976 2:85723735-85723757 GTGGGGTCATAGGAGGCTCCTGG + Intergenic
933911322 2:86943087-86943109 GTGGGGACTGACGCAGCTCCGGG + Intronic
935775035 2:106465955-106465977 GTGGGGACTGACGCAGCTCCGGG - Intronic
935905033 2:107829941-107829963 GTGGGGACTGACGCAGCTCCGGG + Intronic
935991196 2:108720121-108720143 GTGGGGACTGACGCAGCTCCGGG + Intronic
936126812 2:109795024-109795046 GTGGGGACTGACGCAGCTCCGGG + Intronic
936217885 2:110576462-110576484 GTGGGGACTGACGCAGCTCCGGG - Intronic
936427226 2:112432560-112432582 GTGGGGACTGACGCAGCTCCGGG - Intronic
937038553 2:118802890-118802912 TTGGGGTCTTCCAAGGCTCTAGG - Intergenic
945920570 2:215750900-215750922 TTGGGGACCTTCAAAGCTCCTGG + Intergenic
1171994617 20:31722432-31722454 TGTGGGTCTTACGAAGGTCTGGG + Intronic
1175993943 20:62804238-62804260 TGGGGGCCTTACTCAGCTCCTGG - Intergenic
1176521182 21:7825754-7825776 TGGGGGCCTTACGGAACTCCAGG - Exonic
1178655202 21:34455766-34455788 TGGGGGCCTTACGGAACTCCAGG - Intergenic
1179525726 21:41974708-41974730 CTGGGCTCTTACGAAACTGCAGG - Intergenic
1180214131 21:46314098-46314120 TTGGGGCCTTAAGCATCTCCTGG + Intronic
1181374579 22:22446625-22446647 TTGGCCTCTTAGGAAGCTGCAGG - Intergenic
1183773671 22:39948332-39948354 TTGGGGTCTTACGAAGCTCCTGG + Intronic
1184074501 22:42167606-42167628 TTGGGGTCTCTAGAAGCTGCAGG - Intronic
1185372026 22:50465388-50465410 TTGGGGTGTGGAGAAGCTCCTGG - Intronic
949275958 3:2281495-2281517 TTGTGGTCTTACACTGCTCCTGG + Intronic
949313475 3:2726153-2726175 TGGGAGTCTTTGGAAGCTCCAGG + Intronic
952485003 3:33800820-33800842 TTGGGGTCTTCAGAAGCACTTGG + Intronic
952979825 3:38725740-38725762 TGGGGCTCTTAGGGAGCTCCAGG - Intronic
955408325 3:58639808-58639830 GTGGGGTCTTATGAAGCCCTGGG + Intronic
956409001 3:68959308-68959330 GTGGGGGCTTAAGAAGCTGCTGG - Intergenic
962981221 3:140491992-140492014 TTTGGGTCTTTTGAAGGTCCAGG - Intronic
965922428 3:173933573-173933595 TTGGGGTCTTCCCAAGTACCAGG - Intronic
971162901 4:24151929-24151951 TTGTGGTCTTAGGAAGCATCTGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980984122 4:139678937-139678959 TTGTGGTCTCACAAGGCTCCAGG - Intronic
993447847 5:88036760-88036782 GTGGGGTCTTACAAAGAACCTGG - Intergenic
994658709 5:102627170-102627192 TTGGGGTCCTATGGACCTCCAGG + Intergenic
996854747 5:127992861-127992883 TTGGGGTCTTAAACAACTCCAGG - Intergenic
1016509676 6:144827441-144827463 TGGGGGTCTTACTAAACTCTTGG + Intronic
1018030367 6:159836870-159836892 TTCGGGTGTTACTAAGCTCTGGG - Intergenic
1022375170 7:29806190-29806212 TTGAGCCCTTACTAAGCTCCAGG - Intergenic
1024994382 7:55261104-55261126 TTGGGGTCTGACTAGGCACCAGG - Intergenic
1026573186 7:71549740-71549762 ATGGGGTCATACCAAGCCCCTGG + Intronic
1034987956 7:155529122-155529144 CTGGGGTCTTCGGAACCTCCAGG - Intronic
1035100969 7:156396226-156396248 TCGGGGTTTCATGAAGCTCCTGG + Intergenic
1037818630 8:22125033-22125055 TGGGGGTCAGGCGAAGCTCCCGG - Intronic
1037931095 8:22880844-22880866 TTGAGGTCTATAGAAGCTCCTGG - Intronic
1039504731 8:38043732-38043754 CAGGGGTCTTATGAAGCTGCTGG - Intronic
1039889233 8:41673046-41673068 TTGGGGGCTTTCCAAGCTCCAGG + Intronic
1050222385 9:3408048-3408070 TTGGCGTCTTGAGAAGCTGCAGG - Intronic
1056726659 9:89125169-89125191 TTGTGTTCTTAACAAGCTCCTGG - Intronic
1057283170 9:93727158-93727180 TTGGGCTCTCACGTAGGTCCAGG - Intergenic
1061332010 9:129900640-129900662 TTGGGACCTTAGGATGCTCCGGG - Intronic
1186446546 X:9635003-9635025 GTGGGGTCTTTCGAGGCTGCAGG + Intronic
1189321699 X:40091053-40091075 TTGTGACCTTCCGAAGCTCCAGG + Intronic
1195677838 X:107520912-107520934 TTGAGGACTTACTATGCTCCAGG - Intergenic