ID: 1183778509

View in Genome Browser
Species Human (GRCh38)
Location 22:39983676-39983698
Sequence TTGTGCAGCCAGCAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183778509_1183778519 14 Left 1183778509 22:39983676-39983698 CCCTGCTCCTGCTGGCTGCACAA No data
Right 1183778519 22:39983713-39983735 TCTGTACCCACAGTCACAGGAGG No data
1183778509_1183778518 11 Left 1183778509 22:39983676-39983698 CCCTGCTCCTGCTGGCTGCACAA No data
Right 1183778518 22:39983710-39983732 CCATCTGTACCCACAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183778509 Original CRISPR TTGTGCAGCCAGCAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr