ID: 1183779569

View in Genome Browser
Species Human (GRCh38)
Location 22:39990046-39990068
Sequence GACTTTCCCTGAACTAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183779569_1183779573 1 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779573 22:39990070-39990092 AGACTCAGGACCAGAGAGACCGG No data
1183779569_1183779581 25 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779581 22:39990094-39990116 AGAGGACCAGGGGCTTTCCTAGG No data
1183779569_1183779574 2 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG No data
1183779569_1183779577 13 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779577 22:39990082-39990104 AGAGAGACCGGGAGAGGACCAGG No data
1183779569_1183779582 26 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779582 22:39990095-39990117 GAGGACCAGGGGCTTTCCTAGGG No data
1183779569_1183779579 15 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779579 22:39990084-39990106 AGAGACCGGGAGAGGACCAGGGG No data
1183779569_1183779578 14 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779578 22:39990083-39990105 GAGAGACCGGGAGAGGACCAGGG No data
1183779569_1183779575 7 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779575 22:39990076-39990098 AGGACCAGAGAGACCGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183779569 Original CRISPR GACTTTCCCTGAACTAGGTG AGG (reversed) Intergenic
No off target data available for this crispr