ID: 1183779570

View in Genome Browser
Species Human (GRCh38)
Location 22:39990051-39990073
Sequence GTCTGGACTTTCCCTGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183779570_1183779573 -4 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779573 22:39990070-39990092 AGACTCAGGACCAGAGAGACCGG No data
1183779570_1183779584 29 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779584 22:39990103-39990125 GGGGCTTTCCTAGGGTGTCATGG No data
1183779570_1183779579 10 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779579 22:39990084-39990106 AGAGACCGGGAGAGGACCAGGGG No data
1183779570_1183779582 21 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779582 22:39990095-39990117 GAGGACCAGGGGCTTTCCTAGGG No data
1183779570_1183779578 9 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779578 22:39990083-39990105 GAGAGACCGGGAGAGGACCAGGG No data
1183779570_1183779574 -3 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG No data
1183779570_1183779577 8 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779577 22:39990082-39990104 AGAGAGACCGGGAGAGGACCAGG No data
1183779570_1183779575 2 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779575 22:39990076-39990098 AGGACCAGAGAGACCGGGAGAGG No data
1183779570_1183779581 20 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779581 22:39990094-39990116 AGAGGACCAGGGGCTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183779570 Original CRISPR GTCTGGACTTTCCCTGAACT AGG (reversed) Intergenic
No off target data available for this crispr