ID: 1183779574

View in Genome Browser
Species Human (GRCh38)
Location 22:39990071-39990093
Sequence GACTCAGGACCAGAGAGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183779569_1183779574 2 Left 1183779569 22:39990046-39990068 CCTCACCTAGTTCAGGGAAAGTC No data
Right 1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG No data
1183779570_1183779574 -3 Left 1183779570 22:39990051-39990073 CCTAGTTCAGGGAAAGTCCAGAC No data
Right 1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183779574 Original CRISPR GACTCAGGACCAGAGAGACC GGG Intergenic
No off target data available for this crispr