ID: 1183781462

View in Genome Browser
Species Human (GRCh38)
Location 22:40001831-40001853
Sequence GGGTGGGGCTCCCTAACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183781462_1183781468 -6 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781468 22:40001848-40001870 CCACCCAGGAGATTAGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 190
1183781462_1183781475 6 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781475 22:40001860-40001882 TTAGAGGTAGGGGAATTGGGAGG 0: 1
1: 0
2: 3
3: 31
4: 389
1183781462_1183781469 -5 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781469 22:40001849-40001871 CACCCAGGAGATTAGAGGTAGGG 0: 1
1: 0
2: 0
3: 19
4: 194
1183781462_1183781464 -10 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781464 22:40001844-40001866 AGCCCCACCCAGGAGATTAGAGG No data
1183781462_1183781477 25 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781477 22:40001879-40001901 GAGGGCCAAAGACCCTGTGCCGG 0: 1
1: 0
2: 3
3: 19
4: 172
1183781462_1183781476 7 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781476 22:40001861-40001883 TAGAGGTAGGGGAATTGGGAGGG 0: 1
1: 0
2: 2
3: 37
4: 402
1183781462_1183781474 3 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781474 22:40001857-40001879 AGATTAGAGGTAGGGGAATTGGG 0: 1
1: 0
2: 2
3: 20
4: 256
1183781462_1183781470 -4 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781470 22:40001850-40001872 ACCCAGGAGATTAGAGGTAGGGG No data
1183781462_1183781473 2 Left 1183781462 22:40001831-40001853 CCAGAAGTTAGGGAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183781473 22:40001856-40001878 GAGATTAGAGGTAGGGGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183781462 Original CRISPR GGGTGGGGCTCCCTAACTTC TGG (reversed) Intronic
903353509 1:22732220-22732242 GGGTGGGGCTCTATGAATTCTGG + Intronic
904441557 1:30535129-30535151 GGGTGGGGCCCCCTAAGCTGGGG + Intergenic
906939903 1:50246654-50246676 GTGTGTGTGTCCCTAACTTCTGG + Intergenic
907409395 1:54273922-54273944 AGGTGGGGCGCCCCAACTGCTGG - Intronic
912929002 1:113939393-113939415 GGCTGGAGCTCCCTGATTTCTGG + Intronic
920098682 1:203503003-203503025 GGGTGGTGCTCCTTACCTGCAGG - Exonic
923558586 1:235021403-235021425 GGTTGGGGGCCCCTAAGTTCTGG + Intergenic
1062955802 10:1539563-1539585 GGGTGGGCCTCCCCAATTTCCGG - Intronic
1063689918 10:8277116-8277138 AAGAGGGGCTCCCTAGCTTCTGG + Intergenic
1067456495 10:46423014-46423036 AGGTGGGACTCCATAGCTTCAGG - Intergenic
1067630705 10:47961625-47961647 AGGTGGGACTCCATAGCTTCAGG + Intergenic
1072741991 10:97915126-97915148 GGGTGGGGCTGCCTCAAGTCCGG + Intronic
1073025999 10:100487812-100487834 GGGTTGGGCTCACTAACCTAAGG - Intronic
1074987815 10:118672941-118672963 GGATAGGGCTCCCTAAGCTCTGG - Intergenic
1080272462 11:30465543-30465565 GGGTGGGCCTCCCAAAGTGCTGG + Intronic
1081189149 11:40081634-40081656 GGGTTGGGCTCCCAAAGTTGTGG - Intergenic
1081444202 11:43114287-43114309 GGGAGGTGCTGCCTAACCTCTGG + Intergenic
1083049774 11:59766691-59766713 GGGTTGGGCTGCTTAGCTTCTGG + Intronic
1083661024 11:64251806-64251828 GGGTGGGGGTCCCCAGCGTCTGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084725653 11:70940085-70940107 GGGTGGGGCTGCCTTCCTTCTGG - Intronic
1087662365 11:101002477-101002499 GGGTGGGGTTGCCTTCCTTCTGG + Intergenic
1091705944 12:2693426-2693448 GGGAGGGGCATCCTCACTTCCGG + Intronic
1100408886 12:94295206-94295228 AGGTAGGGCTTCCTGACTTCTGG + Intronic
1101247973 12:102902914-102902936 GGCTGGGGCTGCCTAACTCAGGG + Intronic
1101362684 12:104042667-104042689 GGGTGGGGTGTCCTATCTTCTGG + Intronic
1101920280 12:108927056-108927078 GGTTGGGGTTCCCTAAGCTCAGG + Intronic
1102787579 12:115617153-115617175 GCCTGGGCCTCCCTAAGTTCTGG + Intergenic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1113901944 13:113802459-113802481 GGTTGGGGCTCCCTCACTCCTGG - Intronic
1115742637 14:36404276-36404298 GGGTGGGCCACCCTTGCTTCAGG - Intergenic
1115900004 14:38135192-38135214 GAGTGGTGCTCCCTGACTCCTGG - Intergenic
1116427524 14:44808932-44808954 GAGTGGGAATCCCTAACTGCTGG + Intergenic
1117223562 14:53632361-53632383 GGGTGGTGGTCCCAAACTTTAGG + Intergenic
1118532125 14:66718269-66718291 TGGTGGGTCTCGCTGACTTCAGG + Intronic
1119104317 14:71909764-71909786 GGGAGGGGATCCCAAACTACAGG + Intergenic
1124029072 15:25992689-25992711 GGTTGGGGCTTCCTAAACTCAGG - Intergenic
1129444498 15:75607372-75607394 GGATGGGGCTCCCTAGGTTGTGG - Intronic
1140606821 16:76549104-76549126 TTGTGGGGCTTCCTACCTTCTGG + Intronic
1142069897 16:88086371-88086393 GGATGGGGCTCCCTTAATTTAGG - Intronic
1142904514 17:3033228-3033250 AGGTGGGGCACCCTTACATCAGG + Intronic
1144339331 17:14299471-14299493 GGGTGGGGCTGCGTAAACTCGGG + Intergenic
1144941634 17:18946365-18946387 GGGTGGCACTCCCCAACTGCAGG - Intergenic
1146624477 17:34425054-34425076 GGGCTGGGCTCCCCAACTCCTGG + Intergenic
1157651418 18:49336061-49336083 GCCTGGGGCTCCCAAACTGCTGG + Intronic
1159056562 18:63471357-63471379 GGCTGGGGCTCCCAAAGTGCTGG - Intergenic
1159820923 18:73142732-73142754 GGGTGGTGGTCTCTAATTTCTGG + Intergenic
1161175662 19:2841118-2841140 GGGCGGGGCGCCCGAACTGCGGG + Intergenic
1162522727 19:11191499-11191521 GGGTGGGGCTCCCCTACCCCCGG + Intronic
1162609998 19:11741957-11741979 GGGTGGGGCTCTCCATCATCAGG - Intergenic
1162999292 19:14356106-14356128 GGTGGGGGCTCCCTGACTCCTGG - Intergenic
1163357307 19:16822241-16822263 GGGTAGGGACCCCTAAGTTCTGG + Intergenic
1163720725 19:18896927-18896949 GGGGGGGGCTCCCCAACATCAGG + Intergenic
1164880729 19:31730612-31730634 GGGTGGGGCGCTCCAACTTTGGG - Intergenic
928388812 2:30892658-30892680 GGTTTGGGCTCCCTAAGCTCAGG + Intergenic
930474864 2:51869019-51869041 GGGTGGGGCTTTCTAAATACTGG - Intergenic
932713926 2:74087991-74088013 TGGTGGGGTTCCCATACTTCCGG - Exonic
933283063 2:80354149-80354171 GGTTGTGGCACTCTAACTTCAGG + Intronic
934519672 2:95012102-95012124 TAGAGGGGCTCCCTACCTTCAGG + Intergenic
935556541 2:104515932-104515954 GGGTGTGGCTCCTTAAATTTAGG + Intergenic
937304049 2:120860364-120860386 GGGTGGGGCTCACTGTCCTCAGG + Intronic
937929323 2:127192291-127192313 CGATGGAGCTCCCAAACTTCGGG + Intronic
938392181 2:130915128-130915150 GAGTGGGGCTCCCCATCTGCAGG + Intronic
941455176 2:165706504-165706526 GCGTGGGCCTCCCAAAGTTCTGG + Intergenic
942239991 2:173953461-173953483 GTGTGGGCCTCCCAAAGTTCTGG - Intronic
946924390 2:224612237-224612259 TGGTGGGCCTCCCTAACCTCGGG - Intergenic
947716688 2:232343359-232343381 GGATGGGGCTGCCCATCTTCAGG + Intronic
948003794 2:234590827-234590849 GGGCGGGGCTCTCTAGATTCGGG - Intergenic
1172022991 20:31927767-31927789 GGGTGACGCTCCCCAGCTTCGGG + Intronic
1172484886 20:35292118-35292140 GGGTGAGGCTGCCTACCTGCGGG - Exonic
1173850798 20:46216535-46216557 GGGTGGGGCTCCCCCTCTGCCGG + Intronic
1174851645 20:54001278-54001300 GGGTAGGCCACACTAACTTCGGG + Intronic
1175978397 20:62725130-62725152 GGATGGGGCTCCCTGGCTCCTGG + Intronic
1178315224 21:31561241-31561263 GAGTGAGGCTGCCTAATTTCAGG + Intergenic
1182784652 22:32897299-32897321 GTGTGGGGCTCCCTAAGTGTGGG - Intronic
1183781462 22:40001831-40001853 GGGTGGGGCTCCCTAACTTCTGG - Intronic
1184441546 22:44519701-44519723 GGGAGGCGCACCCCAACTTCAGG - Intergenic
1184642923 22:45881690-45881712 GGCTGGGGCTACCCAGCTTCTGG + Intergenic
956622503 3:71235484-71235506 GTGGTGGGCTCCCTGACTTCAGG - Intronic
958491297 3:94777257-94777279 CTGTGGGGCTCCCTTAGTTCTGG - Intergenic
963260713 3:143188535-143188557 GGGTGGGCCTGACTAACTGCCGG - Intergenic
966936644 3:184714483-184714505 GGGTGGCTCTCTCTACCTTCAGG - Intergenic
969100734 4:4766308-4766330 GGGTAGGACCCCCTAACTCCAGG + Intergenic
969284892 4:6196979-6197001 AAGTGGGGCTCCCTGACTCCGGG - Intronic
969569331 4:7999525-7999547 GAGGAGGGCTCCCTAGCTTCAGG + Intronic
969856301 4:10002441-10002463 TGGTGGAGCTGCCAAACTTCAGG + Intronic
974965862 4:68760084-68760106 AGATGGGGCTCCATACCTTCAGG - Intergenic
975267493 4:72388216-72388238 GGCTGGTGCTCCCAAACCTCAGG + Intronic
975851044 4:78572917-78572939 GTGTGGGGCAAACTAACTTCAGG - Intronic
979208379 4:118070395-118070417 TGGTTGGCCTCCCTGACTTCTGG + Intronic
982314530 4:154018795-154018817 GGGAGGGACACCCTAACTCCAGG + Intergenic
982740227 4:159050268-159050290 AGGTGTGACTCCCTAACTTGAGG + Intergenic
985599593 5:819861-819883 GGGTGGGGCTCGCAGACTTCAGG - Intronic
985693282 5:1325374-1325396 GGCAGGGGCTCACTCACTTCAGG + Intronic
985722015 5:1494416-1494438 GGGGGGGGGTCCCTCACTCCCGG + Intronic
990659367 5:57995904-57995926 GAGGAGGGCTCCCTGACTTCAGG + Intergenic
994025283 5:95074341-95074363 GGGTGTGGCCACCCAACTTCTGG + Intronic
997453025 5:133998780-133998802 GGAAAGAGCTCCCTAACTTCAGG + Intronic
998328957 5:141306472-141306494 GGCTTGGGCTCCCAAAATTCTGG - Intergenic
1004368530 6:15032413-15032435 GGGTTGGGCTGCCTGACTTTGGG + Intergenic
1006784962 6:36660322-36660344 GGGGCGGGCTCCCTCACTTCCGG + Intergenic
1007753951 6:44086897-44086919 GGGTGGGGTTCCCTGAGGTCAGG - Intergenic
1007802732 6:44411234-44411256 GGGTAGGGCTCCTTGACTCCTGG + Intronic
1009774939 6:68194517-68194539 GGGAGGGGCTCCCTAACTCATGG + Intergenic
1014270022 6:119326206-119326228 GGGTGGCTCTCCCTGCCTTCAGG + Intronic
1016487481 6:144557704-144557726 GGGTGGGGCATCCTAAGTTGAGG + Intronic
1020004001 7:4772044-4772066 GGGTGGGGGTCACTGACTCCAGG - Intronic
1020279607 7:6643552-6643574 GGGCGGGGCTCCCTGTCTCCTGG + Intronic
1023533571 7:41183842-41183864 GGGTGGTGCCCACTTACTTCCGG + Intergenic
1026118720 7:67518220-67518242 AGCTGGGCTTCCCTAACTTCTGG + Intergenic
1031484411 7:122310614-122310636 GGCTGGGGCTCCCAAGCGTCCGG + Intronic
1031649296 7:124266728-124266750 GGATGTTGCTCCCTATCTTCTGG + Intergenic
1032489159 7:132310997-132311019 GAGTGGTGCTGCCTGACTTCTGG + Intronic
1047467479 8:125131804-125131826 GGATAGGGCTCTCAAACTTCAGG - Intronic
1048485932 8:134847686-134847708 GGGTGAGACTCCCCAACTTTGGG + Intergenic
1049410570 8:142472131-142472153 AGCTGGGCCTCCCTAGCTTCCGG - Intronic
1050418919 9:5442476-5442498 GGATGGTGCTCCCCAAATTCTGG + Intergenic
1051422809 9:16905440-16905462 GCGTTGGGCTCCCAAACTGCTGG + Intergenic
1051636404 9:19184459-19184481 GGGGAGGGCCCCCTAACATCAGG + Intergenic
1052326184 9:27218691-27218713 GGGTGGGTCTCCCTGGCTTTTGG + Intronic
1055476531 9:76668628-76668650 GGGAGGGGCTCCCAGAGTTCAGG - Intronic
1059387686 9:113977457-113977479 TGGTTGAGCTCCCTGACTTCTGG + Intronic
1059913406 9:119072125-119072147 GTGTGGGCCTCCCAAACTACTGG - Intergenic
1061879123 9:133559865-133559887 TGGTGTGGCTCCCTAAACTCAGG - Intronic
1185747339 X:2583786-2583808 GGTTGGGGAGCCCCAACTTCGGG - Intergenic
1189493961 X:41492897-41492919 GGGTGGGGGTTCCTACTTTCAGG - Intergenic
1191224783 X:58031555-58031577 GGGTGGGGCCTCCTTACCTCGGG - Intergenic
1200120002 X:153785739-153785761 GCGTGGGCCTCCCTCACTCCAGG - Intergenic