ID: 1183784374

View in Genome Browser
Species Human (GRCh38)
Location 22:40021155-40021177
Sequence GCTCCTTGTGGGCCACACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183784374_1183784383 13 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784383 22:40021191-40021213 CAAGGGTCTGGCCACAGCGGAGG 0: 1
1: 0
2: 0
3: 14
4: 201
1183784374_1183784392 28 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784392 22:40021206-40021228 AGCGGAGGGGCAGGTGGGGGCGG 0: 1
1: 0
2: 17
3: 170
4: 1995
1183784374_1183784382 10 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784382 22:40021188-40021210 CAGCAAGGGTCTGGCCACAGCGG 0: 1
1: 0
2: 2
3: 56
4: 403
1183784374_1183784378 -4 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784378 22:40021174-40021196 GAGCCGTACACCTGCAGCAAGGG 0: 1
1: 0
2: 0
3: 4
4: 71
1183784374_1183784390 24 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784390 22:40021202-40021224 CCACAGCGGAGGGGCAGGTGGGG 0: 1
1: 0
2: 3
3: 48
4: 424
1183784374_1183784380 1 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784380 22:40021179-40021201 GTACACCTGCAGCAAGGGTCTGG 0: 1
1: 0
2: 1
3: 5
4: 110
1183784374_1183784391 25 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784391 22:40021203-40021225 CACAGCGGAGGGGCAGGTGGGGG 0: 1
1: 0
2: 4
3: 73
4: 512
1183784374_1183784384 14 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784384 22:40021192-40021214 AAGGGTCTGGCCACAGCGGAGGG 0: 1
1: 0
2: 3
3: 12
4: 132
1183784374_1183784388 23 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784388 22:40021201-40021223 GCCACAGCGGAGGGGCAGGTGGG 0: 1
1: 0
2: 1
3: 15
4: 304
1183784374_1183784377 -5 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784377 22:40021173-40021195 GGAGCCGTACACCTGCAGCAAGG 0: 1
1: 0
2: 0
3: 3
4: 96
1183784374_1183784385 15 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784385 22:40021193-40021215 AGGGTCTGGCCACAGCGGAGGGG 0: 1
1: 1
2: 0
3: 19
4: 199
1183784374_1183784393 29 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784393 22:40021207-40021229 GCGGAGGGGCAGGTGGGGGCGGG 0: 1
1: 2
2: 20
3: 213
4: 1844
1183784374_1183784387 22 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784387 22:40021200-40021222 GGCCACAGCGGAGGGGCAGGTGG 0: 1
1: 0
2: 5
3: 68
4: 628
1183784374_1183784394 30 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784394 22:40021208-40021230 CGGAGGGGCAGGTGGGGGCGGGG 0: 1
1: 2
2: 16
3: 150
4: 1388
1183784374_1183784386 19 Left 1183784374 22:40021155-40021177 CCAGCGTGTGGCCCACAAGGAGC 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1183784386 22:40021197-40021219 TCTGGCCACAGCGGAGGGGCAGG 0: 1
1: 0
2: 4
3: 30
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183784374 Original CRISPR GCTCCTTGTGGGCCACACGC TGG (reversed) Intronic
904591857 1:31619369-31619391 GGCCCTGGTGGGCAACACGCTGG + Exonic
916694122 1:167220188-167220210 GCACCTGCTGAGCCACACGCGGG - Intergenic
918515351 1:185357364-185357386 GCTACTTGTGGGGCAGAGGCAGG + Intergenic
919766760 1:201132366-201132388 CCTCCCTGTGAGCCACACGAGGG + Intergenic
920079234 1:203360327-203360349 GCTCCTGGTGGCCCTCAGGCAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
922725385 1:227920658-227920680 CCTCCGTGTGGGCCACCCGTTGG - Exonic
923663777 1:235980971-235980993 CCTCCATGTGGGCCTCATGCAGG - Intronic
1063251927 10:4283032-4283054 GCTCCTTGAGGGCCAAAGGCGGG + Intergenic
1065388696 10:25159729-25159751 TCTCGTTGTGGGCCTCATGCTGG + Intergenic
1066304392 10:34125896-34125918 TCTCCTTGTTGGCAACACTCAGG + Intronic
1066381637 10:34906828-34906850 GCTCCCTGTGGCCAACAGGCGGG - Intergenic
1070605262 10:77893914-77893936 GCCCCATGCGGGCCACGCGCCGG - Intronic
1073008557 10:100342611-100342633 GCTCCTCCTGGGCCCCAGGCTGG - Intergenic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1073176691 10:101561248-101561270 GCACCTTGTGGCCCACAGCCAGG - Intergenic
1075658583 10:124177615-124177637 GCTCCATGTGAGTCACACTCAGG + Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1077035102 11:490638-490660 GCTCCTGGTGGGACTCACACAGG - Exonic
1077058578 11:607856-607878 GCTCCTTATCGTCCACAGGCCGG - Exonic
1077557120 11:3231137-3231159 GCCCTTGGTGGGCCACAGGCTGG - Intronic
1078789901 11:14531929-14531951 GCTCCATGTTGGCCACAGGTTGG + Intronic
1081514699 11:43815587-43815609 GCTGCCTGTGGTTCACACGCTGG + Intronic
1081810636 11:45912154-45912176 GCTCCTTCTGGACCACACCCTGG - Intronic
1091123983 11:133080355-133080377 TCACCGTGTGGGCCACACACCGG - Intronic
1093430661 12:19081507-19081529 GCCCCTTGTGGGCATCAAGCAGG + Intergenic
1094099325 12:26744189-26744211 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG + Intergenic
1098532569 12:71557642-71557664 GGTTCTTGTGGGCCACACCAGGG + Intronic
1101993897 12:109511109-109511131 ACACCATGTGGGCCACATGCAGG - Intronic
1107087571 13:36442617-36442639 GCTCCATGAGGGACACACACAGG - Exonic
1114495480 14:23128699-23128721 GCTCCTTATGGGCCACATGTGGG + Intronic
1117300089 14:54416701-54416723 GCTCCTTGTGGGACTGAGGCTGG + Intronic
1118312993 14:64706605-64706627 TCTCCTTGTGGCACACACGTGGG - Intronic
1121972443 14:98370689-98370711 GCTGCCTGTGGGGCACTCGCCGG - Intergenic
1127395941 15:58544108-58544130 AATCCATGGGGGCCACACGCCGG - Intronic
1127836947 15:62797706-62797728 GCTCCTTGTGGGCCAGAGCAGGG + Intronic
1129077010 15:73005560-73005582 GAGCCTTGTGGGCCACAGGAAGG + Intergenic
1130226853 15:82065722-82065744 GCTCCTTGAGGGCTACTGGCCGG - Intergenic
1132289065 15:100686618-100686640 GCTCCCCGAGGGCCACATGCTGG + Intergenic
1132861686 16:2074860-2074882 GTGCTTTGTGGGCCACATGCAGG + Intronic
1133175276 16:4009917-4009939 GTGACTTGTGGGCCACACTCAGG - Intronic
1134631104 16:15756746-15756768 CCCCCTAGTGGGCAACACGCAGG + Intronic
1136023571 16:27455654-27455676 GCTCCTTTTGGTCCCCCCGCTGG + Intergenic
1136451995 16:30358767-30358789 GGTCCTGCTGCGCCACACGCTGG - Exonic
1136655794 16:31708464-31708486 GCTCCTTGTGGGGCACAGGCAGG - Intergenic
1136994301 16:35177693-35177715 GCACCTTGTGGGCCACGGGCTGG + Intergenic
1141753872 16:85978410-85978432 GCTCCTCGTGGGCCCCACATCGG - Intergenic
1142858238 17:2745206-2745228 ACTCCTTGAGGCACACACGCAGG - Intergenic
1142899587 17:3003884-3003906 GAGCCCTGTGGGCCACACGGAGG - Intronic
1143279167 17:5738263-5738285 GCTCCCTGGGGGACACACGATGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1151722989 17:75868780-75868802 GGTCCTTGTGGGCCTCACTTGGG - Intergenic
1152889413 17:82871913-82871935 GCTCGTTGTGAGGCACACGCTGG + Intronic
1152889415 17:82871942-82871964 GCTCGTTGTGAGGCACACGCTGG + Intronic
1153810495 18:8747917-8747939 CCTCCTTGTGTGCCCCATGCTGG + Intronic
1155364367 18:25035644-25035666 GCCTCTTGTGGGCCCCACACTGG + Intergenic
1161277456 19:3426629-3426651 GGGCCTTGTGGGCCACAGGGAGG - Intronic
1161796162 19:6387867-6387889 GCTATCTGTGGGCCACACCCGGG + Intronic
1163005321 19:14393751-14393773 CCTCCTTCTGGGCTCCACGCAGG - Intronic
1163347156 19:16750370-16750392 GCTCCTCGTGGCCCACGTGCTGG + Exonic
1163509573 19:17726878-17726900 GCTCCTTGCGGGCCACCCCAGGG - Exonic
1164098779 19:22035734-22035756 GCTCCTTGTGGGCAGGACCCAGG + Intergenic
1164918583 19:32071764-32071786 GCTCCTTCTGGGCCAGGAGCTGG + Intergenic
1165077335 19:33287139-33287161 GCTCTGTGTGGGCCGCACTCAGG - Intergenic
1165358325 19:35317899-35317921 GGGCCTTGTAGGCCACAGGCAGG + Intergenic
1165358339 19:35318005-35318027 GGGCCTTGTAGGCCACAGGCAGG + Intergenic
1165435334 19:35792012-35792034 GCTCCTTGGGGTCCACAAGGGGG + Intergenic
1165772074 19:38385842-38385864 ACTCCTTGTGGCCCAGACCCGGG + Exonic
1167106952 19:47435980-47436002 GCTCCTTGTGGACCACAGTAGGG - Intronic
1168678190 19:58294243-58294265 GCTCCTTGAGTGCCAGACTCTGG - Exonic
925430062 2:3783732-3783754 GCTCCTGCTTGGCCACACTCCGG - Intronic
928215553 2:29358517-29358539 GCTTCCTGGGGGCCACATGCTGG - Intronic
930742574 2:54847017-54847039 GCTACTTGGGGGGCACAGGCAGG - Intronic
934560918 2:95312914-95312936 CCTCCTTGCGGGACACACACGGG - Intronic
937255366 2:120551828-120551850 GCTAGTTGTGGGCCACAGGGAGG + Intergenic
938068591 2:128294774-128294796 GTACCTTGTGGGCCACAGTCAGG - Intronic
939390988 2:141569984-141570006 GCACTTTGTGGGCCACAGACAGG + Intronic
941007353 2:160261611-160261633 CCTCCCTGTGGGCCACAGGTTGG - Intronic
942505566 2:176638023-176638045 GCTCGCTGAGGGCCACACCCTGG + Intergenic
944550966 2:200844579-200844601 GCTCATCCTGGGCCACACTCAGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946571496 2:221028807-221028829 GCTTCTTGTGGGCCCCACACAGG - Intergenic
1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG + Intronic
1176161073 20:63649127-63649149 GCTCCTCATGGGCCACCAGCTGG - Intronic
1176307330 21:5130615-5130637 GCTCTGCGTGGGCCACACGGAGG - Intergenic
1178734288 21:35134851-35134873 GCTCCTTGTGGTCCCCTCTCAGG - Intronic
1179426070 21:41279780-41279802 GCTCCGCGTGGGCAACACCCGGG - Intronic
1179849729 21:44131415-44131437 GCTCTGCGTGGGCCACACGGAGG + Intergenic
1181441153 22:22935802-22935824 GCTCCTCCTGGGCCACACCTGGG - Intergenic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1184073772 22:42163263-42163285 GCTACTTGTGGGCCCCTCCCTGG + Intronic
1184271317 22:43385874-43385896 TCTCCATGTCGGCCACACGAGGG - Intergenic
1184648232 22:45907747-45907769 CCTCCTTGTGAGCCCCACACCGG - Intergenic
1184732433 22:46378156-46378178 TCTCCCTCGGGGCCACACGCAGG - Intronic
949942013 3:9162539-9162561 GCTCCTTCTGGTCCACTTGCAGG + Intronic
950660385 3:14463564-14463586 GCCCTTTGTGGGCCACACCCGGG - Intronic
950799555 3:15539169-15539191 TCTCCTTGGGGTCCACACTCTGG - Intergenic
952879382 3:37973957-37973979 GCGCCCTGTGGGTCACAGGCTGG - Intronic
955318022 3:57954849-57954871 GCTACTTGTGGGCCTGAGGCAGG + Intergenic
956957910 3:74362168-74362190 GCTTATTGTGTGCCACACACAGG + Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
965964089 3:174466190-174466212 GCTGCATGTGGGCCACAGGTTGG - Intronic
968500603 4:948118-948140 TCTCCGTGTGGGTCACAGGCAGG - Exonic
970016334 4:11516693-11516715 GCTCCATGTGGCCCACGGGCTGG + Intergenic
970193345 4:13534830-13534852 CCTCATTGTGCGCCGCACGCTGG - Intergenic
971732335 4:30401063-30401085 GCTGTTTGTGTGCCACACGAAGG - Intergenic
980680588 4:136155089-136155111 GCTCCATGTGGGCCCCATGGAGG + Intergenic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
992521514 5:77556517-77556539 GCTACTTGGGGGCTACACGTAGG - Intronic
994597731 5:101860622-101860644 GCTCTTTGTGCACCACAGGCAGG - Intergenic
1000334443 5:160231640-160231662 GCTCCTTGAGGGCCCGAGGCAGG - Intronic
1001742750 5:174067660-174067682 GCTCCTTCTGGGCCCCATGAAGG + Intronic
1002029090 5:176415293-176415315 CCTCTTTGTGGCCCACACTCCGG + Intronic
1003574747 6:7282463-7282485 GCTGCTTGTGGTCCACACAAGGG - Exonic
1006629271 6:35419698-35419720 TCTCCATATGGGCCACACGGTGG + Intronic
1008231702 6:48990825-48990847 GCTCCATGTGGGCCTGAGGCTGG - Intergenic
1013432037 6:110064005-110064027 GCTTCTTGTGGCCCACAGCCCGG - Intergenic
1015950551 6:138548397-138548419 GCTGCATGTGGGCCACAGGTTGG - Intronic
1018970492 6:168525447-168525469 GATCCGTGTGTGCCACAAGCAGG - Intronic
1019443960 7:1061307-1061329 GTTCCTGGTGGGCCCCACACAGG + Intronic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1034377849 7:150662169-150662191 GCTCCTTGTGGGCCAGTCCCTGG + Intergenic
1035883229 8:3265893-3265915 TCTCCTTGGAGGCCACAAGCAGG + Intronic
1043631904 8:82345868-82345890 AGTCCTTGTGGGCCAAACGTAGG - Intergenic
1049373445 8:142278395-142278417 GCTCCTTGAGGGCCACAGAGTGG - Intronic
1055708405 9:79033346-79033368 GCTCCATGTGGGCCCCATGGTGG + Intergenic
1057138619 9:92713375-92713397 CCTCCTTGTGGGCCACGAGAGGG + Exonic
1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG + Exonic
1057533627 9:95876415-95876437 GCTTAATATGGGCCACACGCGGG - Intronic
1061288751 9:129639137-129639159 GCACCTTGTGGGGGACACCCAGG - Intronic
1061920393 9:133779362-133779384 GCTCCTTGAGAGCTACAGGCAGG - Intronic
1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG + Intronic
1062502803 9:136858512-136858534 GCCCCCTGTGGACCACACCCTGG + Exonic
1203423565 Un_GL000195v1:17098-17120 GCTCCCTGTGGGCAGCACGAAGG + Intergenic
1186512836 X:10143296-10143318 GATCCTTGTGGGGCACAGGCTGG - Exonic
1190495597 X:51025719-51025741 GCTCCTGGTGGGCTACACTGAGG + Intergenic
1190510329 X:51167862-51167884 GCTCCTGGTGGGCTACACTGAGG - Intergenic
1192147820 X:68693727-68693749 GCTCCGTCCGGGACACACGCGGG - Intronic
1200904444 Y:8467338-8467360 CCACCTTGTGGGCCAAACCCTGG - Intergenic