ID: 1183784825

View in Genome Browser
Species Human (GRCh38)
Location 22:40023302-40023324
Sequence GGCCCCATCCCCATTCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183784822_1183784825 4 Left 1183784822 22:40023275-40023297 CCATGTTCTGTCAGGGGAGGGGT 0: 1
1: 0
2: 1
3: 26
4: 179
Right 1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG 0: 1
1: 0
2: 5
3: 33
4: 357
1183784815_1183784825 20 Left 1183784815 22:40023259-40023281 CCAGGCATGGGCACAGCCATGTT 0: 1
1: 0
2: 0
3: 30
4: 204
Right 1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG 0: 1
1: 0
2: 5
3: 33
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183784825 Original CRISPR GGCCCCATCCCCATTCCTCC TGG Intronic
900119702 1:1043243-1043265 GGCCCCGTCCCCATGCCTCGGGG + Exonic
900498049 1:2985315-2985337 GGCCGCATCTTCATTCCACCGGG - Intergenic
900565052 1:3328049-3328071 GGCCCCAGCCCGAGTCCCCCAGG - Intronic
901753931 1:11429470-11429492 GGCCACATGCCCATACCCCCAGG + Intergenic
901767906 1:11515552-11515574 TGCCCCATCCCCTTTCTCCCTGG + Intronic
901878754 1:12181706-12181728 GCCCCCATCCCCTTCCCCCCAGG - Intronic
902338760 1:15768966-15768988 TGCCCCATCCCCCTACCACCCGG + Intronic
902391487 1:16109641-16109663 GGCCCCTTCCTCATGCCCCCTGG - Intergenic
902764815 1:18607107-18607129 GGCGCCATCCCCCCTCCTGCAGG + Intergenic
903280411 1:22247009-22247031 GGCCACACCCCCAATACTCCAGG - Intergenic
903291566 1:22317491-22317513 GCACCCAGCCCCCTTCCTCCTGG - Intergenic
904557803 1:31376642-31376664 CACCCCATCTCCTTTCCTCCTGG + Intronic
904657866 1:32062766-32062788 GGCCTCATACCCACTCCTCCAGG - Intergenic
905308660 1:37035030-37035052 CTCCCCAACCCCATTCCTCCTGG + Intergenic
905451442 1:38059398-38059420 CGCTCCACCCCCATTCCTCCAGG - Intergenic
906122481 1:43403669-43403691 GGTCCCAAGGCCATTCCTCCTGG + Exonic
906231769 1:44170641-44170663 AGCCCCATCCCCAGACCTCTAGG + Intergenic
906281799 1:44559605-44559627 AGCCCCACTCCCCTTCCTCCCGG - Intronic
907160713 1:52366580-52366602 GGCCCCATTTCCATTTCCCCAGG - Intergenic
907309881 1:53533255-53533277 GGCCTTCTCCCCATGCCTCCAGG + Intronic
908305227 1:62807483-62807505 AGCCCCATTCCCAATCCTCTGGG + Intronic
909235437 1:73147436-73147458 GTCCTCTTCCCCATTCCTTCTGG + Intergenic
910265476 1:85332876-85332898 AGCCCAGTCCCCAATCCTCCAGG - Intronic
912203032 1:107480082-107480104 CTCCTCATCCCCATGCCTCCCGG + Intronic
912716821 1:111989355-111989377 GGCCCCACCCCCAATCCTTCCGG + Intergenic
915107717 1:153544876-153544898 GGCTCCACTCCCATCCCTCCAGG + Intronic
915154065 1:153859839-153859861 ATCCCTATCTCCATTCCTCCAGG + Intronic
915344882 1:155192403-155192425 TGCCCACTCCCCAGTCCTCCTGG - Intronic
915348389 1:155209364-155209386 GGCCCCCTCCCCAGTCATCAGGG - Intronic
916520748 1:165561470-165561492 AGCCCCATGCCCAGGCCTCCTGG + Intronic
917472370 1:175336739-175336761 CTCCCCTTCCCCATTCTTCCTGG - Intronic
917797612 1:178543030-178543052 AGCCCCCTCCCCACACCTCCCGG - Intronic
920195083 1:204221568-204221590 GGCCTCATCCCCCCTCCTCAAGG + Exonic
920502518 1:206494225-206494247 GGCACAAACCCCATGCCTCCAGG - Intronic
921118833 1:212119222-212119244 GGCCCCATCTCTCTTCCTCAGGG - Intergenic
921312560 1:213858719-213858741 GGCACACTCCACATTCCTCCTGG + Intergenic
922240200 1:223750779-223750801 GTCCTCAGCCCCATACCTCCTGG + Intronic
922740651 1:228012512-228012534 CCCCCCACCCCCATTACTCCAGG - Intronic
1062906621 10:1183856-1183878 GGCCCCATCCTCTTCCCTCCTGG - Intronic
1064268986 10:13848466-13848488 GCCCCCCTCCCCCTTCTTCCTGG - Intronic
1065268063 10:23997957-23997979 GCCCCCTTCTCCATACCTCCTGG - Intronic
1065315576 10:24460419-24460441 GCCCTCATGCCCATTCTTCCTGG - Intronic
1066464158 10:35639304-35639326 GCCCCCCTCCCCACCCCTCCTGG + Exonic
1067018509 10:42775339-42775361 GGCCCCTTCCCTCTTCCTCTTGG - Intergenic
1068669370 10:59708999-59709021 CGCCCCATTCCCAACCCTCCGGG + Intronic
1069723699 10:70564636-70564658 GCCCCCATCCCCCTTTCTGCAGG + Intronic
1071310842 10:84342070-84342092 AGCCCCATCCCCCAACCTCCAGG - Intronic
1073134991 10:101215479-101215501 GCCCCATTCCCCTTTCCTCCTGG - Intergenic
1074819605 10:117168361-117168383 GGCTCCATCCCCACTCACCCCGG + Intergenic
1074851011 10:117439729-117439751 GGCCCCAGCCCCATTGTTCTTGG + Intergenic
1075657610 10:124172614-124172636 GGCCCCAGCCCCGTTACTCCAGG - Intergenic
1075911400 10:126128279-126128301 TGCCCCATCCCCATATCACCAGG - Intronic
1076044571 10:127281417-127281439 GGTCCCATTCCCAATTCTCCTGG - Intronic
1076054984 10:127365363-127365385 TGCCCCATCTCCATTGCTGCTGG + Intronic
1076517051 10:131051944-131051966 GGCCACATCCTGATTCCACCGGG - Intergenic
1076603850 10:131676954-131676976 GGCCACTTCCACATTCCTCCTGG - Intergenic
1076634916 10:131875762-131875784 AGCCCCAGCCCCAATCCTCCAGG + Intergenic
1076760934 10:132605411-132605433 AGCCCCTTTCCCATCCCTCCTGG - Intronic
1077146774 11:1050055-1050077 GGACCCCTCCACTTTCCTCCAGG + Intergenic
1077301612 11:1849834-1849856 CGGCCCATCCACCTTCCTCCCGG - Intergenic
1077328669 11:1974483-1974505 GGCCCCAGCCCCATCCGGCCGGG - Intronic
1078548888 11:12267050-12267072 GGCACCATCTGCTTTCCTCCAGG + Intergenic
1079236704 11:18696261-18696283 GGCTCCCTCCCCATACCTTCAGG - Intronic
1080223049 11:29928766-29928788 TGCTCCATCCCCATTCCCACAGG + Intergenic
1080680437 11:34470485-34470507 AGCCCCACCCCCAAACCTCCAGG - Intronic
1081591107 11:44423768-44423790 AGCCCTATCCCCATTTCCCCAGG - Intergenic
1083592162 11:63902257-63902279 CGCCCCATCCCCATCCCACAAGG + Exonic
1084146569 11:67268041-67268063 GGCCCCATCCCCAGCCCGCTGGG - Intronic
1085792048 11:79504665-79504687 GGCCCCATCTCCAATCCACAGGG + Intergenic
1085828983 11:79879328-79879350 GACACCATCCCTCTTCCTCCAGG - Intergenic
1086869424 11:92018750-92018772 TGCCCCTTCCCCAATTCTCCTGG + Intergenic
1089130700 11:116209711-116209733 GTCCCTACCCCCATTCCTCATGG - Intergenic
1089142755 11:116300463-116300485 AGCCCCATCCCCAAACCTCTAGG - Intergenic
1089730845 11:120517760-120517782 GGCCCCTTCCCACTCCCTCCTGG - Intronic
1089938119 11:122386580-122386602 GCCTCCATACCCCTTCCTCCTGG + Intergenic
1091086594 11:132727341-132727363 GTTCCCATCCTCATTTCTCCCGG + Intronic
1091300609 11:134504868-134504890 GCACCCATCCTCACTCCTCCAGG - Intergenic
1202811648 11_KI270721v1_random:29662-29684 GGCCCCAGCCCCATCCGGCCGGG - Intergenic
1091442139 12:519521-519543 GGCTCCCTCCCCTTTCATCCTGG + Intronic
1091583000 12:1800138-1800160 CGGCCCATCCCCTCTCCTCCAGG + Intronic
1091951139 12:4593978-4594000 GGCCCCAGCCCCAGACCTGCTGG - Intronic
1092698975 12:11205608-11205630 AGCCCCATCCCCCAACCTCCAGG - Intergenic
1093130828 12:15390178-15390200 GTCCCCATCCCCATTACTTAAGG + Intronic
1096142605 12:49254746-49254768 AGCCACATCCCCCATCCTCCAGG - Intronic
1097054390 12:56241061-56241083 GCCCCCATCCCCAACCCTGCTGG - Exonic
1098805941 12:75020206-75020228 GCCCCCAGCCCCATCGCTCCTGG - Intergenic
1102258354 12:111428920-111428942 GGAGCCACCCCCATGCCTCCGGG + Intronic
1102492330 12:113296812-113296834 TGCCTCATGCCCCTTCCTCCGGG - Exonic
1102547015 12:113664560-113664582 GCCCCCCTCCCCTTCCCTCCTGG + Intergenic
1104052895 12:125208443-125208465 CTCCCCACCCCCATTCCTCCAGG + Intronic
1106769101 13:32944626-32944648 GGCCCCATCACCTTTCATCCTGG + Intergenic
1107119238 13:36779083-36779105 GGACCCAGATCCATTCCTCCTGG + Intergenic
1107830843 13:44373237-44373259 GGCCCGATCCCCAACCCTCAGGG + Intergenic
1107875906 13:44790145-44790167 GACCCCACCCCCATCCCTGCAGG - Intergenic
1108278722 13:48839722-48839744 AGTCCCATCCCCAGACCTCCTGG + Intergenic
1108373288 13:49792105-49792127 GGCAGCATCCCCGTTCATCCGGG + Intronic
1108517787 13:51219449-51219471 GGCCCCCTCCCAATTACTCTTGG + Intergenic
1110572386 13:77020094-77020116 GGACTCATCCCCATACCCCCAGG - Intronic
1114646856 14:24260735-24260757 GGCTCCATCCCCTCTCCTCAGGG - Intronic
1114648569 14:24269174-24269196 GACCACAGCCCCATGCCTCCTGG - Intronic
1115290385 14:31765450-31765472 GGCCCCATCCTCCTTGGTCCAGG - Intronic
1115871589 14:37810258-37810280 CTCCCCAACCCCATTCCTGCCGG + Intronic
1117648930 14:57882172-57882194 GGATCCATCCCCCTTCCCCCTGG + Intronic
1118668361 14:68095579-68095601 TGCCCCATCCCCATTCATTTTGG + Intronic
1118775159 14:68969343-68969365 GGCCCCATTTCCCTGCCTCCAGG + Intronic
1119206748 14:72800125-72800147 GGCCCCATCCAAATACCTCTAGG + Intronic
1120840118 14:89078238-89078260 GGTCCCATCCGCAGGCCTCCGGG + Intergenic
1121568024 14:94925314-94925336 TGCCCCATCCCCATTTCTTAGGG - Intergenic
1122262034 14:100529242-100529264 AGCCCCAGCCCCAAGCCTCCTGG + Intronic
1122349386 14:101078632-101078654 AGCCCCAGCCCCCTTCCTCCAGG + Intergenic
1122787376 14:104170024-104170046 GCCCACACCCCCCTTCCTCCTGG + Intronic
1123474009 15:20576080-20576102 GACCCCAGCCCCACTTCTCCAGG - Intergenic
1123644001 15:22424273-22424295 GACCCCAGCCCCACTTCTCCAGG + Intergenic
1123734309 15:23171092-23171114 GACCCCAGCCCCACTTCTCCAGG - Intergenic
1123847528 15:24317550-24317572 GGCCTCCTCCACATTCCTCAAGG - Intergenic
1123866573 15:24524931-24524953 GGCCTCTTCCACATTCCTCAAGG - Intergenic
1123981897 15:25612430-25612452 GGCCACAGCCCCATTTCTCCAGG - Intergenic
1124284814 15:28392402-28392424 GACCCCAGCCCCACTTCTCCAGG - Intergenic
1124297883 15:28519212-28519234 GACCCCAGCCCCACTTCTCCAGG + Intergenic
1124483404 15:30097068-30097090 GACCCCAGCCCCACTTCTCCAGG - Intergenic
1124760170 15:32441519-32441541 GACCCCAGCCCCACTTCTCCAGG + Intergenic
1126300035 15:47184750-47184772 GCCCCCACCCCAAATCCTCCGGG + Intronic
1126638633 15:50803305-50803327 AGCCCCATCCCCTGACCTCCAGG + Intergenic
1129038028 15:72662786-72662808 GCCCTCATCCCTATCCCTCCAGG + Intronic
1129104295 15:73295436-73295458 AGCCCCTTCCTCCTTCCTCCTGG + Intronic
1129137362 15:73566566-73566588 GGTTCACTCCCCATTCCTCCAGG + Intronic
1129211861 15:74074445-74074467 GCCCTCATCCCTATCCCTCCAGG - Intronic
1129398542 15:75266639-75266661 GCCCTCATCCCTATCCCTCCAGG + Intronic
1129402150 15:75290915-75290937 GCCCTCATCCCTATCCCTCCAGG + Intronic
1129738851 15:77980167-77980189 GGCCCCTTCCCCATCTCCCCTGG + Intergenic
1129742466 15:77996097-77996119 GTCCCCAGTCCCTTTCCTCCAGG + Exonic
1129839521 15:78735149-78735171 GCCCTCATCCCTATCCCTCCAGG + Intergenic
1129843017 15:78755380-78755402 GTCCCCAGTCCCTTTCCTCCAGG - Intergenic
1129847109 15:78773014-78773036 GGCCCCTTCCCCATCTCCCCTGG - Intronic
1130122227 15:81060880-81060902 GGCCCCTTCCCCATTCCACTGGG + Intronic
1130254793 15:82320876-82320898 GGCCCCTTCCCCATCTCCCCCGG + Intergenic
1130600180 15:85269130-85269152 GGCCCCTTCCCCATCTCCCCCGG - Intergenic
1131503238 15:92990826-92990848 GCCATCATCCCCATTCCTACAGG - Intronic
1131557605 15:93413389-93413411 GACCTCCACCCCATTCCTCCTGG + Intergenic
1132500229 16:281732-281754 CTCCCCACCCCCAGTCCTCCTGG + Exonic
1132607885 16:801008-801030 AGCCCCATCCCCACTCCTCCCGG - Intergenic
1132714479 16:1283952-1283974 AGCCCCTTCCCCACTCCTGCAGG - Intergenic
1132867245 16:2099602-2099624 GGCTCCATTCCCAGTACTCCCGG + Intronic
1132919698 16:2380340-2380362 AGCCTCACCCCCAATCCTCCAGG - Intergenic
1132982548 16:2745845-2745867 GGGCCCACGCCCATCCCTCCAGG - Intergenic
1132988970 16:2783367-2783389 GCCTCCCTCCCCTTTCCTCCTGG - Intergenic
1133026531 16:2991137-2991159 TGCCCCTTCCCCCTCCCTCCTGG - Intergenic
1133321810 16:4918827-4918849 TGCCCCACCCACATTCCTGCTGG - Intronic
1133768639 16:8855012-8855034 CCCCCCATACCCCTTCCTCCAGG + Exonic
1134061600 16:11202715-11202737 GGCCCCACCTCCCTTCCCCCAGG - Intergenic
1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG + Intronic
1134277069 16:12786155-12786177 GGCCACAGCCTTATTCCTCCAGG + Intronic
1134524529 16:14933513-14933535 GGCTCCATTCCCAGTACTCCCGG - Intronic
1134712118 16:16332000-16332022 GGCTCCATTCCCAGTACTCCCGG - Intergenic
1134719975 16:16375293-16375315 GGCTCCATTCCCAGTACTCCCGG - Intergenic
1134947451 16:18336592-18336614 GGCTCCATTCCCAGTACTCCCGG + Intronic
1134954711 16:18376694-18376716 GGCTCCATTCCCAGTACTCCCGG + Intergenic
1136512621 16:30748568-30748590 CGCCCCTTCCCCCTGCCTCCTGG + Intronic
1137613632 16:49834884-49834906 GGCCCCTCCCCCAGCCCTCCTGG - Intronic
1138079691 16:54077991-54078013 GGCCCCACCCCCATCCATGCTGG + Intronic
1138106755 16:54291169-54291191 CGCCCCCTCCTCATTCATCCTGG + Intergenic
1138496858 16:57414037-57414059 GCCCCCAACCCCTGTCCTCCCGG - Intronic
1138829428 16:60359151-60359173 GGCCGCTTCCCCATTGCTACAGG + Exonic
1139476928 16:67207480-67207502 GGCCCCACCCCCAGTCCTAGAGG + Exonic
1139505550 16:67396542-67396564 GGCCCCTCCCGCATTCCTGCTGG + Intronic
1139672455 16:68501039-68501061 GACCCCATCCTCATGCCTCTTGG + Intergenic
1140648798 16:77064640-77064662 GGCCCCCTCACAGTTCCTCCAGG + Intergenic
1140943951 16:79749829-79749851 GTCCCCAGTCCCCTTCCTCCTGG + Intergenic
1141426927 16:83950106-83950128 GGCTCCCTCCCCAGCCCTCCAGG + Intronic
1141535069 16:84673458-84673480 GGCCCCAGCCCCACTCTTGCAGG + Intergenic
1141987014 16:87586650-87586672 CGCCCCATCCTCCTTCCTCCTGG - Intergenic
1142354628 16:89596740-89596762 GGCCCCACTCCCAGTCCTCCTGG + Exonic
1142430162 16:90022079-90022101 GGCCTCCTCCCCACTCCTCACGG - Intronic
1143490628 17:7283524-7283546 GGACCCAGCTCCATCCCTCCAGG + Exonic
1143739085 17:8939774-8939796 GGCCACGTTCCCATTCCTCTTGG - Intronic
1145244389 17:21258693-21258715 GGTCTCATCCCCTGTCCTCCAGG - Intergenic
1147191066 17:38738550-38738572 GTCCCCATCCCCATTCTCCAGGG + Exonic
1147702476 17:42404560-42404582 GCCCCCCTCCCCACACCTCCAGG - Exonic
1147719555 17:42530494-42530516 GGCACCAACCCCATTCCTGAGGG + Intergenic
1148692011 17:49534173-49534195 GTCCCCATCCCCTTTCTTCTAGG - Intergenic
1148846550 17:50533173-50533195 GGCCCCCTCCCCAACCATCCTGG + Intronic
1148853792 17:50567623-50567645 TCCCCCATCCCCATTCCCCAGGG + Intronic
1149337627 17:55653028-55653050 CGCCCCATCTCCATCCCTCCAGG + Intergenic
1149431103 17:56596043-56596065 CCCCCCCTCCCCATTCCTCGGGG - Intergenic
1149646854 17:58247420-58247442 GCCCCCAGCCCCCTTCCTACAGG + Intronic
1149855411 17:60078648-60078670 GGCCCCGGCCCCACCCCTCCGGG - Intronic
1151154421 17:72114839-72114861 CACCCCATCCCCACGCCTCCAGG - Intergenic
1151785418 17:76272677-76272699 GGCCCCAGCCCCTTTCTCCCCGG - Intergenic
1152077363 17:78168102-78168124 GACCCCCTCCCCATTCCTCCTGG - Intergenic
1152391510 17:80006498-80006520 TGCCCCATCCCCATCCCCCGGGG - Intronic
1152834552 17:82520482-82520504 GGCCCCGACCCCCGTCCTCCCGG + Intronic
1152908064 17:82980860-82980882 AGCCCCACCCCCAAACCTCCGGG - Intronic
1152933728 17:83124184-83124206 GGCCTCCTCCCCATTCCCCTTGG - Intergenic
1156971522 18:43162879-43162901 GCCCCCATCCCCATTGCTCCCGG + Intergenic
1157248232 18:46071982-46072004 GGCCCCAGCCCCACTGCTCGAGG - Intronic
1157340321 18:46772193-46772215 GTCCCCCACCCCAGTCCTCCAGG - Intergenic
1157583632 18:48787587-48787609 GGCCCCAGCTCCAGGCCTCCTGG + Intronic
1158209711 18:55034576-55034598 TACCCCAGCCCCATTTCTCCAGG - Intergenic
1160091298 18:75829313-75829335 GGCCCTATGCCAATTCTTCCCGG - Intergenic
1160406306 18:78648749-78648771 GGCTCCATCCACACCCCTCCAGG - Intergenic
1160579938 18:79877938-79877960 GGCTGCATGCCCATTCCGCCTGG + Intronic
1160812688 19:1019825-1019847 GGCCACGTCCCCATTTCGCCAGG + Intronic
1161169325 19:2805133-2805155 GGCCTCCTCCACTTTCCTCCTGG - Exonic
1161349170 19:3783051-3783073 GGCCCCAGGGCCCTTCCTCCCGG + Intronic
1161520283 19:4720015-4720037 CGCCCCCTCCTCATTGCTCCAGG + Intronic
1161780155 19:6286431-6286453 GGACCCATCCCCTTCCATCCAGG - Intergenic
1162751907 19:12834275-12834297 GGCCCCAGCCCCATCCCCCTAGG - Intronic
1163497436 19:17655057-17655079 GGCCCCACCCTCATTCAGCCTGG - Intronic
1164521862 19:28985727-28985749 GGCTCCATCCCCATCGGTCCAGG - Intergenic
1164669006 19:30062557-30062579 GGGCTGATCCCCATTCCCCCAGG - Intergenic
1165448396 19:35869056-35869078 GGCCCCAACCCCCTCCCGCCTGG + Intronic
1165591289 19:36972470-36972492 GGCCACATCCCCAAACCTCTAGG + Intronic
1166763977 19:45241747-45241769 AGCCCCATGCCCCCTCCTCCAGG + Intronic
1166983796 19:46648289-46648311 GGGCTCCTCCCCATTCCTCTCGG + Exonic
1167456894 19:49601127-49601149 GGCCTCATCCTCCTCCCTCCAGG - Intronic
1167658400 19:50781233-50781255 GGCCCCATCCCCAGACCTTGTGG + Intergenic
1168117383 19:54231275-54231297 GCCCCCATCACCACCCCTCCAGG - Intronic
1168277237 19:55284764-55284786 GCCCCCAGCCCCTCTCCTCCAGG - Intronic
1168333846 19:55585870-55585892 GGCCCCCGCCCCCCTCCTCCCGG - Intergenic
1168512807 19:56987055-56987077 GGCACCATCTCTACTCCTCCAGG - Intergenic
926871022 2:17417310-17417332 GGCTCCATGCCCTGTCCTCCAGG + Intergenic
928370732 2:30738353-30738375 GGCCCCATCCTCCTCCCTGCTGG - Intronic
929439210 2:41952273-41952295 GGCCAGATCCCCATGCCTCTGGG - Intronic
929954616 2:46446762-46446784 AGCCCCATCCCCCATCCTCAGGG + Intronic
929968750 2:46555032-46555054 AGTCCCTTCCCCATTCCTCCAGG - Intronic
933289325 2:80420368-80420390 GGATCCATCCTCATCCCTCCTGG - Intronic
936052011 2:109231137-109231159 GACCCCATCTCCTCTCCTCCCGG + Intronic
936059357 2:109284165-109284187 GGCCCCAACCCCCTTCCCCTGGG - Intronic
937290928 2:120781290-120781312 AGCCCCAGCCTCATTCTTCCTGG - Intronic
937347259 2:121133670-121133692 GCCCCCACCCCCATTCCTCAGGG - Intergenic
937835046 2:126462902-126462924 GGCCCCAACCCCCATTCTCCAGG - Intergenic
938710273 2:133970709-133970731 GGCCCCCACCCCAGACCTCCTGG + Intergenic
941781127 2:169447013-169447035 GGCCCCATCCCCAGACCTCTAGG + Intergenic
942462186 2:176175910-176175932 TGCCACTTCCCCATTCTTCCTGG - Intergenic
942526821 2:176861793-176861815 AGCCCCATCCCCTGGCCTCCAGG - Intergenic
943762298 2:191623132-191623154 GGCCCCATCCCCTTGCTTGCAGG + Intergenic
945730830 2:213531548-213531570 GCCCCCATCCCCAGTTTTCCAGG + Intronic
946082159 2:217130386-217130408 GGCCCCACCCTCCGTCCTCCAGG - Intergenic
947650308 2:231781017-231781039 GGCCGCCTCCCAAGTCCTCCCGG + Intronic
948458219 2:238117059-238117081 GGCCCACCCCCCATGCCTCCAGG - Intronic
1168959597 20:1859737-1859759 GACCCCACCCCCACTCCTCATGG - Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1171365414 20:24619338-24619360 GGACCCAGGGCCATTCCTCCTGG + Intronic
1172012365 20:31852972-31852994 GCCCCCATCCCCAATCCTCCAGG - Intronic
1172100903 20:32483587-32483609 TGCCCCCTCCCCCTTCCTCCGGG - Intronic
1172288998 20:33761811-33761833 GGCCTCGTCCCCGTTCCTGCAGG + Intronic
1172426604 20:34860077-34860099 GGACCCCTCCTCATTCCCCCAGG - Intronic
1173165221 20:40683110-40683132 GGCACCATTCCCTTGCCTCCTGG - Intergenic
1173687417 20:44933202-44933224 TGCCCCACCCCCATTCCCCTTGG - Intronic
1173959060 20:47057266-47057288 TGCCCCATCCCCTCACCTCCTGG - Intronic
1174263250 20:49312850-49312872 GGCCCCAGCCACTTTCCTCTGGG + Intergenic
1174479090 20:50818381-50818403 GGCCGCTGCCCCATTCCTCCTGG - Intronic
1174600359 20:51719297-51719319 GGACCCATCCCTTTTCCTCGTGG - Intronic
1175363955 20:58438092-58438114 AGACCCATCTCCATCCCTCCAGG - Intronic
1175478770 20:59296498-59296520 GCCAGCATCCCCATCCCTCCAGG - Intergenic
1175606607 20:60316601-60316623 TGCCCCAGCCCCATTTATCCTGG - Intergenic
1176298056 21:5084881-5084903 CGCCCCATCTGCAGTCCTCCTGG - Intergenic
1176896333 21:14383164-14383186 GGCACCGCCCCCACTCCTCCCGG + Exonic
1177897219 21:26868009-26868031 GGTCTCTTCCCCTTTCCTCCGGG - Intergenic
1179024058 21:37665903-37665925 GCCCCCAGCTCCACTCCTCCAGG - Intronic
1179628699 21:42663786-42663808 GGCCCCATCCTATTTCTTCCAGG + Intronic
1179858973 21:44177068-44177090 CGCCCCATCTGCAGTCCTCCTGG + Intergenic
1179990710 21:44946998-44947020 GGCCCCAGCCCCTTTTCTTCAGG + Intronic
1180096275 21:45556646-45556668 GGCCCCCACCCCATGTCTCCTGG - Intergenic
1180252196 21:46597128-46597150 GGGCCCATCCCCTGTCCACCTGG + Intergenic
1181397758 22:22633845-22633867 CTCCCCATCCCTATTCCTCAAGG + Intergenic
1181651653 22:24262213-24262235 CTCCCCATCCCTATTCCTCAAGG - Intergenic
1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG + Intronic
1184349922 22:43936869-43936891 AGCCCCATACCCCTTTCTCCGGG + Intronic
1184415734 22:44350848-44350870 AGCCCCATCCCCATTTATGCGGG + Intergenic
1184687276 22:46102334-46102356 GCCCCCAGCCCCAGTGCTCCTGG + Intronic
1184880585 22:47301999-47302021 GTCCCCATCCCTATGCCCCCTGG - Intergenic
1185049554 22:48546685-48546707 GGGCTCACCTCCATTCCTCCAGG + Exonic
1185061513 22:48609495-48609517 AGGCCCAACCCCACTCCTCCTGG - Intronic
1185418944 22:50724562-50724584 GGACCCATCCCCCTGGCTCCTGG - Intergenic
1185420149 22:50730621-50730643 AGCCCCAGCCCGTTTCCTCCTGG + Intergenic
949206094 3:1440384-1440406 GGCCCCACCCTCAAACCTCCCGG + Intergenic
949919411 3:8989347-8989369 GGCCCCATGCCCATTCCCAGGGG - Intronic
950108144 3:10401279-10401301 GGCCCCAACCTCAGCCCTCCAGG - Intronic
950168639 3:10820564-10820586 GCCCCCAACCCCACTCCTGCTGG + Intronic
952268092 3:31806242-31806264 AGTCCCAGCCCCATACCTCCTGG + Intronic
953101165 3:39829635-39829657 GGCCCCAACCCCATTGAGCCAGG - Intronic
953149474 3:40310739-40310761 ACCCCCATCTCCATTCCTACCGG + Intronic
954153896 3:48674198-48674220 ACCCCCATCCCCACCCCTCCTGG - Exonic
954390178 3:50264601-50264623 AGCCCCATACCCAGTACTCCTGG + Intergenic
954779120 3:53046192-53046214 CGCCCCAGCGCCATCCCTCCTGG + Intronic
955506281 3:59636283-59636305 GGCCCCAGCCCCATTGCTTATGG - Intergenic
956165802 3:66397295-66397317 GACCTCATCCCCATTCCCCGAGG - Intronic
958878005 3:99637934-99637956 CGCCCCATCCCTCTCCCTCCAGG - Intergenic
960633256 3:119754813-119754835 TGCCCCATCCCCATGGCTCTAGG - Intronic
960974795 3:123163345-123163367 GGACCCAGCTCCCTTCCTCCTGG + Intronic
960997665 3:123350544-123350566 GGCCCCCTGCCCACCCCTCCTGG - Intronic
961722117 3:128903713-128903735 GGCGCCCTCCCCCTTCCACCTGG + Intronic
961820209 3:129572024-129572046 CGCCCCATCCCACCTCCTCCAGG + Intronic
962850676 3:139306363-139306385 GCCCCCATCCCCAGTACCCCAGG - Intronic
968085125 3:195870731-195870753 CAGCCCAGCCCCATTCCTCCAGG - Intronic
968520703 4:1033550-1033572 GGCCCGATGCCCATTCCTCAAGG - Intergenic
968757854 4:2426114-2426136 GGCCCCACAGCCATGCCTCCTGG - Intronic
969364129 4:6684336-6684358 GTCCCCATCCGCACACCTCCAGG + Intergenic
969422802 4:7107223-7107245 GGCCCCATCTGGATTCCTGCTGG + Intergenic
969439216 4:7207515-7207537 GGCCGGCTCCCCAGTCCTCCAGG + Intronic
971421079 4:26474698-26474720 AGCCCCGTCCTCATTCCACCAGG - Intergenic
972564591 4:40258676-40258698 GGCCCCCTCCCCTTTCTTCCTGG - Intergenic
974338571 4:60584486-60584508 AGCCCCCACCCCATTGCTCCTGG - Intergenic
974833260 4:67215304-67215326 TGCCCCATCCCCTCTTCTCCAGG - Intergenic
976266764 4:83192566-83192588 AGCCCCATCCCCCAGCCTCCAGG + Intergenic
976818516 4:89177667-89177689 GCCCCCATCCCCAATCCTGATGG - Intergenic
977553386 4:98465504-98465526 GGCCCCTTCCACATTCCCCAGGG + Intergenic
978498452 4:109384569-109384591 GGACCCATCCCTTTTCATCCAGG - Intergenic
982739126 4:159039366-159039388 GGCCCCATCTCCACTCCCCTGGG - Intergenic
985190306 4:187365516-187365538 AGCCCCATCACCCATCCTCCAGG - Intergenic
985530766 5:432885-432907 GGCCCCATGCCTGTGCCTCCGGG + Exonic
990157104 5:52889629-52889651 TGCCCCCACCCCTTTCCTCCAGG - Intronic
992616126 5:78547869-78547891 GGCTCCAGCCCCAACCCTCCTGG - Intronic
993401005 5:87450948-87450970 TGCCCCATCCCCATCCCCCAAGG - Intergenic
997963416 5:138338837-138338859 GGTCCCAGCCCCACACCTCCTGG - Intronic
998523196 5:142818841-142818863 GGTCCCCTCCACATTACTCCAGG - Intronic
999101408 5:149028762-149028784 GCCACCATGCCCATGCCTCCAGG + Intronic
999384622 5:151145436-151145458 GGCCACAGCGCCATGCCTCCTGG + Intronic
1001513532 5:172339432-172339454 GGCCCCACTCCCAAGCCTCCGGG - Exonic
1001596152 5:172900206-172900228 GGGCCCTTCCCCAATGCTCCCGG - Intronic
1001690546 5:173629548-173629570 GGCTCCAGCCCCAATCCTCCAGG - Intergenic
1002389237 5:178896254-178896276 GCCCCCATCCCCGCTGCTCCGGG - Intronic
1002992289 6:2249134-2249156 AGCCCCATCCCCTAACCTCCAGG + Intergenic
1003053998 6:2802997-2803019 GGTCCCATCCCCACTCCTGTGGG + Intergenic
1006300053 6:33189234-33189256 CGCCACAACCCCTTTCCTCCTGG + Intronic
1006937565 6:37729019-37729041 GGCTTCAGCCCCATTCCTCAGGG + Intergenic
1007172261 6:39872127-39872149 GGCCCCACAGCCATTTCTCCAGG + Intronic
1007268717 6:40618971-40618993 TGCCCCATGTCCATTGCTCCTGG - Intergenic
1009508171 6:64512481-64512503 GGCCCCCTCCCCCTTCCCCTGGG - Intronic
1010905157 6:81478172-81478194 TGCCTCTTCCCCATACCTCCTGG + Intergenic
1015961061 6:138649956-138649978 GGCAGAATCCCCATACCTCCTGG - Intronic
1016461764 6:144285871-144285893 GGCCCCCGCCCCATTCCCTCGGG - Intronic
1017493723 6:154966231-154966253 GGCCCCCTCCACCTCCCTCCCGG + Intronic
1018195885 6:161356011-161356033 TGCCCCATCCCCAGAGCTCCTGG - Intronic
1018263098 6:161989863-161989885 GGGCCCATCCTCAGTCCTCTGGG - Intronic
1018694711 6:166382631-166382653 GGCCCCACCCGGATCCCTCCCGG - Intronic
1018842284 6:167526173-167526195 TTCCCAATCCCCTTTCCTCCTGG + Intergenic
1019221719 6:170478631-170478653 GGCCTCACCCCTGTTCCTCCTGG - Intergenic
1019436650 7:1025656-1025678 GTTACCAGCCCCATTCCTCCTGG - Intronic
1019520777 7:1459683-1459705 GGCCCCGTTCCCACGCCTCCTGG + Intergenic
1021675115 7:23072728-23072750 GTCTCAATCTCCATTCCTCCGGG + Intergenic
1024058560 7:45681984-45682006 TTCCCCATCCCCATCCCTCGGGG + Intronic
1024893302 7:54227207-54227229 GGTACCCTCCCCATTCCTCTAGG - Intergenic
1024900616 7:54315180-54315202 GGTACCCTCCCCATTCCTCTAGG + Intergenic
1025249448 7:57342234-57342256 TGCCCCACCCCCATCCTTCCCGG + Intergenic
1026301778 7:69104142-69104164 AGCCCCATCCCCTGACCTCCAGG - Intergenic
1026388417 7:69875113-69875135 TCCCCCAACCCCATTCTTCCTGG + Intronic
1026947214 7:74324467-74324489 GTCCCCATCCCCAGACCACCGGG - Intronic
1027894786 7:84026691-84026713 GGCCCCATCCATGTTCCTACAGG - Intronic
1028037476 7:86003199-86003221 GGGCCCATCTTCATTCCTCTAGG + Intergenic
1028111750 7:86949893-86949915 GGACCCATCCCCTTCCATCCAGG - Intronic
1028456260 7:91041089-91041111 GGCCCCATACTCACTCCTCCAGG - Intronic
1029400980 7:100345975-100345997 CGCCCCATCCTTATTACTCCAGG + Intronic
1029560418 7:101299550-101299572 GGCCCCATCCCCTTCACTCCCGG - Intergenic
1029636899 7:101790621-101790643 GGCCCAGTCCCCATGCCTCAGGG - Intergenic
1030444311 7:109629899-109629921 GCCTCCATCGCCAGTCCTCCTGG + Intergenic
1030861181 7:114631648-114631670 GGACTCATCTCCATTCCACCTGG + Exonic
1034078600 7:148256474-148256496 GGCCCCATTCTCATCCCCCCAGG + Intronic
1034232159 7:149538949-149538971 AGCCCAATCCCCCTACCTCCAGG - Intergenic
1034498955 7:151437985-151438007 GGCCCACTCACCATTCCTACAGG + Exonic
1035232129 7:157471586-157471608 GCCTCCATCCCCATTGCTCCAGG + Intergenic
1035245068 7:157557921-157557943 GTCACCATCCCCAATACTCCAGG + Intronic
1035701017 8:1639295-1639317 TGGCCCCTCCCCATCCCTCCTGG - Intronic
1035752157 8:2003276-2003298 GGACCCATCCGCACACCTCCTGG - Exonic
1036686968 8:10918216-10918238 AGACCCATCCCCTTGCCTCCTGG + Intronic
1036707443 8:11055975-11055997 GGCCCCCTCCCCCTGCTTCCGGG + Intronic
1037083540 8:14817674-14817696 GGCACCACCCTCATTCCGCCAGG + Intronic
1042346205 8:67730543-67730565 AGCCCCATCCCCCAACCTCCAGG - Intronic
1042655254 8:71088772-71088794 GGACCCAGCTCCATTCTTCCTGG + Intergenic
1046268306 8:111859670-111859692 GGCCCCACCCCCAACCCTCCGGG - Intergenic
1049654514 8:143791821-143791843 GACCCCACCCCCATGCCTCGGGG + Intronic
1049820322 8:144629475-144629497 GTCCCCAGCCCCACTCCTGCTGG - Intergenic
1051629412 9:19127853-19127875 GGCGCCATCCCCATTTGCCCCGG - Intronic
1052466018 9:28830307-28830329 GGCCCCCACCCCACTCATCCAGG - Intergenic
1053091926 9:35286511-35286533 AGCCCCATTCCCTTTCCTTCAGG + Intronic
1053222478 9:36323768-36323790 GTAACCATCCCCATTCCTCAAGG - Intergenic
1057759321 9:97859929-97859951 GGCCCCTTCCCCATCCTTCATGG - Intergenic
1057926133 9:99151980-99152002 TCCCCCATCCCCATTTCTCCTGG - Exonic
1060215586 9:121736563-121736585 CGCCCCAGCCCCAGCCCTCCGGG - Intronic
1060257841 9:122048081-122048103 TCCCCCATCTCCCTTCCTCCAGG + Intronic
1061134428 9:128725010-128725032 GGCCCCATCCCAGCTCCTCCAGG + Intergenic
1061263001 9:129490223-129490245 GGCTCCATCTTCATGCCTCCAGG + Intergenic
1062234808 9:135502680-135502702 GGGCCCAGGCCCATCCCTCCTGG - Intronic
1062277593 9:135738064-135738086 TGCCCCATCCCTGTTCCTGCAGG + Intronic
1062308003 9:135920455-135920477 GGCACCATCCCCAATCCCTCGGG + Intergenic
1062495126 9:136828019-136828041 GCCCCCCTCTCCTTTCCTCCCGG + Intronic
1189232047 X:39460240-39460262 AGCCCCATTCCCCTCCCTCCAGG + Intergenic
1190362722 X:49664751-49664773 GCCCCCATACCCCTTCCTTCTGG - Intergenic
1192150916 X:68711928-68711950 GGTCCCAGCCCCATTCATCTTGG + Intronic
1193443338 X:81568693-81568715 GGCCCAATCCTCATGCCTCCAGG - Intergenic
1195674475 X:107497407-107497429 GGCCCCCTCCCCATTTCTCCTGG + Intergenic
1195687510 X:107600281-107600303 AGCCCTATCCCTGTTCCTCCAGG + Exonic
1197366201 X:125567270-125567292 GCCCCCACCCCCATCACTCCCGG - Intergenic
1199717278 X:150515659-150515681 GACCCTATCCTCATTCCTCCTGG + Intergenic
1200070212 X:153525526-153525548 GGCCTCAGCTCCATTTCTCCTGG + Intronic