ID: 1183787167

View in Genome Browser
Species Human (GRCh38)
Location 22:40036415-40036437
Sequence CTAAGGATGAACCTGCATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183787167_1183787174 25 Left 1183787167 22:40036415-40036437 CCCTCATGCAGGTTCATCCTTAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1183787174 22:40036463-40036485 CAAAAGTCCCACAACCTTTCTGG 0: 1
1: 0
2: 2
3: 11
4: 160
1183787167_1183787173 -3 Left 1183787167 22:40036415-40036437 CCCTCATGCAGGTTCATCCTTAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1183787173 22:40036435-40036457 TAGAGGGCTGCGGTCTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183787167 Original CRISPR CTAAGGATGAACCTGCATGA GGG (reversed) Exonic
904432895 1:30476636-30476658 CTGAGGACGATCCTGCCTGAAGG + Intergenic
908848806 1:68352572-68352594 CTAAGGATGAACTTGAAACAGGG - Intergenic
911525070 1:98974532-98974554 CTAAGAATGAAACAGGATGAAGG - Intronic
915468565 1:156112662-156112684 CTAGGGATGCACCCGGATGAGGG - Intronic
917004871 1:170403188-170403210 CTAAGAATGGACCTACTTGAAGG - Intergenic
917522351 1:175758640-175758662 CGAAGGAAGAACCTGCATCTGGG - Intergenic
920038933 1:203083698-203083720 CTAAGGAGGCAGCTGAATGAGGG + Exonic
1068425964 10:56864496-56864518 CTCAGGAGGAACCTGCAAGAGGG + Intergenic
1073914360 10:108385081-108385103 CTAAGGGTGAGACTGCATGTGGG + Intergenic
1074469147 10:113711435-113711457 CTAAGGATGACACTGCCTGCTGG + Intronic
1075081304 10:119385701-119385723 GTAAGGATGAGGCTGCAGGAGGG + Intronic
1081109672 11:39119698-39119720 CTAAGGTTGTACGTGCAGGAAGG - Intergenic
1085834616 11:79939249-79939271 CTAAGAATGACTCTGCAAGAAGG + Intergenic
1087185219 11:95184245-95184267 TCAAGGATGAACCAGCCTGAGGG + Intronic
1088325268 11:108594180-108594202 CTGTGGATGAACCTGGCTGAAGG + Intergenic
1092261254 12:6954341-6954363 CTAAGGATGAATCTCCGTGAAGG - Intronic
1092681693 12:10989689-10989711 ATAAAGCTGAACATGCATGAAGG - Intronic
1093752559 12:22817688-22817710 CTTTGGATGTAGCTGCATGAAGG - Intergenic
1094229333 12:28085012-28085034 CCAAGGCTGAGCCTGCATGGAGG - Intergenic
1103984580 12:124758721-124758743 CAAGGGATGATCCTGCTTGATGG - Intergenic
1106465114 13:30006553-30006575 CTAATGAGGAACTTGCAGGATGG - Intergenic
1118091526 14:62485611-62485633 CTGAGGATGCACCAGCTTGATGG + Intergenic
1118381573 14:65221791-65221813 CTAGGGAAGAAGCTCCATGAGGG + Intergenic
1124167531 15:27341525-27341547 GTAAGGATGAAACGGGATGATGG - Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1125440876 15:39702036-39702058 CCAACGATAAGCCTGCATGAAGG - Intronic
1125669244 15:41458209-41458231 CTAAAGAGTAAGCTGCATGAAGG + Intronic
1126744148 15:51807939-51807961 CTAAGTATCAACCTACAGGAAGG - Intronic
1129512992 15:76138621-76138643 CTAAGCATGTTCCTGCATGTAGG - Intronic
1130926505 15:88389566-88389588 CTAATGATGCATCTGAATGAGGG - Intergenic
1140714582 16:77710663-77710685 CTAAAGGTGAATCTGGATGAAGG - Intergenic
1149320050 17:55473196-55473218 TTAAGGATGAATTTCCATGAAGG - Intergenic
1150411984 17:64952835-64952857 CTAAGTATGAATGTGGATGAGGG + Intergenic
1153585118 18:6612837-6612859 CTTAGGATGGACATGCATGCTGG + Intergenic
1154181555 18:12143640-12143662 CCCAGGATGAACCTCCAAGAAGG + Intergenic
1154182349 18:12147944-12147966 CCCAGGATGAACCTCCAAGAAGG - Intergenic
1156407017 18:36792339-36792361 CAATTGATGAACCTGGATGATGG + Intronic
1160746482 19:713520-713542 TTAAGGATGAACCTGGCTAATGG - Intronic
927830954 2:26349648-26349670 CTAAGGGTGAAACTGCAAGTTGG + Intronic
929221638 2:39470314-39470336 CTAAGGAAGAACCTGAAATAGGG - Intergenic
932535690 2:72592468-72592490 CTAAGCATGAAACTGGATTAAGG + Intronic
934938642 2:98483602-98483624 TGTAGGATGAACCTGCCTGAAGG - Intronic
935179398 2:100676441-100676463 CTAAGCATGAACTTCCATGCTGG + Intergenic
935294926 2:101640567-101640589 CTAAGGAAGAACCTGCTTAAGGG - Intergenic
935411497 2:102769056-102769078 CTGAGGATGAAAGAGCATGAAGG - Intronic
936624991 2:114139354-114139376 CTGAGGATGTCCCTGCATCAGGG + Intergenic
940672621 2:156689040-156689062 CTAAGGATAAGCCTGCTTCAAGG + Intergenic
942491818 2:176496809-176496831 CAGAGGATGAACCTGCCTGTAGG + Intergenic
1170627314 20:18039802-18039824 CTAAGAAGGAACCTGTATGAGGG + Intronic
1174547553 20:51337074-51337096 CTTATGATGAACCCGCATGGTGG + Intergenic
1181859275 22:25805659-25805681 CTACCGATGACCCTGTATGAGGG + Intronic
1183787167 22:40036415-40036437 CTAAGGATGAACCTGCATGAGGG - Exonic
953285249 3:41600214-41600236 CTCAGTAAGTACCTGCATGAGGG - Intronic
958478497 3:94616173-94616195 GTAAGGATTAACATGCAGGAAGG - Intergenic
963371372 3:144404939-144404961 CCGAGGCTGAATCTGCATGATGG - Intergenic
963738421 3:149048943-149048965 CTAAGAGTGATCCTGGATGAAGG - Exonic
963749809 3:149164849-149164871 CAAATGATGAAGATGCATGAGGG - Intronic
965743105 3:171897323-171897345 ATTAGGCTGAAGCTGCATGATGG - Intronic
971037069 4:22705301-22705323 CCAAGTATGCATCTGCATGATGG - Intergenic
978055254 4:104255718-104255740 CCAAGGATGAAGCTGACTGATGG - Intergenic
978986917 4:115024276-115024298 CCCAGAATGAAGCTGCATGATGG - Intronic
979032605 4:115669217-115669239 CTAAGGATGAAAATTCATTAAGG + Intergenic
984652015 4:182280545-182280567 CTAAGTATGAACCTGACTCATGG + Intronic
985294591 4:188422058-188422080 GCATGGATGAGCCTGCATGAAGG - Intergenic
987472149 5:18345411-18345433 GTAATAATGAACCTACATGAGGG + Intergenic
992453195 5:76891794-76891816 CCAAGGAAGAACATGCATTAGGG + Intronic
994286455 5:97974265-97974287 ATAAGGATGAATCAACATGAGGG - Intergenic
994818414 5:104615189-104615211 TTTAAGATGAACCAGCATGATGG - Intergenic
995140143 5:108727193-108727215 GTTAGGAAGAACCTGCATGGTGG + Intergenic
998445715 5:142196919-142196941 CAAAGAAGGAGCCTGCATGATGG + Intergenic
999472530 5:151868216-151868238 CTAAGGTGGAACCTGCATGCAGG + Intronic
999865714 5:155698396-155698418 CTAAGGGTGACCCTGAAGGACGG + Intergenic
1001765623 5:174244130-174244152 CTATGGATGATGCAGCATGAAGG - Intergenic
1002529048 5:179832970-179832992 CCAAGGATGCACCTGCAAGCAGG - Intronic
1002649638 5:180682049-180682071 CTCTGGATGAAGCTGCTTGATGG - Intergenic
1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG + Intergenic
1012708504 6:102566041-102566063 CAGAAGATGAATCTGCATGAAGG + Intergenic
1013829148 6:114252203-114252225 CTAAGCAATAATCTGCATGAAGG - Intronic
1018492386 6:164307481-164307503 CTATGGAACAACCTGCATGCAGG + Intergenic
1021023050 7:15628253-15628275 CTAAAGAGGACCCTGCATAATGG + Intronic
1021822025 7:24507754-24507776 CCACGGATGAACTTGGATGATGG + Intergenic
1022120703 7:27305258-27305280 CTAACGATGAACCTGAAGCATGG - Intergenic
1022298321 7:29078563-29078585 AGAAGGATGAAGCTGCATAATGG + Intronic
1023872971 7:44272631-44272653 CTCTGCATGAACATGCATGACGG + Intronic
1024503623 7:50141426-50141448 CTAAGGATGAAACATGATGATGG + Intronic
1039034551 8:33345733-33345755 TTAAGGAGGTACCAGCATGATGG + Intergenic
1039847019 8:41332675-41332697 CTCACGGTGAGCCTGCATGATGG + Intergenic
1042063183 8:64843706-64843728 CATGGGATGAAACTGCATGAAGG + Intergenic
1043676006 8:82954438-82954460 CTAATGATGAAACAGTATGAAGG + Intergenic
1044001741 8:86890701-86890723 CTAACAATGTACCTGTATGAGGG + Intronic
1045042346 8:98237705-98237727 TTAAGCATGAAACTGCATGGTGG - Intronic
1052759324 9:32573408-32573430 CTAAGGAAGAACTTGTATGCTGG + Intergenic
1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG + Intergenic
1058150576 9:101459451-101459473 CTAAGGAAGAACCAGAGTGAAGG + Intergenic
1188572406 X:31603822-31603844 CTAAGGATGATCCTTCCTGGTGG + Intronic
1190431560 X:50382668-50382690 ATGAAGATGAATCTGCATGATGG + Intronic
1193928184 X:87517257-87517279 CTAATTACGAACCCGCATGAGGG + Intergenic
1194618242 X:96134774-96134796 CTATGGAGGTACCTGGATGATGG - Intergenic
1196690212 X:118550980-118551002 CTAAGGATAAACCTGCCTCCAGG - Intronic
1201484998 Y:14484548-14484570 CTAAGGATGAACCTGCCCCATGG + Intergenic
1202174272 Y:22083439-22083461 CTATGGCTGCACCTGCATCATGG - Intronic
1202217088 Y:22502943-22502965 CTATGGCTGCACCTGCATCATGG + Intronic
1202326097 Y:23693127-23693149 CTATGGCTGCACCTGCATCATGG - Intergenic
1202544674 Y:25976927-25976949 CTATGGCTGCACCTGCATCATGG + Intergenic