ID: 1183787167

View in Genome Browser
Species Human (GRCh38)
Location 22:40036415-40036437
Sequence CTAAGGATGAACCTGCATGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183787167_1183787173 -3 Left 1183787167 22:40036415-40036437 CCCTCATGCAGGTTCATCCTTAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1183787173 22:40036435-40036457 TAGAGGGCTGCGGTCTTATCTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1183787167_1183787174 25 Left 1183787167 22:40036415-40036437 CCCTCATGCAGGTTCATCCTTAG 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1183787174 22:40036463-40036485 CAAAAGTCCCACAACCTTTCTGG 0: 1
1: 0
2: 2
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183787167 Original CRISPR CTAAGGATGAACCTGCATGA GGG (reversed) Exonic