ID: 1183788448

View in Genome Browser
Species Human (GRCh38)
Location 22:40045344-40045366
Sequence GCGGGCGCGCGCGCGGCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183788440_1183788448 0 Left 1183788440 22:40045321-40045343 CCCGAACGGCCGGGCAGGCACTG No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data
1183788445_1183788448 -9 Left 1183788445 22:40045330-40045352 CCGGGCAGGCACTGGCGGGCGCG No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data
1183788439_1183788448 1 Left 1183788439 22:40045320-40045342 CCCCGAACGGCCGGGCAGGCACT No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data
1183788441_1183788448 -1 Left 1183788441 22:40045322-40045344 CCGAACGGCCGGGCAGGCACTGG No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data
1183788433_1183788448 21 Left 1183788433 22:40045300-40045322 CCGGCGCGCGGGCCGGGGCGCCC No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data
1183788436_1183788448 9 Left 1183788436 22:40045312-40045334 CCGGGGCGCCCCGAACGGCCGGG No data
Right 1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183788448 Original CRISPR GCGGGCGCGCGCGCGGCTCC GGG Intronic