ID: 1183789042

View in Genome Browser
Species Human (GRCh38)
Location 22:40050158-40050180
Sequence CCTTTGCTACCAAGCCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183789037_1183789042 9 Left 1183789037 22:40050126-40050148 CCTGCTACTTAGTTACGATACTG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1183789042 22:40050158-40050180 CCTTTGCTACCAAGCCAGCCCGG No data
1183789036_1183789042 17 Left 1183789036 22:40050118-40050140 CCTGGAATCCTGCTACTTAGTTA 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1183789042 22:40050158-40050180 CCTTTGCTACCAAGCCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183789042 Original CRISPR CCTTTGCTACCAAGCCAGCC CGG Intronic
No off target data available for this crispr