ID: 1183792504

View in Genome Browser
Species Human (GRCh38)
Location 22:40084275-40084297
Sequence GTGTGATTATTTTAGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183792504_1183792505 -7 Left 1183792504 22:40084275-40084297 CCAGTGAGCTAAAATAATCACAC 0: 1
1: 1
2: 0
3: 12
4: 163
Right 1183792505 22:40084291-40084313 ATCACACCGTGAATTGAATTTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1183792504_1183792507 23 Left 1183792504 22:40084275-40084297 CCAGTGAGCTAAAATAATCACAC 0: 1
1: 1
2: 0
3: 12
4: 163
Right 1183792507 22:40084321-40084343 AGATGAGCTGAGTTTGATGATGG 0: 1
1: 0
2: 2
3: 34
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183792504 Original CRISPR GTGTGATTATTTTAGCTCAC TGG (reversed) Intronic
908312824 1:62902641-62902663 GTGTGAATATTTTAATACACAGG + Intergenic
908523117 1:64964076-64964098 CTGTGATTATTGTGGCTCAGTGG - Intronic
909405763 1:75287613-75287635 TTCAGATTATTTTATCTCACAGG + Intronic
914974086 1:152342139-152342161 CTGTGATTTTTTTAGCTCATTGG + Intergenic
915518895 1:156429994-156430016 TTGTGATTAGTTAAGCTGACCGG - Intronic
918630101 1:186707133-186707155 GTGTGATGATTCAAGCTCCCTGG + Intergenic
918778541 1:188668036-188668058 GAGCAATTATTTTAGCTAACTGG - Intergenic
919261592 1:195202490-195202512 GTGTGCTTGATTTGGCTCACAGG + Intergenic
919537961 1:198811868-198811890 GTGTGCATATTTTAGATCATGGG - Intergenic
923406592 1:233666989-233667011 GTGTGAGTATTACAGCTCCCTGG + Exonic
923511534 1:234657809-234657831 GTCTGATTGTTTTTGCACACAGG - Intergenic
924449514 1:244164978-244165000 GTGAGATTATAATACCTCACAGG - Intergenic
1064399082 10:15005813-15005835 GTATGAAAATTTTAGTTCACAGG - Intergenic
1068840509 10:61608499-61608521 GAGTAATTATTTTTCCTCACAGG - Intergenic
1071670802 10:87607843-87607865 GTGTGATTATTTCATCACCCAGG + Intergenic
1071902132 10:90132027-90132049 GTGTGATTATTTGAATTCAATGG - Intergenic
1072242735 10:93512166-93512188 GTGGCATGATTTCAGCTCACTGG - Intronic
1073616323 10:104999854-104999876 CTGTGATTATTTTATCCCAGGGG + Intronic
1079545113 11:21624542-21624564 GTGTGATTACTTAATCTCTCTGG - Intergenic
1080784762 11:35464631-35464653 GTGTCATTATTTTAAATCAGTGG - Intronic
1088565081 11:111162860-111162882 GTGAGTTTATTTTGGTTCACTGG + Intergenic
1088686859 11:112290896-112290918 GTGTGATTAGTTCAGTTCATTGG + Intergenic
1092059406 12:5536314-5536336 GTGGCATGATCTTAGCTCACTGG + Intronic
1092658351 12:10711886-10711908 CTGTGATTATTTTGACTCCCAGG - Intronic
1095736738 12:45565425-45565447 ATTTGATTCTTTTATCTCACTGG + Intergenic
1096732007 12:53621328-53621350 GTGTTTTTGTTTTAGGTCACTGG - Intronic
1099915730 12:88890886-88890908 GTGGCATGATTATAGCTCACTGG - Intergenic
1099973039 12:89519385-89519407 TTGTGATTATTTTAGCCTATGGG - Intronic
1101061912 12:100981247-100981269 ATGTTATTCTTTTAGGTCACAGG - Intronic
1103628324 12:122238075-122238097 GTGTGATAATAATAGCTAACAGG - Intronic
1108115773 13:47126223-47126245 GTGTGTTTATTTATGCTCACTGG - Intergenic
1110103016 13:71633419-71633441 ATGTGATTATTCTAGCTGAGAGG - Intronic
1110614278 13:77523743-77523765 GTGTGATTATCTTAGAAAACTGG - Intergenic
1110988739 13:82009895-82009917 CAGTGTTTATATTAGCTCACTGG + Intergenic
1111363547 13:87209199-87209221 GTGGGATTATCACAGCTCACTGG - Intergenic
1111634868 13:90891285-90891307 CTGTGATTTTATTAGCTCCCAGG + Intergenic
1112659125 13:101487318-101487340 TTGGTATTATTTTAGGTCACAGG - Intronic
1113835714 13:113327233-113327255 GTGGCATGATCTTAGCTCACTGG + Intronic
1116537572 14:46053494-46053516 ATGTGATTATTTCAGCTCTCTGG + Intergenic
1116917682 14:50541120-50541142 TTCTGATTATTTTTGCTGACGGG - Intronic
1121240036 14:92422932-92422954 GTGTCCTGAGTTTAGCTCACAGG + Intronic
1123471907 15:20561865-20561887 TTGTGATTATTTTATCTTATTGG + Intergenic
1123646099 15:22438488-22438510 TTGTGATTATTTTATCTTATTGG - Intergenic
1123683087 15:22776444-22776466 CTGTGATTATTTTATCTTATTGG - Intronic
1123732210 15:23156856-23156878 TTGTGATTATTTTATCTTATTGG + Intergenic
1123750345 15:23354238-23354260 TTGTGATTATTTTATCTTATTGG + Intergenic
1124076420 15:26449517-26449539 GTGTGATGATTTCAGTTCATTGG - Intergenic
1124282715 15:28378154-28378176 TTGTGATTATTTTATCTTATTGG + Intergenic
1124299987 15:28533460-28533482 TTGTGATTATTTTATCTTATTGG - Intergenic
1124335282 15:28850856-28850878 CTGTGATTATTTTATCTTATTGG - Intergenic
1124562761 15:30790952-30790974 CTGTGATTATTTTATCTTATTGG + Intergenic
1124598059 15:31107778-31107800 TTGTGACTTTTTTAGCCCACTGG + Intronic
1124960560 15:34390295-34390317 TTTTGATTATTTTATCTCATTGG - Intronic
1124977189 15:34536516-34536538 TTTTGATTATTTTATCTCATTGG - Intronic
1125304582 15:38295837-38295859 TTGTGATTTTTTTAGCTCATTGG - Intronic
1127776965 15:62271234-62271256 TTGTGATTATTTTATCTTATTGG - Intergenic
1129036626 15:72654163-72654185 TTGTGATTATTTTACCTTATTGG + Intergenic
1129213261 15:74083062-74083084 TTGTGATTATTTTACCTTATTGG - Intergenic
1129397139 15:75258024-75258046 TTGTGATTATTTTACCTTATTGG + Intergenic
1129400750 15:75282301-75282323 TTGTGATTATTTTACCTTATTGG + Intronic
1129730391 15:77927375-77927397 TTGTGATTATTTTACCTTATTGG - Intergenic
1131187880 15:90291365-90291387 TTGTGATTATTTTATCTTATTGG + Intronic
1132184265 15:99790546-99790568 TTGTGATTATTTTATCTTATTGG + Intergenic
1132434106 15:101782608-101782630 TTGTGATTATTTTATCTTACTGG - Intergenic
1133292412 16:4731336-4731358 GTGGCATGATTTCAGCTCACTGG + Intronic
1137032953 16:35542537-35542559 GTGGCATGATTTCAGCTCACTGG + Intergenic
1137631595 16:49949870-49949892 GTGGTATGATTTCAGCTCACTGG - Intergenic
1137847016 16:51700172-51700194 GTGTGTTTGTCTTAGCTCATAGG + Intergenic
1150963703 17:69942810-69942832 GAATGATAATTTTATCTCACAGG - Intergenic
1157992044 18:52509226-52509248 GTATTACTATTTTAGCTCATTGG + Intronic
1164100385 19:22049814-22049836 GTGGGATTTGTTCAGCTCACAGG - Intergenic
926532726 2:14070701-14070723 GTGTGATTATATTTGTTCTCTGG + Intergenic
927372804 2:22376892-22376914 GTTTAATTATTTTAGCTTTCAGG - Intergenic
928517219 2:32054866-32054888 GTGTCAGAATTATAGCTCACTGG - Intergenic
931925121 2:67064108-67064130 GTGTGATTAATTCAGCAAACGGG + Intergenic
935023162 2:99251361-99251383 TTGTGATTATTTATGTTCACAGG - Intronic
935742736 2:106165030-106165052 GTGAGATTATTTTAGTTTAGTGG - Intronic
936735190 2:115432693-115432715 GTGTGTGTCTTTTAGCTCAGTGG + Intronic
937525382 2:122762073-122762095 GTGGCATTATCATAGCTCACTGG - Intergenic
939279457 2:140043189-140043211 AGGTGTTTATTTTGGCTCACTGG - Intergenic
941600074 2:167531864-167531886 TTGTGAATATTTTGGCTCAATGG + Intergenic
942057112 2:172194773-172194795 CTGTCATTATTTTACCTCCCTGG - Intergenic
942721271 2:178955890-178955912 GTTTTATTATTTGAGTTCACAGG - Intronic
943056271 2:182984758-182984780 TTTTGATTATTTTACTTCACAGG + Intronic
1170395087 20:15917075-15917097 CTATGATTATTTTAGCGCAGGGG - Intronic
1171303104 20:24080988-24081010 GTCTGAATATTTTACCTCAGTGG - Intergenic
1171374506 20:24683024-24683046 GTGGGATTGTTTTAGCTCTTTGG - Intergenic
1172152710 20:32801641-32801663 GTGGCATTATTACAGCTCACTGG + Intronic
1172557748 20:35857186-35857208 TTGTGATTATTTTAAATCCCTGG + Intronic
1173017502 20:39238876-39238898 GTGTGTTTATTTTGGACCACTGG + Intergenic
1173035473 20:39404926-39404948 GTATGTTCATTTTAGGTCACTGG + Intergenic
1176653851 21:9572658-9572680 GTGTCATGATCTAAGCTCACTGG - Intergenic
1178770816 21:35502068-35502090 GTGTGATTATTTTACCAAAGGGG + Intronic
1182984900 22:34707077-34707099 GTGTGGGTGTTTTATCTCACTGG - Intergenic
1183792504 22:40084275-40084297 GTGTGATTATTTTAGCTCACTGG - Intronic
953757562 3:45660354-45660376 GTGTGAATAGTTTTGCTTACTGG + Intronic
955457233 3:59136953-59136975 GTGTCATTATTTTTTCTCTCTGG + Intergenic
955636593 3:61036751-61036773 GTGTGATTTATTGTGCTCACCGG - Intronic
960265623 3:115617973-115617995 GTTTGTTTCTTTTATCTCACAGG - Intergenic
962054046 3:131849673-131849695 GTTTGATTATTCTTGCTCTCCGG + Intronic
963392732 3:144688927-144688949 GTGTGATTGTTTTCTCTCATAGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969735243 4:8984438-8984460 GTATGAAAATTTTAGTTCACAGG + Intergenic
971022202 4:22548239-22548261 GTGTAAGTATTCTATCTCACTGG + Intergenic
971059034 4:22946454-22946476 GTGTGTTTATAACAGCTCACAGG - Intergenic
971445209 4:26737709-26737731 TTGTGATTATTTTTGTACACTGG - Intronic
972908553 4:43784151-43784173 TTGTGAATATTTTACCTTACAGG + Intergenic
973322392 4:48823719-48823741 GTGGCATTATCATAGCTCACTGG + Intronic
973997661 4:56475501-56475523 GTGGTATGATTTCAGCTCACTGG - Intronic
974167600 4:58223971-58223993 GTGTTATTATTTTAGATAAAAGG + Intergenic
974506283 4:62777270-62777292 TTGTGTTTAATTTAGTTCACAGG + Intergenic
976288585 4:83394159-83394181 GTGTGATTATTCCAGCTGTCTGG + Intergenic
977332022 4:95648421-95648443 TTGTAATTATTTTAGGACACAGG - Intergenic
979431203 4:120633713-120633735 TGCTTATTATTTTAGCTCACAGG + Intergenic
980012645 4:127614254-127614276 GTGTGAGTGTTTTGTCTCACTGG - Intergenic
982944936 4:161609220-161609242 GTCTTCTTGTTTTAGCTCACAGG + Intronic
984557527 4:181233226-181233248 GTTTGATTTTGTTTGCTCACTGG + Intergenic
986393692 5:7306978-7307000 CTGTGATTATTTTATCTTATTGG - Intergenic
989995129 5:50820105-50820127 TGCTGATTATTTTAGGTCACTGG + Intronic
990066254 5:51718538-51718560 AAGTGATTACTTTAGCTCACGGG + Intergenic
990350866 5:54914506-54914528 GGGAGATTATTCTAGCTCTCTGG + Intergenic
990609789 5:57445614-57445636 GTGTGACTATTTTAGCTCACAGG + Intergenic
992205611 5:74427755-74427777 CTGTGAATATTTTATCTTACAGG - Intergenic
993182255 5:84568928-84568950 TTGTGATTTTTTTAAATCACTGG - Intergenic
994602568 5:101924994-101925016 AGGTAATTATTTTAGCTCAAAGG + Intergenic
995001483 5:107136135-107136157 GTGTCATGATCTTGGCTCACTGG - Intergenic
995085872 5:108108754-108108776 GTGTGAGTCTTTTGGCCCACTGG - Intronic
995137802 5:108699151-108699173 GTGTGTTTATGTTAGGACACTGG - Intergenic
998884756 5:146682694-146682716 GTGTTACTATTATAGCACACTGG + Intronic
1005140307 6:22624114-22624136 GTGTGAGTCTTTTTGTTCACAGG - Intergenic
1005676840 6:28163648-28163670 GTTTGTTTGTTTTACCTCACAGG + Intergenic
1005768470 6:29039271-29039293 GTGTCATGATCTTGGCTCACTGG + Intergenic
1006661636 6:35650857-35650879 GTATGATCATTTTAGAGCACTGG + Intronic
1008180638 6:48323884-48323906 GTATTATTATTTTAGACCACTGG + Intergenic
1008356575 6:50561341-50561363 CTGTGTTTATTTTAGCACTCAGG + Intergenic
1009694387 6:67081716-67081738 GTGTGAATAATTTAACTCAAAGG - Intergenic
1010909283 6:81533881-81533903 ATGTGTTCATTTTAGCTGACTGG - Intronic
1011644519 6:89445327-89445349 GTGGCATGATCTTAGCTCACTGG + Intronic
1012490008 6:99771982-99772004 GTGTTATTATTTTACCTGTCTGG - Intergenic
1012759003 6:103273006-103273028 GTGTGTTAATTTTATCTCACTGG + Intergenic
1013731750 6:113176404-113176426 GTGTGATTAGTTTTGGTCAAGGG - Intergenic
1014959508 6:127665470-127665492 CTGTGATTATTTTAGATGACTGG + Intergenic
1015485983 6:133770323-133770345 ATATGATTTTTTTAGCACACTGG + Intergenic
1022748231 7:33194909-33194931 TGGTGATTATGTTATCTCACTGG - Intronic
1026821133 7:73549769-73549791 GTGTCATGATCTCAGCTCACTGG - Intronic
1027580770 7:79992295-79992317 GTGTGATTACTTGAGCTGACAGG - Intergenic
1027897196 7:84060842-84060864 GAGTGATTATTTTATCACACAGG + Intronic
1031715072 7:125098901-125098923 TTGTGATTATTATTCCTCACAGG + Intergenic
1032214598 7:129948212-129948234 GTGGCATGATCTTAGCTCACTGG + Intronic
1034733110 7:153405063-153405085 CTGTGATTATCTGAGCTGACGGG + Intergenic
1036133502 8:6138185-6138207 GGCTTATTATTTTAGCTAACTGG - Intergenic
1041511377 8:58658814-58658836 GTGAGACCATTTTAGCTCAAGGG + Intronic
1046393092 8:113602514-113602536 GTGTGATGAGTGTGGCTCACAGG - Intronic
1046448819 8:114360078-114360100 GTGAGATTATTTTGTTTCACAGG - Intergenic
1047783341 8:128128842-128128864 GTGACATGATCTTAGCTCACTGG + Intergenic
1052141133 9:24985808-24985830 GTGTGATTATTTTTGCTCTTTGG - Intergenic
1053054333 9:34985431-34985453 CTTTAATTTTTTTAGCTCACAGG + Intergenic
1054838501 9:69707518-69707540 ATGTGATTATTTTTGCTCCAAGG + Intergenic
1056064863 9:82923585-82923607 GTGTTATTGTTTTCCCTCACAGG + Intergenic
1058237405 9:102507786-102507808 ATGTAATTGTTTTAGCTGACAGG - Intergenic
1058369121 9:104244349-104244371 GTGGCATGATCTTAGCTCACTGG + Intergenic
1060625091 9:125104897-125104919 GTGGCATTATCTCAGCTCACTGG - Intronic
1203631572 Un_KI270750v1:76110-76132 GTGTCATGATCTAAGCTCACTGG - Intergenic
1185826170 X:3252964-3252986 GTGTGATAAATTTAGCTAAGAGG + Intergenic
1186634909 X:11392422-11392444 GTGGGTTTCTTTGAGCTCACTGG - Intronic
1187745945 X:22409462-22409484 ATGTGATCTTTTTAGCTCAGTGG + Intergenic
1191053154 X:56215762-56215784 GTGGCATGATCTTAGCTCACTGG - Intergenic
1192725173 X:73742843-73742865 GTCTGATTATTTTATCACCCAGG + Intergenic
1193573744 X:83175467-83175489 GTTTGCTAATTTTGGCTCACTGG + Intergenic
1193882744 X:86944481-86944503 GTGAGATTATTTAAGCTAACTGG + Intergenic
1194955161 X:100170361-100170383 GTATGATTATTTCAGCTTATTGG + Intergenic
1195327950 X:103773407-103773429 ATGTGATTATTTTGGCTTCCAGG + Intergenic
1195800125 X:108699576-108699598 GTGTAATGATTTGAGCTCATTGG + Intergenic
1198895181 X:141446231-141446253 GTTTGATTATTTCATCACACAGG + Intergenic
1199268964 X:145860651-145860673 ATGTGATTATTTTAATTAACAGG - Intergenic
1201785481 Y:17772528-17772550 GTTTGATTATATTAAGTCACAGG - Intergenic
1201816072 Y:18133459-18133481 GTTTGATTATATTAAGTCACAGG + Intergenic