ID: 1183793670

View in Genome Browser
Species Human (GRCh38)
Location 22:40097061-40097083
Sequence CTGGTGATGGGTGAGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 373}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183793660_1183793670 1 Left 1183793660 22:40097037-40097059 CCTGCCCCATCAGGGGAGTTCAC 0: 1
1: 0
2: 0
3: 4
4: 112
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793654_1183793670 11 Left 1183793654 22:40097027-40097049 CCCATCCTTACCTGCCCCATCAG No data
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793655_1183793670 10 Left 1183793655 22:40097028-40097050 CCATCCTTACCTGCCCCATCAGG 0: 1
1: 0
2: 5
3: 27
4: 301
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793662_1183793670 -4 Left 1183793662 22:40097042-40097064 CCCATCAGGGGAGTTCACCCTGG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793659_1183793670 6 Left 1183793659 22:40097032-40097054 CCTTACCTGCCCCATCAGGGGAG 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793661_1183793670 -3 Left 1183793661 22:40097041-40097063 CCCCATCAGGGGAGTTCACCCTG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793664_1183793670 -5 Left 1183793664 22:40097043-40097065 CCATCAGGGGAGTTCACCCTGGT 0: 1
1: 0
2: 2
3: 10
4: 93
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373
1183793653_1183793670 12 Left 1183793653 22:40097026-40097048 CCCCATCCTTACCTGCCCCATCA 0: 1
1: 0
2: 3
3: 41
4: 453
Right 1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG 0: 1
1: 0
2: 3
3: 31
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183793670 Original CRISPR CTGGTGATGGGTGAGGTGTC AGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900626800 1:3612040-3612062 CGGGAAGTGGGTGAGGTGTCAGG - Intergenic
901919109 1:12523606-12523628 CTGGAGATGGGAGAGGAGTTGGG + Intergenic
902066545 1:13692860-13692882 CTGGGGAGGGGTGAGGTGGCAGG + Intergenic
902097354 1:13957679-13957701 GTGGGGATGGGTGAGATGTGAGG + Intergenic
903554936 1:24186633-24186655 CTACTGATGAGTAAGGTGTCAGG - Intronic
903794436 1:25918254-25918276 CTGGGGGTGGCTGGGGTGTCAGG + Intergenic
904465669 1:30705867-30705889 ATCATGATGGGTGAGGAGTCTGG - Intergenic
906085210 1:43127125-43127147 ATAGTGATGAATGAGGTGTCTGG + Intergenic
908512331 1:64859425-64859447 CTGGTGATGGGCAATGTGTGAGG - Intronic
909169853 1:72282061-72282083 CTGGGGATGAGTGAACTGTCAGG - Intronic
910657883 1:89636617-89636639 TTGGTCAAGGGTGAGGTGTGTGG - Intronic
911294995 1:96104254-96104276 CTGGTGATGAGTGATTTATCAGG - Intergenic
912297829 1:108487171-108487193 CTGCTCATGGGTCAGGGGTCAGG - Intergenic
913315755 1:117549918-117549940 CCAGTGATGGCTGAGGTGTCAGG + Intergenic
913368479 1:118069420-118069442 CTGATGATGGATTAGGTATCAGG + Intronic
913607318 1:120477934-120477956 CTCGTGATGAGTGAGGGGACTGG + Intergenic
913669545 1:121083083-121083105 ATGGTGCTGGGTTAGGTGACAGG + Intergenic
914000410 1:143689940-143689962 CTTATGATGAGTGAGGGGTCTGG - Intergenic
914021302 1:143870482-143870504 ATGGTGCTGGGTTAGGTGACAGG + Intergenic
914209117 1:145562205-145562227 CTCGTGATGAGTGAGGGGACTGG - Intergenic
914268037 1:146054571-146054593 CTCGTGATGAGTGAGGGGACTGG - Intergenic
914369060 1:147006288-147006310 CTCGTGATGAGTGAGGGGACTGG + Intergenic
914503411 1:148266695-148266717 CTCATGATGAGTGAGGGGTCTGG + Intergenic
914510352 1:148327232-148327254 CTCATGATGAGTGAGGGGTCTGG - Intergenic
914583875 1:149043904-149043926 CTTGTGATGAGTGAGGGGACTGG - Intronic
914659793 1:149778400-149778422 ATGGTGCTGGGTTAGGTGACAGG + Intergenic
914760796 1:150596441-150596463 CTGGGGAGGGGTGAGGTGGTTGG + Intergenic
915004127 1:152621226-152621248 TGGGTGTTGGGTGAGGTTTCTGG - Intergenic
915097586 1:153474331-153474353 CTGAGGCTGGGAGAGGTGTCAGG - Intergenic
915756105 1:158261531-158261553 ATCATGATGGGTGAGGAGTCTGG + Intergenic
915809033 1:158886798-158886820 CTGCTCAGGGGTCAGGTGTCAGG - Intergenic
916381472 1:164216723-164216745 CTGCTCATGGGTCAGGGGTCAGG - Intergenic
917190122 1:172407772-172407794 TTGGTGATGGGGGTGGTCTCCGG - Exonic
918024984 1:180734448-180734470 ATCATGATGGGTGAGGGGTCTGG + Intronic
918783622 1:188733987-188734009 ATCGTGATGGATGAGGGGTCTGG + Intergenic
919919728 1:202160772-202160794 CTGGGAATGGGTGAGGGGCCAGG + Exonic
919958789 1:202445110-202445132 ATGGTAATGGGTGAGGTAGCAGG - Intronic
920578905 1:207086071-207086093 GTGGTGAAGGGGGAGGTGTTGGG + Intronic
923127268 1:231042829-231042851 ATGGTGATGGGTATGGTGGCGGG - Intergenic
924591015 1:245404414-245404436 CTGGGGATCCCTGAGGTGTCAGG + Intronic
1064351766 10:14583594-14583616 CTGGGGTGGGGTGATGTGTCTGG - Intronic
1065837921 10:29676014-29676036 ATCATGATGGGTGAGGGGTCTGG - Intronic
1066034558 10:31468257-31468279 TTGGTGATGGGTGGGGGGTGTGG - Intronic
1066317021 10:34258273-34258295 CTGGAGATGGGAGAGGGGTCAGG + Intronic
1067428429 10:46226497-46226519 CTGGTGGTGGGTGTGGGGTGGGG + Intergenic
1067798104 10:49335362-49335384 CTGGAAAAGGGTGAGGTTTCAGG - Intergenic
1072019798 10:91387051-91387073 CTAGGGGTGGGTGGGGTGTCTGG + Intergenic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074410671 10:113225769-113225791 CTGGAGATGGGAGATGTGTTAGG + Intergenic
1074705373 10:116125180-116125202 CTGGTGATTAATGAGGTGACAGG - Intronic
1075067240 10:119297384-119297406 CTGCAGATGGGTGAAGAGTCTGG + Intronic
1075081110 10:119384492-119384514 CTGATGATGGGCGAGGTGTTAGG + Intronic
1075952876 10:126497190-126497212 CTGCTGATGGGAAAGGTGGCAGG + Intronic
1076171253 10:128322047-128322069 CTAGGGAGGGATGAGGTGTCAGG + Intergenic
1076207555 10:128615257-128615279 GTGGTGCTGGGTGAGGGGCCTGG + Intergenic
1076618420 10:131771672-131771694 GTGGTGATGGGTGCAGTGACAGG + Intergenic
1077260040 11:1612536-1612558 CTGGTGATGGGGGTGGGGGCTGG - Intergenic
1077490866 11:2860368-2860390 CTGGGGATGGGTGGGCTGTGGGG - Intergenic
1078494258 11:11800229-11800251 ATGGTGATGTGATAGGTGTCGGG + Intergenic
1078719891 11:13874781-13874803 CTGGTGGTGGGTGTGGTGGGTGG + Intergenic
1079237711 11:18701650-18701672 CTGGTGATGGCAGCGCTGTCGGG + Exonic
1079499475 11:21086511-21086533 CTGGTGGTGGGTGAAGATTCCGG - Intronic
1079641221 11:22807852-22807874 ATCATGATGGGTGAGGGGTCTGG + Intronic
1081729229 11:45357257-45357279 TTGTTGATGGGTGAGCTGTGGGG - Intergenic
1083402165 11:62431074-62431096 TTGATGATGGGTGAGGGGTTTGG - Intergenic
1083451492 11:62748968-62748990 CTGGGAATGTGTGAGGAGTCTGG - Intronic
1084755938 11:71238651-71238673 GTGGTGATGGGTGATCTGCCTGG - Intronic
1084949035 11:72654578-72654600 CTGATGAGGGGAGAGATGTCTGG - Intronic
1085304581 11:75477824-75477846 CAGGGGAAGGGTGAGGAGTCAGG + Intronic
1087153222 11:94877321-94877343 CTGGGGGTGGGTGAGGAGACAGG - Intergenic
1087502997 11:98983444-98983466 CTGTTGATGGGTGGGGCGTGGGG - Intergenic
1088812584 11:113401531-113401553 ATGGTGAGGGGTGGGTTGTCTGG + Intergenic
1089008889 11:115116400-115116422 CTAGTGGTGGGTTAGGAGTCAGG + Intergenic
1089813546 11:121152109-121152131 CTGGTGAAGGGTGTGGGCTCTGG - Intronic
1092255451 12:6924644-6924666 CTGAAAATGGCTGAGGTGTCAGG - Intronic
1092536499 12:9393128-9393150 CCAGTGATGTGTGAGTTGTCTGG + Intergenic
1094436193 12:30423359-30423381 ATTGTGATGGGTGAGGGGTCTGG - Intergenic
1094598487 12:31887414-31887436 ATCATGATGGGTGAGGGGTCTGG - Intergenic
1095570254 12:43675876-43675898 CTGGCGATGGGTGGGGTGTGTGG - Intergenic
1095954492 12:47798473-47798495 CTTGTGAGGGGTGAGGTGGGAGG - Intronic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096898389 12:54848174-54848196 ATGGTGAGGAGTGAGGAGTCTGG + Intronic
1098437496 12:70483430-70483452 TTCATGATGGATGAGGTGTCTGG + Intergenic
1099730638 12:86495861-86495883 ATCATGATGGGTGAGGGGTCTGG - Intronic
1100432949 12:94546780-94546802 CTGGGGAAGGGTGAAGTGTGAGG + Intergenic
1101042527 12:100771349-100771371 CTGGAGATAGCTGAGCTGTCAGG + Intronic
1101882573 12:108635371-108635393 CTGGGGAAGGGTGAGGGGCCTGG - Intergenic
1102392750 12:112562866-112562888 CTGGTGATGGATCAGATGTAGGG - Intergenic
1102590176 12:113950847-113950869 ATGGGGATGGATGAGGTGCCTGG - Intronic
1102924045 12:116813304-116813326 CAAGCGATGGCTGAGGTGTCGGG - Intronic
1103193124 12:119019519-119019541 CTGCTGTTGTCTGAGGTGTCAGG - Intronic
1103240769 12:119411579-119411601 CTTGTGATGGGTGAGGTAAAAGG + Intronic
1103507553 12:121452332-121452354 AAGGAGATGGCTGAGGTGTCTGG + Intronic
1103937804 12:124485809-124485831 CTGGAGACGGCTGAGGTGTGGGG - Intronic
1104114256 12:125734277-125734299 CTGGTGGTGGGAGGGGCGTCAGG + Intergenic
1104125417 12:125841372-125841394 GTCATGATGGGTGAGGGGTCTGG + Intergenic
1104425576 12:128674742-128674764 CTGGTGATTTGTGAGGTTTTTGG + Intronic
1104897433 12:132171312-132171334 GTGGGGATGTGTGGGGTGTCGGG + Intergenic
1104904044 12:132204050-132204072 CGGGTGCTGGGGGAGGTGGCTGG - Intronic
1106192590 13:27466686-27466708 CTGGTGATGTCTGAGCTTTCTGG + Intergenic
1107279813 13:38720818-38720840 CTGGTGAGGAGGGAGATGTCAGG + Intronic
1110253810 13:73409766-73409788 TTGGTGCTGGGTGAGGTGGAAGG + Intergenic
1110520738 13:76473117-76473139 ATCATGATGGGTGAGGGGTCTGG - Intergenic
1110721329 13:78765479-78765501 TTGGTGATGGGACAGGTTTCAGG - Intergenic
1111040491 13:82740861-82740883 CTGTTGATGTGTGAGTTGTTAGG - Intergenic
1111201869 13:84948835-84948857 ATTGTGGTGGGTGAGGGGTCTGG - Intergenic
1111604490 13:90520007-90520029 CTGGTGAAGAGTGAGGGGTGGGG - Intergenic
1112709501 13:102111161-102111183 GTGGTGATGGCTGAGGGGTGTGG - Intronic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113606266 13:111609751-111609773 TTGTTCGTGGGTGAGGTGTCAGG + Intronic
1113640339 13:111952855-111952877 CTAGGGGAGGGTGAGGTGTCTGG - Intergenic
1113881478 13:113629100-113629122 CAGGTGATGGGTGAGGAGCAGGG + Intronic
1113917366 13:113882622-113882644 CTGGGGTTGGGTGGGGTGTTTGG - Intergenic
1113923422 13:113927390-113927412 GTGGAGAGGGGGGAGGTGTCTGG - Intergenic
1117479247 14:56126689-56126711 CTGGTGATGGGTGAGCAATTAGG + Intronic
1120462865 14:84819490-84819512 CTGTTGGTGGGTGAGGAGTGAGG + Intergenic
1120721688 14:87895999-87896021 CAGGTCATGTGTGAGCTGTCGGG - Intronic
1121261035 14:92566345-92566367 CTTCGAATGGGTGAGGTGTCTGG - Intronic
1121717595 14:96087331-96087353 CTGGTAATAGGTGGGGTTTCTGG + Exonic
1122795817 14:104205691-104205713 CTGGGGCTGGGTGAGGTCTGGGG + Intergenic
1122799664 14:104223289-104223311 CTGCTGATGGCTGAGGGGGCAGG + Intergenic
1124567880 15:30833199-30833221 CTGGTGACGTGTGGGGTGCCAGG + Intergenic
1124587796 15:31025622-31025644 AGGGTGGGGGGTGAGGTGTCTGG - Intronic
1124797970 15:32801068-32801090 CAGGTGATGCCAGAGGTGTCAGG - Intronic
1125176418 15:36827469-36827491 CTGGTGAAAGTTGAGGTGTTTGG - Intergenic
1125698582 15:41660304-41660326 CTGGTGTTGGGGGAGGGGTCAGG + Intronic
1126189592 15:45865832-45865854 CTGGAGATGAGTGAGGGTTCAGG + Intergenic
1126492328 15:49251660-49251682 CTGGTGCAGGGTGAGGTGGATGG - Intronic
1126854254 15:52822676-52822698 GTGGTGATTGGTGGGGTGTGGGG + Intergenic
1126877550 15:53060499-53060521 CTGCTAATGGGTGAGGCTTCTGG + Intergenic
1126981542 15:54249819-54249841 CTGAGGAGGGGTGAAGTGTCAGG + Intronic
1128481901 15:68046654-68046676 GTGGTGAGGGGTGAGGGGTGAGG - Intergenic
1128582356 15:68818820-68818842 GTGGTGATGGGGGAGGGGGCCGG - Intronic
1129115899 15:73365305-73365327 CTGGAGCTGGGTGGGGTGTAAGG - Intronic
1129182840 15:73887781-73887803 CTGGGGTGGGGTGGGGTGTCAGG - Intronic
1129919017 15:79302628-79302650 CTGGGGATGAGTGAGCTATCTGG + Intergenic
1130380350 15:83366588-83366610 CTGGGGATGGGGGTGGTGGCGGG + Intergenic
1130702934 15:86204041-86204063 CTTATGATGGATGAGGAGTCTGG + Intronic
1131225955 15:90624503-90624525 CTGGGCATGGCTGAGGTGTCAGG - Intronic
1131396759 15:92092365-92092387 TGGGTGATGGGGGAGGTGCCGGG + Intronic
1131780869 15:95857261-95857283 CTGGTGCTGGGTGAGGGACCAGG + Intergenic
1131940843 15:97563199-97563221 CTGCTGATGGGTGGGATGTGAGG - Intergenic
1132039211 15:98511199-98511221 CAGGTGGTGAGTGAAGTGTCAGG + Intronic
1132406144 15:101542829-101542851 CTGGGGTTGGGTGGGGGGTCAGG - Intergenic
1132789450 16:1677554-1677576 CTTGGGGTGGGTGAGGTGTGGGG + Exonic
1132932466 16:2465925-2465947 CTGGTGCTGGGGCAGGTGTGGGG + Intergenic
1134202685 16:12211900-12211922 CTGGTGTTGGGTGAAATATCTGG + Intronic
1134597361 16:15506608-15506630 ATCGTGATGGTTGAGGAGTCTGG - Intronic
1134792465 16:17001674-17001696 CTGGATATGGGCGAGGTGTCCGG + Intergenic
1134822332 16:17256951-17256973 ATGGAGATTGGGGAGGTGTCAGG - Intronic
1135189818 16:20345615-20345637 CTGGTAATGAGGGAGGTGGCAGG + Intronic
1137772226 16:51025519-51025541 CTGGTGAGGGGTAAGGGGTGGGG + Intergenic
1138495298 16:57405225-57405247 CAGCTGATGAGGGAGGTGTCAGG + Intronic
1138597451 16:58036574-58036596 CTGCTGAGGGGTGAGGTTTGAGG - Intronic
1138606256 16:58091338-58091360 CCGGTGGTGGGTGTGGTGGCGGG - Intergenic
1139344435 16:66293461-66293483 CTGGAGATGGGAGAGGTCTTAGG + Intergenic
1141026348 16:80552284-80552306 GTGGTGATGGGAGAGGAGACAGG + Intergenic
1141292486 16:82732838-82732860 CTGGGGATGAGTGAGGGTTCCGG + Intronic
1141931557 16:87208018-87208040 CTGGTGATGGCAGAGGTGCCTGG - Intronic
1142235659 16:88921416-88921438 CTGGTGACGGATGGGGTGGCAGG + Intronic
1142547128 17:712550-712572 GTAGTGATGTGTGAGGAGTCAGG - Intronic
1142917328 17:3152691-3152713 CTGCTGAGGGGTTAGGGGTCAGG + Intergenic
1144114768 17:12077306-12077328 CTGCTGATGCTGGAGGTGTCCGG + Intronic
1144338175 17:14290826-14290848 GTGTTGATGGGTTCGGTGTCTGG + Intergenic
1144647234 17:16983460-16983482 TTGGTGATGGGTAAGATGTGGGG - Intergenic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1147258214 17:39194661-39194683 CTGGTGCTGGGGGAGGGGCCGGG + Intronic
1147389165 17:40099002-40099024 TTGGTGATGGGGGAGGGGGCCGG + Intronic
1147933493 17:43997501-43997523 CTGGTGAGGAGTGAGCTGGCTGG + Intronic
1148234021 17:45955498-45955520 CTGTAGGTGGGTGAGGTGGCTGG - Intronic
1148598206 17:48873624-48873646 GTGGGGTTGGGTGAGGTGGCAGG - Intergenic
1148740475 17:49889927-49889949 CTGGTGATGTGGGAGGGGGCTGG - Intergenic
1148813901 17:50313011-50313033 CTGGAGATAGGTGTGGTGGCAGG + Intergenic
1149191405 17:54067617-54067639 CTGTTGATGGGTGAGGGGCTAGG - Intergenic
1150117488 17:62566614-62566636 CTGGTGATAGCAGAGGTATCAGG + Intronic
1151278048 17:73050790-73050812 CTGGGGATGGGGGAGGTGAAAGG + Intronic
1151974166 17:77475162-77475184 AGCGTGATGGATGAGGTGTCTGG + Intronic
1152112173 17:78362934-78362956 CAGGTGATGAGTGAGGTGGGAGG + Intergenic
1152806500 17:82359336-82359358 CTGGTGCTGGGTGAGGGGTTGGG + Intronic
1153197837 18:2620310-2620332 CTGGAGATTGGTGTGGTGTGGGG - Intergenic
1153954284 18:10083028-10083050 ATCATGATGGGTGAGGGGTCTGG + Intergenic
1155143345 18:23063334-23063356 CTGGTGAGGGGAGAGGTGAAAGG - Intergenic
1155333405 18:24740605-24740627 CTGGTGATGAGAGAGGTCTTGGG - Intergenic
1155429837 18:25743843-25743865 CTGGTGAGGGGGGATGGGTCAGG - Intergenic
1156063387 18:33109616-33109638 ATGGAGATGAGTGAGGTTTCTGG - Intronic
1156610119 18:38715546-38715568 CTGGAGGTGGGTGAGTTATCTGG + Intergenic
1156719275 18:40049841-40049863 CTGGGGATGGGTGAGTGGTGAGG + Intergenic
1159105133 18:63996003-63996025 ATCATGATGGGTGAGGGGTCGGG + Intronic
1159433940 18:68391602-68391624 GTCATGATGGGTGAGGAGTCTGG - Intergenic
1160258598 18:77268600-77268622 CTGGTGGTGGTTGTGGTGTTTGG + Exonic
1160490785 18:79335401-79335423 CTGGTGATGGGTGAAGAAACAGG - Intronic
1160592653 18:79952586-79952608 CGGGTGAGGGGTGAGGGGTGAGG + Intergenic
1162838230 19:13335806-13335828 CTTGTGCTGGGTGTGCTGTCAGG - Exonic
1163358381 19:16829658-16829680 GAGGTGAGGGGTGAGGGGTCCGG - Intronic
1163375443 19:16927569-16927591 TTGGTGATGGGGCAGGCGTCCGG - Intronic
1164990182 19:32677022-32677044 CTCGGGATGGGTGTGGGGTCTGG + Exonic
1165384226 19:35501109-35501131 CTGGGGCTGGGGGGGGTGTCCGG - Intronic
1166274476 19:41742837-41742859 CTGGTGATGGGGGAGGTGAAAGG + Intronic
1166279370 19:41780774-41780796 CTGGTGATGGGGGAGGTGGAAGG + Intergenic
1167118697 19:47503594-47503616 CAGGTGAAGGGTGAGGGGTAGGG - Intronic
1167382920 19:49149016-49149038 CGGGTCATGGGTTGGGTGTCCGG + Exonic
1167454820 19:49592537-49592559 CTGGGGATAGGTGAAGTGTGAGG - Intronic
1167594141 19:50418524-50418546 CGGGGGATGTGTGAGGTGACGGG - Intronic
1168339391 19:55614703-55614725 CTGGTGCTGGTGGAGGTGACTGG - Exonic
1168535712 19:57167696-57167718 CTTGTGATGGCTTAGGTGTAGGG - Intergenic
1202709204 1_KI270714v1_random:7675-7697 CTCGTGATGAGTGAGGGGACTGG + Intergenic
925006583 2:447742-447764 CTGGTGGTGGGTGAGGTGCCAGG - Intergenic
925574880 2:5350041-5350063 CTGGTGAGGGCTGTGATGTCTGG + Intergenic
927044316 2:19262176-19262198 ATTGTGATGGGGGAGGGGTCAGG - Intergenic
927181386 2:20448598-20448620 GTGGTGATGGGTGAGCGCTCTGG + Exonic
928939479 2:36713137-36713159 TTGGTGGTGGGTGAGGTGGGAGG + Intronic
929002902 2:37365778-37365800 ATGAAGATGGGTGAGGTGGCAGG + Intronic
929138644 2:38648253-38648275 ATCATGATGGGTGAGGTGTCTGG + Intergenic
930026389 2:47031724-47031746 ATGCTGAGGGGTGAGATGTCAGG - Intronic
931165673 2:59745002-59745024 GTGGGGGTGGGTGAGGTGGCGGG - Intergenic
932883066 2:75522365-75522387 CTGGGGAGAGGTGGGGTGTCAGG + Exonic
933695289 2:85213012-85213034 CTGGAAGTGGGTGAGGTGTGGGG + Intronic
935081453 2:99800912-99800934 CTGGGGATGAGTGGGGTGTGTGG + Intronic
935201594 2:100861422-100861444 ATTGTGATGGGTGGGATGTCGGG + Intronic
935233063 2:101116154-101116176 CTGGTAATGGGTGAGGAGGCAGG + Intronic
935658190 2:105442902-105442924 TTGGGGATGGGTGAGATGTGAGG + Intergenic
935794507 2:106628407-106628429 GTCATGATGGGTGAGGGGTCTGG - Intergenic
936820891 2:116519418-116519440 CTGGGGATGGGTGTGGTGGTGGG + Intergenic
939849827 2:147291192-147291214 CTGGTGAAAGGTGAGGAGTTGGG - Intergenic
940680178 2:156775857-156775879 CTGCTCATGGGTCAGGGGTCAGG + Intergenic
940849057 2:158671282-158671304 CTGCTGATAGGTGTGGTTTCTGG - Intronic
942460042 2:176162381-176162403 CTGCTGAGGGATGAGGTGTAGGG + Intronic
943682440 2:190782626-190782648 CTGCTGAGGGGTGAGGTGACAGG - Intergenic
946938085 2:224742629-224742651 ATCATGATGGGTGAGGAGTCTGG - Intergenic
947621522 2:231594090-231594112 CTGGCGTGGGGTGAGGTGGCTGG - Exonic
948381171 2:237550938-237550960 CTGGAGGTGAGTGAGGTCTCTGG - Intronic
949071953 2:242030663-242030685 CTCATGATGGGTGAGGGGTTTGG + Intergenic
1170027862 20:11910056-11910078 CTGGTGATTTGGGAGTTGTCTGG + Intronic
1170473141 20:16688248-16688270 CTGGGGTTGGGAGAGGTGTTTGG + Intergenic
1171357776 20:24563470-24563492 ATTGTGATGGGTGAGGGGTCCGG - Intronic
1172762128 20:37330387-37330409 CTGCTGATGGATGAGGGGTGTGG - Intergenic
1173239810 20:41284500-41284522 CTGGTGAAAGGTGAGGGGTTGGG - Intronic
1174137710 20:48392228-48392250 GTCGTGATGGGTGAGGGATCTGG + Intergenic
1174981690 20:55402624-55402646 ATGGTGATGGCTGAGTTCTCAGG - Intergenic
1175945015 20:62554641-62554663 CTGGTGAGGGCTGGGGGGTCGGG + Intronic
1176250493 20:64118004-64118026 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250536 20:64118158-64118180 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250582 20:64118309-64118331 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250629 20:64118461-64118483 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250706 20:64118706-64118728 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250740 20:64118809-64118831 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1176250803 20:64119013-64119035 CTGATGTTGGGGGGGGTGTCTGG + Intergenic
1177539778 21:22477459-22477481 CTGGGGCTGTGGGAGGTGTCAGG - Intergenic
1177650911 21:23961255-23961277 AAGGTGATGGCTGATGTGTCTGG - Intergenic
1177878211 21:26660670-26660692 GTCATGATGGGTGAGGGGTCTGG + Intergenic
1178920852 21:36737295-36737317 CAGGTGGTGGGTGAGGCGTGGGG - Intronic
1179412083 21:41169300-41169322 CAGGGGCTGAGTGAGGTGTCCGG + Intronic
1179769627 21:43605053-43605075 CGTGTGATGTGTGTGGTGTCTGG - Intronic
1180056354 21:45361151-45361173 CTGGGGCAGGGTGAGGGGTCTGG + Intergenic
1181163995 22:20973858-20973880 CTGGTGAAAGGTGAGCTGTCAGG + Exonic
1183793670 22:40097061-40097083 CTGGTGATGGGTGAGGTGTCAGG + Intronic
1184416054 22:44352512-44352534 GTGGTGGTGAGGGAGGTGTCAGG + Intergenic
1185281243 22:49971006-49971028 CTGGTGACAGGGGAGGAGTCTGG + Intergenic
949465679 3:4340704-4340726 CTGGAGATGGATCAGTTGTCGGG + Intronic
950254634 3:11494306-11494328 ATCATGATGGGTGAGGGGTCTGG + Intronic
950281271 3:11710110-11710132 TTGGTGATGCGTGAGTTCTCTGG - Intronic
951063169 3:18234204-18234226 GAGGTGATGTGTGAGGTGTGTGG + Intronic
952472648 3:33672152-33672174 CTGCTCATGGGTCAGGGGTCAGG - Intronic
953210504 3:40870907-40870929 GTGGTGATGGGTTAGGGGTGTGG - Intergenic
953470688 3:43163550-43163572 CTGGGGATGGGTGAGGAGATGGG - Intergenic
953620114 3:44525852-44525874 GTGGTGGTGGGTGAGGGGCCAGG - Intergenic
954205787 3:49057819-49057841 CTGGTGAACGGTGAGTTGTGGGG + Exonic
954554250 3:51505765-51505787 CTGGAGAGGGGTGTGGGGTCTGG + Intergenic
955558595 3:60164214-60164236 CTGCTGATGTGTTAGGTGTTTGG - Intronic
958090488 3:88870532-88870554 CTGCTCATGGGTCAGGGGTCAGG - Intergenic
958101631 3:89019353-89019375 CTGTTGAGGGGTGAGGGGTTAGG + Intergenic
960131865 3:114065382-114065404 CGTGTGATGGGTGAGGTGTGGGG - Exonic
960572981 3:119203643-119203665 CTGCTGAGGGGTGAGGAGTGAGG + Intronic
961380178 3:126491980-126492002 CTGGGATTGGGTGAGGTGTCTGG - Intronic
961380373 3:126492763-126492785 CTGGGATTGGGGGAGGTGTCTGG - Intronic
962893462 3:139693069-139693091 CTGTTGATGTGTGAGGTTTAAGG + Intergenic
963484456 3:145918595-145918617 CTGCTCATGGGTCAGGGGTCAGG - Intergenic
963948369 3:151170860-151170882 GTGGTGGGGGTTGAGGTGTCTGG + Intronic
965632360 3:170746349-170746371 ATCATGATGGGTGAGGGGTCTGG - Intronic
967334021 3:188322358-188322380 CTGGTGTTGGGTGAGGGAGCAGG + Intronic
968593551 4:1471438-1471460 CTGGGGCTGGCTGAGCTGTCAGG + Intergenic
968731206 4:2270190-2270212 ATGGTGAGGGGTGAGGGGTGAGG + Exonic
968917175 4:3501652-3501674 TTGGGGGTGGGTGAGGTGACGGG + Intergenic
969723725 4:8907226-8907248 CTGGTGATGGCTGGGCCGTCTGG + Intergenic
969977359 4:11117228-11117250 CAGGTGCGGGGTGAGGGGTCTGG - Intergenic
976025978 4:80688375-80688397 CTGCTCATGGGTCAGGGGTCAGG - Intronic
976324612 4:83757175-83757197 CTGGTGGTGGGTGGGGTGCCAGG + Intergenic
977244708 4:94617687-94617709 CTGGTAAGGGCTGAGGTGTCAGG + Intronic
978008530 4:103650214-103650236 CTGGAGCTGGGTGAGGTGGATGG + Intronic
978166640 4:105616579-105616601 CAGGTGATGGGGGAGGGGCCTGG - Intronic
979544415 4:121923299-121923321 CTGGTTCTGGGTGAGGTTTTTGG + Intronic
980878892 4:138689409-138689431 GTGATGATGAGTGAGGTGTCAGG - Intergenic
981269908 4:142833702-142833724 CTGGTGCTGGCTGAGGTGGGAGG - Intronic
983679040 4:170330778-170330800 GTGGTGGGGGGTGGGGTGTCGGG + Intergenic
984474439 4:180217706-180217728 CTGGTCATGGAAGACGTGTCTGG - Intergenic
985245864 4:187979246-187979268 GTCATGATGGGTGAGGGGTCTGG - Intergenic
985283172 4:188306974-188306996 ATCGTGATGGGTGAGGGGTCTGG + Intergenic
985508064 5:295994-296016 CTCATGATGGGTGAGGGGTTTGG + Intronic
985643767 5:1075536-1075558 GTGGTGGTGGCTGAGGTGTGGGG - Intronic
985739971 5:1609675-1609697 CTCATGATGGGTGAGGGGTTTGG - Intergenic
985889302 5:2703237-2703259 CTGGGGCTGGGTGAGTTGTAGGG - Intergenic
986933205 5:12853038-12853060 ATCGTGATGGGTGAGGGGTGTGG + Intergenic
987402824 5:17495679-17495701 CTGGAGATGTGTGAGATGTGGGG - Intergenic
987928228 5:24368300-24368322 CTGGTGAGGGAAGAGGTGACAGG - Intergenic
988348486 5:30070221-30070243 CTGGGGGTGGCTGAGGTGTGGGG - Intergenic
989470270 5:41808654-41808676 CTGGGGATGAGTGAGGAGACAGG + Intronic
989976150 5:50589360-50589382 CTGGTGATAGGGGTGGTGTGGGG - Intergenic
990965951 5:61447981-61448003 ATTGTGATGGGTGAGGGGTCTGG + Intronic
991377423 5:65980277-65980299 GTGGTGTTGGGTGCGGTGTCGGG + Intronic
992932281 5:81661001-81661023 CTGTTGAGGGGTGGGGGGTCAGG + Intronic
993979438 5:94527029-94527051 ATTCTGAGGGGTGAGGTGTCAGG - Intronic
994187243 5:96828736-96828758 CTTGGGATGAGTGAGGGGTCTGG + Intronic
994979269 5:106852383-106852405 CTGGTGATGGGTGTAATGTAGGG + Intergenic
995767325 5:115632741-115632763 TTGGTGATGGGTGAAGTTTGAGG + Intronic
995771462 5:115675216-115675238 CTGCTGAGGGGTCAGGGGTCAGG - Intergenic
996336997 5:122395043-122395065 ATAGTGATGAGTGAGGTGACTGG - Intronic
996658301 5:125967762-125967784 GTCATGATGGGTGAGGGGTCTGG + Intergenic
998696317 5:144643928-144643950 CTGGTGAGGGGTGGGGGGTGAGG - Intergenic
1000068069 5:157713660-157713682 TGGATGATGTGTGAGGTGTCTGG - Intergenic
1000267658 5:159653163-159653185 CTGGAGATGGGTGAGGGGCAGGG - Intergenic
1000459962 5:161502944-161502966 CTGGAGATGTGTGAGCTGACTGG + Intronic
1002278079 5:178115890-178115912 CTGGAGAGGGGTGAGGGGACTGG + Intronic
1002780360 6:360440-360462 CTGGTGATTGTTGAGGACTCTGG + Intergenic
1003513400 6:6800014-6800036 GTGGTGAGGGGTGGGGAGTCGGG + Intergenic
1004060144 6:12187424-12187446 CAAGGGATGGGTGAGGTGCCAGG - Intergenic
1004172045 6:13302736-13302758 CTGGTGAGGGGTGTGGGGTGTGG - Intronic
1004567552 6:16813003-16813025 ATCATGATGGGTGAGGGGTCTGG - Intergenic
1005688293 6:28276792-28276814 CTGATGGTGGGTGAGGAGTAAGG - Exonic
1006904112 6:37521587-37521609 CTGGGGAAAGGTGAGGTGTCAGG - Intergenic
1006910635 6:37561327-37561349 CTGGTTCTGGGTTAGGTGTGTGG + Intergenic
1007400820 6:41601317-41601339 CTGGGGCTGGGGGAGGTGTCAGG - Exonic
1010989293 6:82461695-82461717 GTCATGATGGGTGAGGGGTCTGG - Intergenic
1012226578 6:96710417-96710439 CTGAAGTTGGGTGAGGGGTCTGG + Intergenic
1012256271 6:97036549-97036571 GTGATGATGGGTGGGGTGTGTGG + Intronic
1012638136 6:101573169-101573191 GTGGTGATGGTTGTGATGTCTGG + Intronic
1014120728 6:117721995-117722017 CTGCTCAGGGGTCAGGTGTCAGG - Intergenic
1014130850 6:117830327-117830349 ATGGTGATGGGTGGGCTCTCTGG + Intergenic
1017168340 6:151431415-151431437 CTGGTGGTGGGTGAGCAGGCAGG + Intronic
1017313657 6:153002979-153003001 CGGTTGATGGGTGACGTGTTTGG + Intergenic
1017522714 6:155216125-155216147 GTGGTGATGTGGGAGGTGTCTGG + Intronic
1017667114 6:156730750-156730772 CTGGTGATAGGTGAGGTGTTTGG - Intergenic
1020417241 7:7960307-7960329 TTAGTGATGGGTGAGGACTCAGG + Intronic
1021433040 7:20583229-20583251 CTGGTAAAGACTGAGGTGTCAGG - Intergenic
1022244444 7:28544799-28544821 CTGGAGAGGTGGGAGGTGTCAGG + Intronic
1026854147 7:73742320-73742342 CTGGTGGAGGGTGGGGTGTATGG - Intergenic
1027318329 7:76997735-76997757 GTGGTGGTGTGTGGGGTGTCTGG + Intergenic
1028163714 7:87514417-87514439 CTGGGGATGAGGGAAGTGTCTGG - Intronic
1028446606 7:90931564-90931586 CTGGTGAGAGGTGATGTGTATGG + Intronic
1029458116 7:100681098-100681120 CTGAGGCTGGCTGAGGTGTCCGG - Exonic
1030523467 7:110626964-110626986 CTGGAGTTGGGTCAGGTTTCAGG + Intergenic
1031000502 7:116409558-116409580 CTGCTCATGGGTCAGGGGTCAGG - Intronic
1031122603 7:117738685-117738707 GTGGTGATGGGTTATGTTTCAGG + Intronic
1031642000 7:124176040-124176062 ATGGTGTTGGGGGAGGGGTCTGG + Intergenic
1032083695 7:128872820-128872842 CTGGTGATGGGGGAGGAGGGAGG - Intronic
1034129578 7:148702690-148702712 ATGGTGATGTGTGAGCCGTCAGG - Intronic
1034233135 7:149548261-149548283 ATCATGATGGGTGAGGGGTCTGG - Intergenic
1034574549 7:151985804-151985826 CTGGATGTGAGTGAGGTGTCTGG + Intronic
1035219306 7:157396484-157396506 ATGGTGCTGGGTGGGGTGCCTGG - Intronic
1035231259 7:157467408-157467430 CTGCTGAGGGGGGTGGTGTCTGG + Intergenic
1035260234 7:157656478-157656500 CTGCTGATGCGTGACGTGTGCGG + Exonic
1035400804 7:158564449-158564471 TTGGTGATGGGGGTGGTGCCTGG - Intronic
1035574803 8:697588-697610 CTGAGGGTGGGTGAGGGGTCAGG + Intronic
1035713937 8:1739497-1739519 CTGGTGTGGTGGGAGGTGTCTGG + Intergenic
1035713967 8:1739624-1739646 CTGGTGTGGTGGGAGGTGTCTGG + Intergenic
1037328341 8:17717833-17717855 CTGATGATGGGTGTGGTGCCGGG - Intronic
1040574736 8:48641857-48641879 GTGGTGATGGGGGAGGTCTGAGG - Intergenic
1040998989 8:53431033-53431055 AAGGTGAGGGGTGAGGTGTGAGG - Intergenic
1041806028 8:61850434-61850456 CTGCTCAGGGGTGAGGGGTCAGG + Intergenic
1042020401 8:64368373-64368395 CTGCTGATGGATGAGGTGTCAGG - Intergenic
1042338958 8:67658803-67658825 TTGGTGATGGATGAGATGTTGGG - Intronic
1042483862 8:69330959-69330981 CTCATGACGGGTGAGGGGTCTGG + Intergenic
1043469016 8:80543630-80543652 CTGGTGATGGGTCAGGGGCGGGG + Intergenic
1043750969 8:83933720-83933742 ATGGAGATGAGTAAGGTGTCAGG + Intergenic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1044211617 8:89557645-89557667 CTGCTGGGGGGTCAGGTGTCAGG + Intergenic
1045554988 8:103207089-103207111 CTGGGGATGGGTGCAGGGTCAGG + Intronic
1046187127 8:110735250-110735272 CTGGTTTGGGGTGAGGTGGCCGG - Intergenic
1046919128 8:119709029-119709051 CTAGGGATGGGTTGGGTGTCAGG - Intergenic
1049227588 8:141464861-141464883 CTGTTGAAGGTTCAGGTGTCTGG - Intergenic
1049385902 8:142342865-142342887 CAGGTGCTGGGACAGGTGTCCGG - Intronic
1049731656 8:144181313-144181335 CCGGTGATGGGGGAGGGGCCTGG + Intronic
1056681467 9:88722809-88722831 CTGGTGAGGGGGGAGGTGAAAGG - Intergenic
1056722411 9:89083100-89083122 GTGGTGATGGGTTTGGTGTGTGG - Intronic
1057468479 9:95337458-95337480 CTGGTGGGGGCTGAGGTGGCAGG - Intergenic
1058496349 9:105563062-105563084 CTGGGGCTGGAGGAGGTGTCAGG + Intronic
1060105342 9:120869631-120869653 GTGGAGATGGGTTTGGTGTCGGG - Intronic
1060151337 9:121290190-121290212 CTGGTGATTGGGCAGGTGCCTGG + Intronic
1061151739 9:128832563-128832585 TTGGTGCTGGGTGTGGTGGCTGG - Intergenic
1061991284 9:134160049-134160071 CCGGTGGTGGGGGTGGTGTCTGG + Intergenic
1203772718 EBV:57787-57809 CTGGCGCGGGGTGGGGTGTCGGG + Intergenic
1185633345 X:1533159-1533181 GTGGTGATGTGTGAGATTTCAGG - Intronic
1185776720 X:2809141-2809163 CAGGAGAAGAGTGAGGTGTCAGG + Intronic
1185884947 X:3774174-3774196 TTGGTAATGGGTGAGTTCTCTGG - Intergenic
1187293387 X:17976505-17976527 CTGGAGATGGGAGGGGTGCCAGG - Intergenic
1187794123 X:22982697-22982719 CAAGTAATTGGTGAGGTGTCAGG - Intergenic
1188187129 X:27129552-27129574 GTCATGATGGGTGAGGGGTCTGG - Intergenic
1188553924 X:31390598-31390620 TTGGTGATGGATTAGATGTCAGG - Intronic
1189966532 X:46379157-46379179 ATGATGATGGATGAGGGGTCTGG + Intergenic
1190545088 X:51517628-51517650 CTGCTGAGGGGTCAGGGGTCAGG + Intergenic
1190546844 X:51536874-51536896 CTGCTGAGGGGTCAGGGGTCAGG + Intergenic
1192753150 X:74015928-74015950 ATGGTGATGTGTGTGATGTCAGG + Intergenic
1192955875 X:76069502-76069524 CTGCTGAGGGGTCAGGGGTCAGG - Intergenic
1193064532 X:77244967-77244989 CTGCTTGTGGGTCAGGTGTCAGG - Intergenic
1193347794 X:80424108-80424130 CTGGAGATGGGTGTTGTGTGGGG + Intronic
1196909265 X:120469093-120469115 CTAGTCCTGGGTGAGTTGTCGGG - Exonic
1197913861 X:131513991-131514013 CTGGTGAAGAGTGAGGGGTGGGG + Intergenic
1201418811 Y:13776013-13776035 CTGCTCATGGGTCAGGGGTCAGG + Intergenic