ID: 1183798060

View in Genome Browser
Species Human (GRCh38)
Location 22:40137348-40137370
Sequence CCTCTGGAGTCAGACAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1467
Summary {0: 1, 1: 4, 2: 53, 3: 301, 4: 1108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183798060_1183798066 17 Left 1183798060 22:40137348-40137370 CCAGGCCTGTCTGACTCCAGAGG 0: 1
1: 4
2: 53
3: 301
4: 1108
Right 1183798066 22:40137388-40137410 TCCATCCTGGACAAGTTACACGG 0: 1
1: 0
2: 1
3: 8
4: 132
1183798060_1183798065 4 Left 1183798060 22:40137348-40137370 CCAGGCCTGTCTGACTCCAGAGG 0: 1
1: 4
2: 53
3: 301
4: 1108
Right 1183798065 22:40137375-40137397 AGTAGTTCAATACTCCATCCTGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183798060 Original CRISPR CCTCTGGAGTCAGACAGGCC TGG (reversed) Intronic
900126420 1:1070812-1070834 CCTCTGGCTGCAGACAGGCTGGG - Intergenic
900438278 1:2641544-2641566 CCTGTGCAGGCAGCCAGGCCGGG - Exonic
900561415 1:3308960-3308982 GATCTGGAGTCCGCCAGGCCCGG + Intronic
900589087 1:3451791-3451813 GCTTTGGCGTCAGACAGACCTGG + Intergenic
900655682 1:3755667-3755689 CCTCAGGAGGCAGACAGTCCCGG - Intronic
900902089 1:5523999-5524021 ACTCTCGAGTCAGACACTCCTGG + Intergenic
900902235 1:5524976-5524998 ACCCTGGAGTCAGACACTCCTGG - Intergenic
901027534 1:6286523-6286545 GCTTTGGAGTCAGATGGGCCTGG + Intronic
901632806 1:10656139-10656161 CCTCTGGACTAAGGCAGGCTGGG + Intronic
901702564 1:11053496-11053518 TTTCTGGAGCCTGACAGGCCAGG - Intergenic
901758009 1:11453147-11453169 CCTCTGGAGTCAGATGAACCAGG - Intergenic
901905341 1:12404626-12404648 ACTTTAGAGTCAGACAGGCTTGG - Intronic
902103924 1:14017577-14017599 ACTCTGTGGTCAGACAGGCTGGG - Intergenic
902173363 1:14630747-14630769 ACTCTGAAATCAGACAAGCCTGG + Intronic
902257185 1:15197473-15197495 CCTCTTCAGTCAGAGAGGCCGGG - Intronic
902273349 1:15322508-15322530 TAACTGGAGTCAGACAGGCCTGG - Intronic
902373447 1:16019054-16019076 CCTATGGAGACAGGCTGGCCCGG + Intronic
902441482 1:16433011-16433033 CCATGGGAGTCAGACAGGCCTGG - Intronic
902798528 1:18815143-18815165 ACTTTGGAGCCAGAAAGGCCTGG - Intergenic
902815303 1:18913211-18913233 CCCCTGGAGTCAGGCCGGGCCGG + Intronic
902839381 1:19065600-19065622 GCTTTGGTGTCAGACAGTCCTGG - Intergenic
902916516 1:19643323-19643345 CCTCATGAGTCAGACAAGCAGGG + Exonic
903036351 1:20495217-20495239 GCTCTGGAGTCAGACTGCCTGGG + Intergenic
903060603 1:20666130-20666152 GTTTTGAAGTCAGACAGGCCTGG - Intronic
903176918 1:21586955-21586977 CCTCTGGCGTCGGGCAGGGCTGG + Intergenic
903268578 1:22173776-22173798 CCTCTGCAGACAGGCTGGCCAGG + Intergenic
903290624 1:22311874-22311896 CCTCAGAAGTCAGAAAGTCCAGG + Intergenic
903363867 1:22794106-22794128 CATCTGGAGGTAGGCAGGCCAGG - Intronic
903461996 1:23526719-23526741 GCTTTGCAGTCAGACAGGCCTGG - Intronic
903475184 1:23614566-23614588 GCTTTGGAGTCAGAGATGCCTGG + Intronic
903480071 1:23646619-23646641 TCTCTGGACTCAGACAGACTTGG + Intergenic
903488741 1:23711500-23711522 CCTCTGGAGCCAGACTGCCTGGG - Intergenic
903565605 1:24263021-24263043 GATCTGGAGTCAGCCAGCCCGGG - Intergenic
903574980 1:24334043-24334065 AATTTGGAGTCAGGCAGGCCTGG - Intronic
903577142 1:24346084-24346106 GCTTTGGAGTAAGACAGGCTTGG - Intronic
903590541 1:24452612-24452634 CCTTTGGAGTCAGGGAGACCTGG - Intronic
903671904 1:25041016-25041038 GCTCTGGAGACAGACAGTCCTGG - Intergenic
903687450 1:25142358-25142380 GCTCTGCAATCAGACAGGCCTGG - Intergenic
903711439 1:25327875-25327897 GCTCTGGAGTCAGACAGATCTGG + Intronic
903715509 1:25363554-25363576 GCTCTGGAGTCAGACAGATCTGG - Intronic
903790275 1:25888050-25888072 TTTCTGGAGTCAGAAAGCCCTGG + Intronic
903939023 1:26915913-26915935 ACTCTGGAGTCAGACTGGCTGGG + Intronic
903970141 1:27113521-27113543 GCCCTGGAGTCAGTCAGACCTGG + Intronic
904035065 1:27554542-27554564 CTTTGGGAGTCAGACATGCCTGG - Intronic
904085857 1:27907473-27907495 GCTCTGGAGTTAGACAAACCTGG - Intronic
904116896 1:28169528-28169550 ACTCTGTAGTCAGACAAACCTGG + Intronic
904201121 1:28819698-28819720 ATTTTGGAGTCAGAGAGGCCTGG - Intronic
904353012 1:29921132-29921154 GCTATGGAGCCAGACAGACCAGG + Intergenic
904379320 1:30100647-30100669 GCTCTGGAGTCCGGCAGCCCTGG - Intergenic
904384991 1:30135229-30135251 AGGCTGGAGTCTGACAGGCCAGG - Intergenic
904450439 1:30607556-30607578 ACTATGGTATCAGACAGGCCTGG - Intergenic
904461743 1:30684819-30684841 AACCTGGAGTCAGACAGGCTGGG + Intergenic
904497231 1:30893764-30893786 CAGCTGGGGTCAGAGAGGCCAGG - Intronic
904508896 1:30985021-30985043 ACTCTGGAGCCAGACAGCCTTGG + Intronic
904545157 1:31264416-31264438 GCTCTGGAGTCAGAAAGACTGGG + Intronic
904568478 1:31442895-31442917 AGTGTGGAGTCAGGCAGGCCCGG + Intergenic
904575842 1:31504452-31504474 CCTTTGGAGTGAGACAGCCCAGG + Intergenic
904615802 1:31748960-31748982 CCTCTGGAGTCAGGCAGGCCTGG - Intronic
904661570 1:32089450-32089472 CCTTTAGGGTCAAACAGGCCTGG - Intronic
904679844 1:32221791-32221813 TCTTTGGAGTCAAACAGGTCTGG - Intronic
904849194 1:33444397-33444419 CCTCTGGAGACAGACAGACACGG - Intergenic
904914729 1:33961488-33961510 GTTCTGGAATCAGATAGGCCTGG + Intronic
904961735 1:34338667-34338689 ACACTGGAGTCAGACAGGCTGGG + Intergenic
905139014 1:35826121-35826143 GCTCTGGAGTCACACAGACCTGG + Intronic
905237802 1:36561989-36562011 GTTCTGGATCCAGACAGGCCTGG + Intergenic
905250910 1:36647782-36647804 ACTCTGCAGTCACACAGGCATGG - Intergenic
905269070 1:36774867-36774889 ACTTTGGAGTCAGACAGACCTGG + Intergenic
905392243 1:37644236-37644258 ACTTTGGAGTCAGACAAACCTGG + Intergenic
905455530 1:38085624-38085646 GCTTTGGAGTCAGAAAGACCAGG - Intergenic
905489160 1:38329964-38329986 ACTCTGGAGTCAGCCAGACCTGG + Intergenic
905514937 1:38555733-38555755 GCTCTGTGGTCAGACAGGCTTGG - Intergenic
905879414 1:41453950-41453972 GGCCTGGAGTCAGGCAGGCCTGG + Intergenic
905900470 1:41578697-41578719 TCTTTGGAGTCAGATAGGTCTGG + Intronic
905951263 1:41953283-41953305 ACTCTGGAGTCAGACTGCCTGGG + Intronic
906060982 1:42948412-42948434 CATCTGGAGTCTGCCAGCCCTGG - Intronic
906247293 1:44285329-44285351 GCTTTGGAGTCAGACAGAACTGG - Intronic
906258773 1:44370291-44370313 ACCTTGGAGTCAGACAGTCCTGG + Intergenic
906266838 1:44437817-44437839 GTTCTGGAGACAGACAGGCCTGG + Intronic
906279650 1:44544313-44544335 GCTCTGGAGTCAGACAGACCTGG + Intronic
906448238 1:45922137-45922159 CCCCTGGACTCAGCCAGGCTTGG - Intronic
906527828 1:46506737-46506759 GCTCTAGAGTCAGACTGCCCAGG - Intergenic
906636109 1:47411813-47411835 CCTCTGGAGTCAGACCCTGCTGG + Intergenic
906678796 1:47711130-47711152 GCTTTGGAGTCAGACAGACTCGG + Intergenic
906835134 1:49074715-49074737 CCTTTGGAGTGAGACAGAACTGG - Intronic
907078337 1:51598190-51598212 TCTCTGAAGTCAGACAGACCTGG - Intronic
907113269 1:51946922-51946944 GCTTTGGAATCAGACAGACCAGG - Intronic
907170939 1:52463994-52464016 ACTCTGGAGTCAGACAGACCTGG + Intronic
907243761 1:53094514-53094536 TCTCTGGTGTCCCACAGGCCAGG - Intronic
907281719 1:53351380-53351402 GTTTTAGAGTCAGACAGGCCTGG + Intergenic
907340444 1:53731541-53731563 GCTCTGCTGTCAGACAGACCTGG + Intronic
907352639 1:53845492-53845514 ACTTTGGAGCCAGACAGTCCTGG + Intergenic
907357596 1:53889376-53889398 GCTCTGGGGTCAGACAGAGCTGG + Exonic
907366285 1:53963423-53963445 GCTGTGGAGTCAGAAAGACCTGG + Intronic
907374441 1:54024260-54024282 CAGCTTGAGTCAGACAGACCTGG + Intergenic
907408864 1:54270892-54270914 CCTCTGGTGTCACACAGCCTGGG - Intronic
907462025 1:54610777-54610799 GCTCTGGAGCCAGGCAGACCTGG - Intronic
907481951 1:54751063-54751085 ACTCTGGAGTCAGACTGTCTGGG - Intergenic
907667631 1:56447318-56447340 GCTTTGGAATCAGACTGGCCTGG - Intergenic
907691488 1:56671731-56671753 GCTCTGAAGTCAGACAGCCCAGG + Intronic
907734233 1:57096205-57096227 GCTCTGGAGTGAGAAAGGCTTGG - Intronic
907955723 1:59226455-59226477 CCTCGGGAGTCAGACAGACCTGG + Intergenic
908053292 1:60256172-60256194 CCTTTGAAGTCAGCCAAGCCTGG - Intergenic
908104337 1:60825774-60825796 CCTGTGGTGTCAGGCAGGCTGGG - Intergenic
908115227 1:60934063-60934085 CCCCTGCAGTCAGAAAGACCTGG - Intronic
908392360 1:63695334-63695356 TCTCTGGAGTTAGAGAGGCCAGG + Intergenic
908408607 1:63840744-63840766 ACTCTGGAGCCAGACAGACTGGG + Intronic
908415672 1:63911168-63911190 CCTCTGGAGTTAAACATACCTGG + Intronic
908648787 1:66309613-66309635 CCTTTGGAATCAGACAGTCTTGG + Intronic
908830062 1:68169942-68169964 GCTTTGGAGACAGACAGGCTGGG + Intronic
908942212 1:69448947-69448969 CGTCTGGAGTCAGACTGCTCGGG - Intergenic
909020653 1:70427254-70427276 CCTCTGGAGTCAGGCAGTCTGGG + Intronic
909872438 1:80759631-80759653 ATTCTGGAGTCAGCCAGACCTGG + Intergenic
909941815 1:81619837-81619859 ACTCTGGAGTCAGACTGTCTAGG + Intronic
910172067 1:84388030-84388052 GCTCTGCAGTCAGGCAGCCCAGG + Intronic
910287400 1:85570971-85570993 AACTTGGAGTCAGACAGGCCTGG + Intronic
910300565 1:85702512-85702534 GCTCTGGAATTAGACAGACCAGG - Intronic
910482968 1:87678496-87678518 GCTTTGGAGTTAGACAAGCCTGG + Intergenic
910516921 1:88072392-88072414 ACTCTGGAGTCAGACAGACCTGG + Intergenic
910532691 1:88258162-88258184 GCTCTGGAGTCATACAAGTCTGG - Intergenic
910726423 1:90344589-90344611 CCTTTGGGGCCAGACAGGCTTGG + Intergenic
910726592 1:90346386-90346408 CCTTTGGGGCCAGACAGGCTTGG + Intergenic
910746621 1:90581720-90581742 GCTCTGGAGTCAGAAAGATCTGG + Intergenic
911327470 1:96485192-96485214 GCTCTGCAGTCAGACAGTCCAGG + Intergenic
911868182 1:103055118-103055140 ACTCTGGAGTCAGACAGCCCTGG - Intronic
912389277 1:109290785-109290807 GCCTTGGAGTCAGACAGACCTGG + Intergenic
912432879 1:109638760-109638782 AATCTGGAGTCAGATGGGCCTGG - Intergenic
912507159 1:110164223-110164245 GCTGTGAAGCCAGACAGGCCTGG - Intronic
912798823 1:112708082-112708104 AGTTTGGAGCCAGACAGGCCCGG - Intronic
913700798 1:121372624-121372646 TCTTTGGAGTCTGACAGACCTGG + Intronic
914041347 1:144053086-144053108 TCTTTGGAGTCTGACAGACCTGG + Intergenic
914136737 1:144907400-144907422 TCTTTGGAGTCTGACAGACCTGG - Intronic
914247610 1:145897511-145897533 CCTGAGGAGTGAGACTGGCCAGG + Exonic
914340108 1:146753068-146753090 ACTCTGGAGTCAGAGAGCCCTGG - Intergenic
915033517 1:152903891-152903913 GCTTTGCTGTCAGACAGGCCTGG - Intergenic
915076395 1:153311454-153311476 GCTCTGGAGTCAGACAGACCTGG - Intergenic
915177965 1:154032620-154032642 CCTCCTGAGACATACAGGCCAGG + Intronic
915228722 1:154430167-154430189 GCTTTGGAGTCACACAGACCTGG - Intronic
915283075 1:154836019-154836041 CGTCTGGAGGCAGACTTGCCAGG + Intronic
915315876 1:155028965-155028987 GCTCTAGAGTCACACTGGCCAGG - Intronic
915396430 1:155588584-155588606 GCTTTGAAGTCAGACAGACCTGG - Intergenic
915412233 1:155710777-155710799 GCTTTGAAGTCAGACAGACCTGG - Intronic
915432879 1:155880223-155880245 CCTCTGGAGCCAGATTAGCCTGG - Intronic
915511409 1:156388801-156388823 CCAGTGGAGTCAGCCAGCCCGGG + Intergenic
915571197 1:156746123-156746145 CCTAGGGAGTCGGCCAGGCCAGG - Intronic
915728441 1:158035665-158035687 GATTTGGGGTCAGACAGGCCTGG - Intronic
915729097 1:158040380-158040402 ACTTTAGAGTCAGACAGACCAGG + Intronic
915772867 1:158447586-158447608 GCTCTGGAGTCAGACTGCCTAGG + Intergenic
916004993 1:160652074-160652096 ACTCTGGAGTCAGATAATCCAGG - Intergenic
916052034 1:161043171-161043193 CCTCTGGAGTCAGGCAGACCTGG - Intronic
916170993 1:162001543-162001565 GCTCTGGAGGCAGGCAGTCCAGG - Intronic
916497734 1:165360335-165360357 TCACTGGAGGAAGACAGGCCAGG + Intergenic
916520879 1:165562658-165562680 GCTCTGGAGCTAGACAGGCCAGG - Intronic
916549790 1:165839341-165839363 CCTCTGTAGTCAGACAAGGAGGG - Intronic
916558878 1:165915762-165915784 TCTCTGGAGTTAAACAGACCTGG + Intergenic
916722521 1:167495152-167495174 GCTTTGGAGTGAGACAGTCCTGG + Intronic
917740671 1:177959254-177959276 ACTTTGGAGTCAGACAACCCTGG + Intronic
918082120 1:181215743-181215765 CCGCTGGAGACAGCCAGGCATGG - Intergenic
918135737 1:181672602-181672624 TCTCTGGAGCCAGACAGTCTGGG - Intronic
918444107 1:184599009-184599031 GCTTTGGAGTCAGACAGACCTGG - Intronic
918458529 1:184752769-184752791 GCTCTGGGATCAGACAGGCTTGG + Intronic
919123257 1:193366906-193366928 ACTCTGGAGCCAGACCTGCCAGG + Intergenic
919652773 1:200166710-200166732 ACTTTAGAGTGAGACAGGCCTGG + Intronic
919931680 1:202225287-202225309 GCTTTGGAGTCAGAATGGCCTGG + Intronic
919947098 1:202327591-202327613 ATTCTGGAGTCATACATGCCTGG + Intergenic
919955601 1:202411809-202411831 GCTTTGGAGTCAGACAGACCAGG - Intronic
920135264 1:203764214-203764236 AGTCTGGATGCAGACAGGCCAGG + Intergenic
920176784 1:204107057-204107079 CCTCTAGGGTCAGACAGACTTGG - Intronic
920207169 1:204300712-204300734 GCTCTGCAGGCAGACAGACCTGG + Intronic
920210396 1:204323920-204323942 GCTCTGGAGTCAGTCTGCCCAGG - Intronic
920403439 1:205691864-205691886 ACTCTGGAGTCAGACAGATTTGG + Intergenic
920444830 1:206008053-206008075 GCTCCGGAGTCAGGCAGGCTTGG - Intergenic
920488217 1:206391357-206391379 TCTTTGGAGTCTGACAGACCTGG + Intronic
920730312 1:208477236-208477258 CCTCTGGAGTCAGAAAGACTGGG - Intergenic
920740916 1:208580468-208580490 GCTTTGGAGTCAAACAGGCCTGG + Intergenic
920750317 1:208668663-208668685 GGTCTGGAGTCAGATAGACCTGG - Intergenic
921333321 1:214062246-214062268 ACTCTGGAGCCAGACAGACTAGG - Intergenic
921837978 1:219797203-219797225 ACTCTGGAGTCAAGCAAGCCAGG + Intronic
921937812 1:220810831-220810853 ACTCTGAAGTCAGCCAGGCCTGG + Intronic
922038804 1:221875560-221875582 ACTCTGGAGTGAGACAGTCTAGG + Intergenic
922076486 1:222250102-222250124 GGTCTGGAGTCAGACTGTCCAGG - Intergenic
922110956 1:222554788-222554810 TCTATGGAGTCAGAAAGGTCTGG - Intergenic
922140199 1:222877036-222877058 CCTCTGGAGTCAGAGGAGCATGG + Intronic
922492473 1:226029148-226029170 CCTTTGGAGTCACACAGACCTGG - Intergenic
922564219 1:226590683-226590705 CATCTGGAGACAGGCTGGCCTGG - Intronic
923059693 1:230459744-230459766 GCTTTGGAGTCAGACAGTCTGGG + Intergenic
923550070 1:234956941-234956963 GCTCGGGAGTTGGACAGGCCTGG - Intergenic
924414398 1:243844306-243844328 GCTCTGGAGTCAGACAGCCTGGG - Intronic
924600376 1:245483390-245483412 GCTCTGGGGTCAGGCAGACCTGG - Intronic
924625755 1:245695408-245695430 CCTCTGGAGGGAGACAGGCGCGG + Intronic
924644860 1:245868269-245868291 GCTTTGGAGCCAGACAGACCTGG - Intronic
1062826864 10:576377-576399 GTACAGGAGTCAGACAGGCCTGG + Intronic
1063088991 10:2844937-2844959 ACTCTGAAGCCAGACAGGTCAGG + Intergenic
1064391667 10:14947506-14947528 GCTCTGCAATCAGACAGACCTGG + Intronic
1065491751 10:26289347-26289369 CCTCTGTTGTCAGACATGCCTGG + Intronic
1065648859 10:27866320-27866342 GCTCTGGGGTCAGACAGATCTGG - Intronic
1065862197 10:29881426-29881448 CTTCTGGAGCCAGACAGCCGTGG - Intergenic
1066181961 10:32971289-32971311 ACTCTGAAGTCAGGCAAGCCTGG + Intronic
1067456286 10:46421516-46421538 GCTCTGGAGTCAGTCAGACCTGG - Intergenic
1067465756 10:46497673-46497695 CCTCTGGACCCAGACAGCCTGGG - Intergenic
1067580806 10:47444271-47444293 ACTCTGGAGAGACACAGGCCTGG + Intergenic
1067621431 10:47886933-47886955 CCTCTGGACCCAGACAGCCTGGG + Intergenic
1067630913 10:47963123-47963145 GCTCTGGAGTCAGTCAGACCTGG + Intergenic
1067784038 10:49229587-49229609 CCAGTGGAGTCACACAGGCCGGG + Intergenic
1067850205 10:49749814-49749836 CCCCTGGAGCCAGAGGGGCCGGG + Exonic
1068874409 10:61981035-61981057 GCTTTGGAATCAGACAGACCTGG + Intronic
1069513862 10:69062078-69062100 GCTCTGGAGCCAGACAGCCCTGG - Intergenic
1069579055 10:69552657-69552679 GTTCTGGGGTCAGACAGACCTGG + Intergenic
1069614734 10:69799968-69799990 ACTCTGGAGTCAGAGAAACCTGG - Intergenic
1069687308 10:70326492-70326514 CCTCAGGAGGCAGACAGTGCAGG + Intronic
1069707439 10:70467621-70467643 GCTCTGGAGTCAGAGAGGGCTGG + Intergenic
1069818167 10:71211730-71211752 CCCCTGGAATCAGACTGGCTGGG + Intergenic
1069836927 10:71315081-71315103 GCCCTGGAGCCAGACAGACCTGG - Intergenic
1069883973 10:71611693-71611715 CCTCTGGAGGCAGACAGCACGGG - Intronic
1070111327 10:73489643-73489665 GCTCTGGAGTCAGACTGCCTGGG - Intronic
1070154215 10:73823838-73823860 GCTTTGCAGTCAGACAGACCTGG - Intronic
1070248416 10:74752792-74752814 GCTCTGGAGTCAGACAATGCTGG + Intergenic
1070335571 10:75452205-75452227 CCTCAGGAGTGTGACAGCCCAGG - Intronic
1070405302 10:76089267-76089289 GCTTTGGAGTCAGACAGCCCTGG - Intronic
1070461303 10:76673196-76673218 ACTTTGGAGTCAGGCAGACCTGG + Intergenic
1071287685 10:84163940-84163962 ACTTTGGAGTCAGACAGATCTGG + Intergenic
1071366947 10:84909192-84909214 GCTCTGGCGTCAGACAGCCCTGG - Intergenic
1071494457 10:86158189-86158211 CCCTGGGAGTCAGACAGCCCTGG + Intronic
1071528511 10:86372262-86372284 GCCCTGGGGTCAGAGAGGCCAGG - Intergenic
1071760974 10:88606167-88606189 ACTTTGGAGTCAGACAGACTTGG - Intronic
1071785745 10:88897758-88897780 CCTTTGGAGTGAGATAAGCCTGG - Intronic
1071816246 10:89234977-89234999 CCTGTGGTGTCAGACACACCTGG - Intronic
1071816951 10:89241899-89241921 AATCTGTAGTCAGACAGGTCAGG + Intronic
1072425200 10:95324233-95324255 ACCCTGGAGTCAGGCAGGACAGG + Intronic
1072536735 10:96369989-96370011 GTTGTGGAGTCAGACACGCCCGG - Intronic
1072617923 10:97061996-97062018 CCTCTGGAGTCTGATCAGCCTGG - Intronic
1072723122 10:97792901-97792923 CACCTGGAGTCACACAGGCCTGG + Intergenic
1072748026 10:97955476-97955498 TCTCTAGAGTCAGACACACCTGG + Intronic
1073126810 10:101155970-101155992 CCTCTTGAGACAGTCAGGCTGGG + Intergenic
1073327281 10:102650251-102650273 CCTCTGGAGACTGACTGGCCAGG - Intronic
1073719961 10:106157338-106157360 CCCCTGGAGTCAGACTGCCTGGG + Intergenic
1073855239 10:107665790-107665812 GCTCTGGAGTCACACAGACCTGG + Intergenic
1073863895 10:107778839-107778861 ACTATGGAGTCAGAGAGGCTAGG + Intergenic
1074052625 10:109894043-109894065 GCTCTGTACTCAGGCAGGCCTGG - Intronic
1074141339 10:110675708-110675730 CCTTTCAAGTCAGACAGACCTGG + Intronic
1074147616 10:110730515-110730537 ACTTTGGAGTCAGACAGGGTGGG + Intronic
1074438244 10:113452799-113452821 GCTTTGGAGTCAGACTGACCTGG + Intergenic
1074450536 10:113555817-113555839 AATGTGGAGTCAGACAGACCTGG - Intronic
1074502043 10:114034695-114034717 GCTCTGGAGTCAGACTGCCTGGG - Intergenic
1074761314 10:116669403-116669425 GGCCTGGAGTCAGACAGACCTGG + Intronic
1074762326 10:116676296-116676318 CCTGTGGAGTCAGGTTGGCCTGG - Intronic
1074782095 10:116809358-116809380 GCTCCGGAGTCAGACACACCTGG + Intergenic
1075204313 10:120433660-120433682 CCTTTGGAGTCTGACAGACCTGG - Intergenic
1075286052 10:121187062-121187084 GCTCTGGAGTCAGAAAAGTCTGG + Intergenic
1075563058 10:123482383-123482405 GTTCTGGAGTCTGACAGGCCTGG + Intergenic
1075635540 10:124027831-124027853 GCTTTGGGGTCAGGCAGGCCTGG - Intronic
1075676465 10:124299270-124299292 GCTCTGGGGTCAGACAGGCTAGG + Intergenic
1075810305 10:125220244-125220266 CCTCTGGAAGCAGGCAGGACGGG + Intergenic
1076187604 10:128461286-128461308 GCTCTGGAGTCAGGCTGGCAGGG + Intergenic
1076454471 10:130580156-130580178 GCTTTGAAGTCAGACAGCCCAGG + Intergenic
1076561897 10:131372279-131372301 CCCCTGGAGTCAGACATGAGAGG + Intergenic
1077177797 11:1198502-1198524 CCCCCGGAGCCAGGCAGGCCAGG - Intronic
1077196727 11:1284716-1284738 CCTCTGGAGAAAGGCAGCCCTGG + Intronic
1077987468 11:7368059-7368081 CCTCTGGAGTCAGACTACCTAGG - Intronic
1078086851 11:8239132-8239154 ACTCTGGATTCTGACAGGCCAGG - Intronic
1078182441 11:9023656-9023678 GCTCTGGAGTCCCACAGTCCTGG + Intronic
1078436498 11:11329994-11330016 CATCTGGAAACAGACATGCCTGG - Intronic
1078565536 11:12410865-12410887 ACTCTGGCATCAGACAGACCTGG + Intronic
1078652499 11:13208767-13208789 ATTCTGGAATCAGACAGGTCTGG - Intergenic
1078667373 11:13337855-13337877 GCTTTGGAGTCAGACAGAGCTGG + Intronic
1078747618 11:14130194-14130216 GTTCTGGAGTCAGGCAGACCTGG - Intronic
1078747706 11:14131222-14131244 GTTCTGGAGTCAGGCAGACCTGG + Intronic
1078779116 11:14420487-14420509 ACTCCAGAGTCAGACAGGCCGGG + Intergenic
1078846001 11:15119009-15119031 ACTCTGGAGTTAGACAGATCTGG - Intronic
1078858241 11:15224016-15224038 ACTTTGGAGTCAGGCAGACCTGG + Intronic
1078868077 11:15316972-15316994 ACTTTGGAATCAGATAGGCCTGG + Intergenic
1078869092 11:15327471-15327493 ACTTTGGAGTCAGACAGAGCTGG + Intergenic
1078880681 11:15445916-15445938 ACTCTGGATTCAGTCAGACCTGG - Intergenic
1078897030 11:15605886-15605908 CCTCTGGAGTCAGAGGGTGCAGG + Intergenic
1078912830 11:15749342-15749364 TCTCTGGACCCACACAGGCCTGG + Intergenic
1078934037 11:15936721-15936743 GCTTTGGAATCAGACAGACCTGG - Intergenic
1079108186 11:17587710-17587732 CTTCTGGGGTCAGACAGCCAGGG - Intronic
1079133015 11:17760539-17760561 CCCCTGCAGTCCCACAGGCCAGG - Intronic
1080403395 11:31957455-31957477 GCTTTGGAGTCAGACAGGCCTGG - Intronic
1080404457 11:31966714-31966736 ACTCTGGAGTTAAACAGACCTGG - Intronic
1080409680 11:32011851-32011873 CCTGTGGAGCCAGACAGAGCTGG - Intronic
1080765835 11:35295960-35295982 CCTATGGAGTCAGAATGTCCTGG + Intronic
1080847179 11:36036620-36036642 ACTCTGGTGTCAGGCAGCCCTGG - Intronic
1081454948 11:43212395-43212417 CTTCTGGAGCCAGAGAGGCAGGG - Intergenic
1081484312 11:43516105-43516127 CTTCTGGAGCAAGACAGTCCCGG - Intergenic
1081649860 11:44816697-44816719 TCACTGGAGTCAGGCAGGCTCGG - Intronic
1081651228 11:44825426-44825448 GCACTGGAGTCAGACTGACCGGG - Intronic
1081665424 11:44914296-44914318 ACTTTGGAGTCAGAAAAGCCCGG + Intronic
1081722900 11:45303100-45303122 GCTTTGGAGTCAGGCAGACCTGG + Intergenic
1081733586 11:45388333-45388355 CCTCCAGAGTCAGACAGTCCTGG + Intergenic
1082014489 11:47474477-47474499 CCTCTGGAGAATGACAAGCCGGG - Intronic
1082799425 11:57403695-57403717 CCTTGGGAGCCAGACAGACCTGG + Intronic
1082809807 11:57472856-57472878 ACTCTGGAGTCAGACAGACCTGG - Intronic
1082879368 11:58023119-58023141 GCTCTGGAGTCAGACTGGGCTGG + Intergenic
1083158304 11:60839136-60839158 GCTCTGGAATCAGACAGTCTAGG + Intergenic
1083226911 11:61291022-61291044 GCTCTGAAGGCAAACAGGCCTGG + Intronic
1083305639 11:61760834-61760856 CCTCCAGAGTCAAAGAGGCCTGG - Intronic
1083336574 11:61925220-61925242 GCTTTGGAGTCAGACAAACCTGG - Intergenic
1084029075 11:66470367-66470389 CTTCTGGAGTCAGAGAGACTGGG + Intronic
1084203016 11:67574713-67574735 TCTCGGGAGTAAAACAGGCCAGG - Intergenic
1084214470 11:67639967-67639989 CCCCTCCAGTCAGCCAGGCCTGG - Intergenic
1084922728 11:72484231-72484253 GTTCTGGAGCCAGACAGGCTGGG + Intergenic
1085033883 11:73288818-73288840 CCTGAGGAGTCAGACAGGCTGGG - Intronic
1085041758 11:73330961-73330983 CCTCTGGATCCAGGAAGGCCAGG + Intronic
1085156113 11:74296286-74296308 GCTCTGGAATCAGACAGTCCTGG - Intronic
1085191675 11:74631258-74631280 ACTTTGGAGTCAGGCAGACCTGG + Intronic
1085204470 11:74722330-74722352 CCTTTGGAGTCAGATCGGCTGGG + Intronic
1085445739 11:76599470-76599492 CTTCAGGAGTCAGAGAGACCTGG + Intergenic
1085585574 11:77701367-77701389 ACTCTAGAGTCAGAAAAGCCTGG - Exonic
1085726311 11:78957998-78958020 GCTCTAGAGTCAAACAGGCTTGG + Intronic
1085737426 11:79050984-79051006 CGTGTGGAGTCAGATAGACCTGG + Intronic
1085776305 11:79369906-79369928 ACTTTGGAGACAGACAGTCCTGG - Intronic
1085834809 11:79941667-79941689 ACTCTGGAATCAGACAGATCTGG + Intergenic
1086329527 11:85739797-85739819 TCTTTGGAGTCAGACACACCTGG - Intronic
1086371426 11:86159179-86159201 GCTTTGGAGTCTGATAGGCCTGG + Intergenic
1086419588 11:86625493-86625515 GCTCTGGAGTCAAAGAGACCTGG + Intronic
1086495640 11:87402011-87402033 GCTCTGGAGTCAGCTAGACCTGG - Intergenic
1087054360 11:93919156-93919178 CCTCTGGAGTCAGAAAGATGTGG - Intergenic
1087064071 11:94011060-94011082 GCTTTGGAGTCAGAAAGACCTGG + Intergenic
1087105911 11:94406642-94406664 TCTCTGGAATCAGACAACCCAGG + Intergenic
1087136788 11:94729193-94729215 ACTTTGAAGTCAGACAGACCTGG + Intronic
1087176247 11:95098848-95098870 GCTCTGGTGTCAGACAGCTCAGG - Intronic
1087811590 11:102614187-102614209 GCTTTGGAGTCAGACAGAACTGG - Intronic
1087822081 11:102723845-102723867 GCTTTGGAATCAGACAGGCCTGG + Intronic
1088109891 11:106249211-106249233 ACTCTGGAGTAAGACAGACAAGG - Intergenic
1088358507 11:108967738-108967760 GCTCTGGAGTCAGACTGCCTTGG - Intergenic
1088735863 11:112727334-112727356 GCACTGGGGTCAGACAGGCAGGG - Intergenic
1088748208 11:112822313-112822335 GCTTTGGAGTCAGGCAGACCAGG + Intergenic
1088902457 11:114128410-114128432 ACTCTGGAGTCAGACAGTCTGGG + Intronic
1089009901 11:115123733-115123755 GCTTTGGAGTCAGGCAGGCCTGG - Intergenic
1089067254 11:115671119-115671141 GCTCTGGAGTCAGACAGACAGGG + Intergenic
1089120496 11:116131145-116131167 CTTCTGGAGTCAGAAAGACCTGG + Intergenic
1089175926 11:116548907-116548929 GGGCTGGAGTCAGACAGACCTGG - Intergenic
1089360307 11:117881418-117881440 CCTCTGGAGGCAGTCTGGCCTGG - Intergenic
1089360677 11:117884332-117884354 CCTCTTAAGTCAGACTAGCCTGG + Intergenic
1089405572 11:118194671-118194693 GCTGTGGAGTTAGACAGACCTGG - Intronic
1089418455 11:118313498-118313520 GCACTGGAGTCAAACAGCCCTGG - Intronic
1089470323 11:118715340-118715362 CCTGTGGCCTGAGACAGGCCAGG - Intergenic
1090166761 11:124557314-124557336 GCTTTGGAGTCAAACAGCCCTGG + Intergenic
1090239103 11:125169562-125169584 CCACTGGAGTCATGCAGCCCTGG - Intronic
1090276437 11:125423236-125423258 ACTCTAGAGTCAGACTGCCCAGG - Intronic
1090727983 11:129544790-129544812 TCTTTGGAGTGAGACAGACCAGG - Intergenic
1090855088 11:130603905-130603927 GCTTTGGAGTCACACAGGCCTGG + Intergenic
1090859021 11:130636604-130636626 ACTTTGGAGCCAGTCAGGCCAGG - Intergenic
1090924663 11:131238985-131239007 CCTCTGAAGTCAGCCAGGCTGGG - Intergenic
1091894490 12:4090009-4090031 GCTGTGGAGTCAGACGGGACGGG - Intergenic
1091976327 12:4828757-4828779 ACTCTGGAGCCAGACTGCCCAGG - Intronic
1092089379 12:5791615-5791637 TTTCTAGAGTTAGACAGGCCTGG + Intronic
1092262842 12:6961756-6961778 GCTCTGGGGTCAGACAGCCTGGG - Intergenic
1092914328 12:13176130-13176152 ACTTTGGAGTCAGACAGACGAGG - Intergenic
1092950323 12:13497576-13497598 CCTCAGGAGGCTGGCAGGCCTGG - Intergenic
1093247171 12:16754041-16754063 GCTCTGGAGTCAGACAGCCCTGG - Intergenic
1093467830 12:19468293-19468315 CATCTAAAGTCAGATAGGCCAGG - Intronic
1093661186 12:21758911-21758933 ACTTTGGAGTCAGGCAGCCCTGG - Intergenic
1093706656 12:22282185-22282207 CCTTTGAAATCAGACAGGCCAGG + Intronic
1094016818 12:25873697-25873719 TCTCTGGAGTCAGACAAACCTGG - Intergenic
1094195138 12:27741273-27741295 CCTTTGGAGCCAGACAGACATGG + Intronic
1094407161 12:30128582-30128604 CCTCTGGAGTCAGAAGTGCTGGG - Intergenic
1094657572 12:32435290-32435312 GCTCAGGAGTTAGACAGGCCTGG + Intronic
1095540272 12:43301561-43301583 ACTCTGGAGTCAGGCAGCCTGGG + Intergenic
1096235026 12:49920718-49920740 GCTGTGGAGTCAGACTGCCCCGG - Intergenic
1096466607 12:51850169-51850191 GCTCTGGGGTCTGACAGGTCTGG + Intergenic
1096473715 12:51895512-51895534 CCTTTGGAGTCAGACAGACCTGG + Intergenic
1096534409 12:52262093-52262115 TCTCTGGAATCAGACACGCCTGG + Intronic
1096573563 12:52539025-52539047 CCTCTGAAGCCAGAAAGGCTGGG - Intergenic
1096596680 12:52700351-52700373 ACTATGGAGTCACACAGGGCCGG + Intronic
1096841259 12:54380435-54380457 GCTTTGGAGTCAGACTGCCCAGG - Intronic
1097374835 12:58829307-58829329 CCACTGAAGTCATACAGGCCTGG - Intergenic
1097712420 12:62931644-62931666 GCTCTGGAGTCAGACTGCCTGGG + Intronic
1098106797 12:67076129-67076151 ATTCTGGAGTCAGACAGTCTAGG + Intergenic
1098143747 12:67477203-67477225 ACTTTAGAATCAGACAGGCCTGG + Intergenic
1099341579 12:81443295-81443317 GCTCTGGAGTCAGACAGATCTGG - Intronic
1100283281 12:93139029-93139051 GCTTTGGAGTCAGACATACCTGG + Intergenic
1100355499 12:93825300-93825322 ACTCTGGAGCCAGAAAGACCTGG + Intronic
1100397909 12:94200649-94200671 CCTCTTGAGTCAGAAGGGTCTGG - Intronic
1100552584 12:95659586-95659608 CTGCTGGAGTCAGGCAGGCGTGG - Intronic
1100568540 12:95823192-95823214 ACTCTGAAGTCAGACAGACCTGG + Exonic
1100903155 12:99266512-99266534 CCTCTAGAGTCAGACAAACCAGG - Intronic
1101196301 12:102386326-102386348 CCTCTGGAGGCAAATAGACCTGG + Intergenic
1101442233 12:104712518-104712540 CCTTTGGAAACAGACAGACCTGG - Intronic
1101559167 12:105839361-105839383 TTTTTGGAGTCAGACAGACCTGG + Intergenic
1101616465 12:106342753-106342775 GCTCTGGAGTCAGACAGGCTGGG - Intronic
1101654707 12:106709684-106709706 ACTTTGGTGTCAGACAGACCTGG - Intronic
1101724373 12:107376910-107376932 ACTCTGGACTCAGACGGGCCTGG - Intronic
1101811278 12:108110167-108110189 CCTTTGGAGTCAGAAAGACATGG - Intergenic
1101813367 12:108127089-108127111 AATCTGGAGTCAGCCAGACCTGG - Intergenic
1101818314 12:108162795-108162817 ATTCTGGAGTCTGACAGACCTGG + Intronic
1101820915 12:108183789-108183811 GGTCTGGAGTCAGACAGGCCTGG + Intronic
1101897533 12:108767763-108767785 GCTTTAAAGTCAGACAGGCCTGG + Intergenic
1101912303 12:108869261-108869283 ACTCTGGAGTCAGGCAGACTGGG - Intronic
1102023150 12:109697865-109697887 AATCTGGAATCAGCCAGGCCTGG - Intergenic
1102030987 12:109740009-109740031 CCCCTGCAGCCAGACAGGCGAGG + Intronic
1102043636 12:109816288-109816310 CCTTTGGAGTCATTCAGGCCTGG + Intronic
1102169647 12:110832612-110832634 GCTCTGGAGTCAGGAAGACCTGG - Intergenic
1102393698 12:112570051-112570073 GCTCTGAAGTCAGACCAGCCTGG - Intergenic
1102442682 12:112975502-112975524 ACCCTGGAGTAAGAGAGGCCAGG + Intergenic
1102642796 12:114381721-114381743 GCTTTGGAGTCAGACAAACCTGG - Intronic
1102756992 12:115349573-115349595 TGTTTGGAGTCAGGCAGGCCTGG - Intergenic
1103063964 12:117881722-117881744 GCTTTGGAGCCAGACAGGCTGGG - Intronic
1103165019 12:118763050-118763072 GCTTTGGAGTCAGACAGACCTGG + Intergenic
1103220271 12:119238695-119238717 GTTCTGGAGTCAGAAAGGTCTGG - Intergenic
1103220386 12:119239417-119239439 GCTGTGGAGTCAGACAGTTCTGG + Intergenic
1103403746 12:120660391-120660413 CCTCTGCAGTCAGACAGGACTGG + Intronic
1104003303 12:124874292-124874314 AGTCTGGAGCCAGACAGTCCAGG + Intronic
1104354792 12:128075831-128075853 ACCCTGGAGTCAGGCAGGCTGGG + Intergenic
1104965777 12:132508267-132508289 CCCCTGGAGGCAGGCAGCCCCGG + Exonic
1105413610 13:20191842-20191864 CCTCTGGGGACAGCCAGGCAAGG - Intronic
1105643903 13:22295961-22295983 ACTCTGGAGTCAGATAGATCTGG - Intergenic
1105855329 13:24366600-24366622 CCAGTGGAGTCAGGCAGGACAGG - Intergenic
1106024738 13:25946154-25946176 ACTCGGGATTCAGACAGACCTGG - Intronic
1106195948 13:27493920-27493942 GCCCTGGAGTCAGACAGGCAAGG + Intergenic
1106407568 13:29487297-29487319 CCTTTGGAGTCAGACAGACCTGG + Intronic
1106511785 13:30419376-30419398 ACTGTGGTGGCAGACAGGCCTGG + Intergenic
1106570298 13:30921132-30921154 GCCCTGGATTCAGACAGGCTAGG - Intronic
1106934093 13:34699166-34699188 GCTCTGGAGTAAGACAGTCTAGG + Intergenic
1107424511 13:40279619-40279641 TCTCTGGAATCAGATAGACCTGG + Intergenic
1107448211 13:40486656-40486678 CCTCTGGGGACAGACTGTCCAGG + Intergenic
1107638631 13:42418537-42418559 TCTCTGAAGTCAGACAGACCTGG + Intergenic
1107818088 13:44262139-44262161 ACTCGGGAGCCAGACAGCCCGGG + Intergenic
1107823061 13:44303870-44303892 GCTGTGGAGTCAGACAGGCTTGG - Intergenic
1108004166 13:45930925-45930947 ACTTTGGAGTCAGAAAGACCAGG + Intergenic
1108822645 13:54372658-54372680 GCTCTGGAGTCACCCAGGCTGGG + Intergenic
1109220284 13:59634522-59634544 GGTTTGGAGTCAGACAGACCTGG + Intergenic
1110473659 13:75888441-75888463 ACTCTGGAATCAGAGAGACCAGG - Intergenic
1110554415 13:76842499-76842521 CGTCTGGATTCATCCAGGCCTGG + Intergenic
1110596829 13:77328726-77328748 GCTCTGAAATCAGACAGCCCTGG + Intergenic
1110927470 13:81173071-81173093 GCTTTGGAGTCAGAGAGGCCTGG + Intergenic
1111248076 13:85568315-85568337 CCTTTAGAATCAGACAGACCTGG - Intergenic
1111373202 13:87344382-87344404 CCTCTGGAATTAGACAGGTTGGG + Intergenic
1112275411 13:98013430-98013452 GCTTTGGAGTCAGACAGATCTGG - Intronic
1113193326 13:107776223-107776245 GCTATGGAGTCAGACAGGCTAGG + Intronic
1113790177 13:113024090-113024112 ACTTTGGAGTCACACAGGCTGGG - Intronic
1113975378 13:114224316-114224338 ACTGTGGGGTCAGACAGGCCTGG + Intergenic
1114264805 14:21067476-21067498 CCTCTGGCGTCAGACAGCCTGGG + Intronic
1114552842 14:23543862-23543884 CCTTTAGAGTCAGACAGACCTGG + Intronic
1115101828 14:29710498-29710520 CATCTTGAGTAATACAGGCCAGG - Intronic
1115528434 14:34304031-34304053 CCTTTGGAGTAAGACAGAGCTGG - Intronic
1115782580 14:36786095-36786117 GCTCTGGAATCAGAAACGCCTGG + Intronic
1115786658 14:36834349-36834371 GCTTTGGAGTCAGACAGACCTGG + Intronic
1115862137 14:37699419-37699441 ACTCTGGAGTCAGACTGCCTGGG - Intronic
1116586237 14:46708320-46708342 CCTCTGGAGTCAGATAGTCCTGG - Intergenic
1117035623 14:51725299-51725321 CCTCTGAAGTCAGATAGATCTGG - Intronic
1117127558 14:52646766-52646788 GCTTTGGAGTCAGACAGGCCTGG - Intronic
1117712198 14:58542849-58542871 CCTCTGAAGTCAGCCGGGCGTGG + Intronic
1117780961 14:59231563-59231585 GCTCTAGAGTCAGACAGCCAGGG + Intronic
1118013094 14:61629766-61629788 GTTCTGGAGTCAGACAGTCTGGG + Intronic
1118181021 14:63493370-63493392 CATCTAGTGGCAGACAGGCCAGG - Intronic
1118345310 14:64936093-64936115 GCTTTGGAGTCAGACTGACCTGG + Intronic
1118429230 14:65699325-65699347 ACTCTGGAGTCTGACTGGTCTGG + Intronic
1118492741 14:66277465-66277487 ACTATGGATTCAGGCAGGCCTGG + Intergenic
1118912882 14:70076502-70076524 TCTCTGCAGTGAGAAAGGCCTGG - Intronic
1118975496 14:70672849-70672871 GCTCTGGAGTCAGGCAGGCCTGG - Exonic
1119017455 14:71074209-71074231 GCTCAAGAGTCAGACAAGCCTGG - Intronic
1119042241 14:71285547-71285569 CCTCTGGAGGGAGCCTGGCCTGG - Intergenic
1119348499 14:73945151-73945173 GCTTTAGAGTCAGACAGACCTGG + Intronic
1119427354 14:74544339-74544361 CAACTGGAGTCAGATAGGCCGGG + Intronic
1119575043 14:75712278-75712300 CATTTTGAGTCAGAGAGGCCTGG - Intronic
1119859674 14:77927029-77927051 CCTGTGCAGTCAGAAAGCCCTGG + Intronic
1119894461 14:78207996-78208018 ACTCTGGAGTCAGACTGCCTAGG + Intergenic
1120026028 14:79585274-79585296 CCTCAGAAGTCTGGCAGGCCAGG - Intronic
1120692110 14:87604227-87604249 GCCTTGGAGTCAGACAGTCCAGG + Intergenic
1120815897 14:88857871-88857893 GGTCTGGAGTCAGAAAGACCTGG - Intronic
1120937789 14:89914842-89914864 CCTTTGGAGTCAGAGAGATCAGG - Intronic
1120963552 14:90147804-90147826 CCTATGCAGTCAGTGAGGCCAGG - Intronic
1121293561 14:92797319-92797341 ACTCTGGAGTCAGGCAATCCTGG - Intronic
1121314169 14:92951314-92951336 ACTTTGGAGTCAGACAGATCTGG + Intronic
1121432546 14:93898184-93898206 CTGCTGGGGTCAGAGAGGCCAGG + Intergenic
1121436610 14:93924772-93924794 CCTTTGGACACAGACGGGCCTGG + Intronic
1121440605 14:93946616-93946638 CCTGTGGAGACAGACGAGCCGGG - Intronic
1121586890 14:95068733-95068755 GCTTTGCAGTCAGACAGGGCTGG - Intergenic
1121625432 14:95382387-95382409 GCTATGGATTCAGACAGACCTGG - Intergenic
1121625731 14:95384370-95384392 CCTCTGGAGAAAGACAGGCCTGG - Intergenic
1121830081 14:97044074-97044096 TCTCTAGAGGCAGATAGGCCTGG - Intergenic
1122004205 14:98688661-98688683 CCACTGGAGTCAGGCATCCCAGG + Intergenic
1122063885 14:99158543-99158565 GCTCTGGAGCCAGACTGACCTGG - Intergenic
1122067608 14:99184574-99184596 GCTCTGGGGTCAGACGGACCCGG - Intronic
1122153821 14:99738553-99738575 ACTCTGGAGTCAGGCTGTCCAGG + Intronic
1122170661 14:99871914-99871936 GCTTTGGAGCCAGACAGCCCGGG - Intronic
1122264431 14:100540026-100540048 CCCTTGGCATCAGACAGGCCTGG + Intronic
1122732864 14:103814432-103814454 GCTTTGGAGTCACACAGGCCAGG - Intronic
1122857517 14:104567035-104567057 CCTCACGAGTCAGGCGGGCCAGG - Intronic
1122954144 14:105061981-105062003 CCCCTGGAGTCCACCAGGCCAGG - Intronic
1123626436 15:22229945-22229967 ACTTTGGAATCAGACAGGCCTGG - Intergenic
1123880484 15:24674785-24674807 GCTCTGGAATCACACAGCCCAGG + Intergenic
1124719625 15:32100010-32100032 CCTCTGGGGTGAGATGGGCCAGG - Intronic
1125334003 15:38609784-38609806 ACTCTGGGGTCTGATAGGCCTGG + Intergenic
1125704806 15:41724598-41724620 TCTCTTGAGTCAGGGAGGCCAGG + Intronic
1125884247 15:43216518-43216540 ATTCTGGAGTCAGAGAGACCAGG + Intronic
1125933294 15:43615303-43615325 GCTCTAGAGTCAGACAGGCTTGG - Intronic
1125946392 15:43714765-43714787 GCTCTAGAGTCAGACAGGCTTGG - Intergenic
1126678607 15:51183155-51183177 ATTCTGGAGCCAGACAGGACCGG - Intergenic
1127700787 15:61498388-61498410 CCTCTGGTGTCAGATACGCTTGG + Intergenic
1128218165 15:65948551-65948573 ACTTTGGAATCAGACAGTCCTGG - Intronic
1128327089 15:66730868-66730890 GCTCTGGAGGCAGGCAGGCCTGG - Intronic
1128340080 15:66816326-66816348 CCTCTGGAGCCTGACAGACATGG + Intergenic
1128344292 15:66843716-66843738 GATCTGGAGTCAGGCAGACCTGG + Intergenic
1128548986 15:68585554-68585576 TCTCTGGAGTCAGACAGCCCAGG - Intronic
1128728094 15:70002564-70002586 CCTCTGGGGGCAGGCAGGGCTGG + Intergenic
1128801026 15:70497135-70497157 GCTCTGGAATTAGACAAGCCAGG - Intergenic
1128990557 15:72256231-72256253 CTTTTGGAGCCAGACAGACCTGG - Intronic
1129104607 15:73297582-73297604 ACTCTGGAGTCAGACAGACCTGG - Intronic
1129437413 15:75552968-75552990 CCTTTAGAGTCAGACAGCCAAGG + Intronic
1129669109 15:77597335-77597357 GCCCTGGAGTGAGACAGACCAGG + Intergenic
1129866050 15:78909687-78909709 GCTCTGGGGTCAGAAAGGGCAGG - Intergenic
1129878976 15:78994828-78994850 GCTCTGGAGTCAGCCAGACCTGG + Intronic
1129883368 15:79021683-79021705 ACTCTGGAGCCAGACTGGCTGGG + Intronic
1130236307 15:82137607-82137629 ACTTTGGAGTCAGAGAGTCCTGG - Intronic
1130312213 15:82765603-82765625 CCTCTGGAATCAGAGGGGCTTGG - Intronic
1130445876 15:84001527-84001549 CCTTTGGAGTCACACAGGATTGG - Intronic
1130519796 15:84653790-84653812 ACTCTGGAGTCAGGCAGACGTGG + Intronic
1130547291 15:84866434-84866456 CCTCTGGAGTCAGACAGACCTGG - Intronic
1130575568 15:85090161-85090183 GCTTTGGTGTCAGACGGGCCTGG + Intronic
1130905600 15:88238870-88238892 GCTCTGGAGTCAGCCTGGGCTGG + Intronic
1130923012 15:88364946-88364968 ACTTTGGAGGCAGACAGACCTGG + Intergenic
1131058158 15:89388695-89388717 CCTCTGGAGACAGAAAAGCATGG - Intergenic
1131076545 15:89498956-89498978 CCTTTGAAATCAGACAGCCCAGG - Intergenic
1131397616 15:92098964-92098986 GCTTTGAGGTCAGACAGGCCTGG - Intronic
1131426773 15:92352012-92352034 CCACTGGGATCAAACAGGCCTGG - Intergenic
1132125449 15:99220142-99220164 GCTCTGAAGTCAGACTGCCCAGG + Intronic
1132460466 16:51349-51371 GCCTTGGAGTCATACAGGCCCGG - Intronic
1132506993 16:315530-315552 TCTATGAAATCAGACAGGCCGGG + Intronic
1132600192 16:769692-769714 CCCCTAGAGCCAGACAGGCCTGG + Intronic
1132937864 16:2490774-2490796 GCTTTGCAGTTAGACAGGCCTGG - Intronic
1133183892 16:4081351-4081373 CCTCTGGAGTCAGGGAGCCATGG - Intronic
1133200781 16:4203259-4203281 CCGCTGGAGACAGAGAGGGCCGG + Exonic
1133242245 16:4421870-4421892 GCTCTGGAGTCAGACAGCCTGGG - Intronic
1133659847 16:7905575-7905597 ACACTGGAGTCAGACTGTCCTGG - Intergenic
1134038615 16:11050913-11050935 GCCCTGGAGCAAGACAGGCCTGG + Intronic
1134215569 16:12314403-12314425 ACTCTGGAGCCAGACAGCTCAGG + Intronic
1134233751 16:12449701-12449723 GCTCTGAAGTGAGACAGGCCTGG - Intronic
1134293558 16:12923910-12923932 GCTGTGGAGTCGGACAGACCTGG - Intronic
1134804181 16:17110768-17110790 CCTTTGGAGTCAGTCGGTCCTGG - Intronic
1134845492 16:17436366-17436388 ACTCTGGAGCCAGACAGCCTTGG - Intronic
1134914910 16:18061357-18061379 GCTCTGGAGTCAGATCTGCCGGG - Intergenic
1135017882 16:18939199-18939221 CAACTGGAGTCAGAAATGCCTGG - Intergenic
1135096744 16:19570778-19570800 ATTCTGAAGTCAGACTGGCCAGG - Intronic
1135172386 16:20197258-20197280 GCGCTGGAGGCAGACAGACCTGG + Intergenic
1135659957 16:24287561-24287583 ACTCTGGAGTCAGAATGACCTGG + Intronic
1135861726 16:26062236-26062258 ACACTGGAGTCAGACAGAGCTGG + Intronic
1135967292 16:27046695-27046717 ACTCTGGAGTCAGACTGACCTGG - Intergenic
1136079327 16:27841244-27841266 CTCCTGGAGTCAGACAGTTCAGG - Intronic
1136170774 16:28487851-28487873 GCTCTGGAGTCAGGCACGCCTGG + Intronic
1136295077 16:29296984-29297006 GCTCTGGAATCAGACAGGCCTGG + Intergenic
1136374224 16:29855698-29855720 GCTCTGGAACCAGACTGGCCAGG + Intergenic
1136400717 16:30016578-30016600 CTTCTGGAGGCAGGCAGGGCTGG - Intronic
1136620466 16:31424972-31424994 ACTGTGGAGGCAGACAGGCCTGG + Intronic
1136687771 16:32005225-32005247 ACTCTGGAGTCAGACAGTCCTGG + Intergenic
1136788374 16:32948776-32948798 ACTCTGGAGTCAGACAGTCCTGG + Intergenic
1136881441 16:33905155-33905177 ACTCTGGAGTCAGACAGTCCTGG - Intergenic
1136926940 16:34383011-34383033 CCTTTGGAGTCAGACAGAACTGG - Intergenic
1136977634 16:35028796-35028818 CCTTTGGAGTCAGACAGAACTGG + Intergenic
1137289226 16:47040395-47040417 GCTCTGGAGGCAGAGAGACCTGG - Intergenic
1137347089 16:47673940-47673962 ACACTGGAGTCAGGCAGACCTGG - Intronic
1137481950 16:48859239-48859261 CATTTGGAATCACACAGGCCTGG - Intergenic
1137732963 16:50702827-50702849 GCTCTGGAGGAAAACAGGCCTGG - Intronic
1137849474 16:51724675-51724697 ACTCTGGAATCAGATGGGCCTGG - Intergenic
1137885440 16:52098152-52098174 CCTCTGGTGGCAGAGAGGCTGGG - Intergenic
1137931834 16:52595903-52595925 GCTCTGGAGTTGGACAGACCTGG + Intergenic
1137965712 16:52931230-52931252 TCTTTGTAATCAGACAGGCCTGG - Intergenic
1138108911 16:54307698-54307720 GCTTTGGAATCAGACTGGCCTGG + Intergenic
1138127906 16:54454015-54454037 CCTCTGGAACCAGAAAGGGCTGG - Intergenic
1138208704 16:55144639-55144661 GCTCTTGAATCAGACAGACCTGG - Intergenic
1138223766 16:55275305-55275327 CTTCTGAAGTCAGACAGGCCTGG - Intergenic
1138269039 16:55681474-55681496 GCTCTGGGGTCAGACAGACCTGG - Intronic
1138302638 16:55945366-55945388 CTCCTGGAGTCAGACAGACCAGG - Intronic
1138341860 16:56295257-56295279 ACTCTGGGGTCAGACAGTCCTGG + Intronic
1138342453 16:56299159-56299181 CCTTTGGAGTTAGGCAAGCCTGG - Intronic
1138358240 16:56402841-56402863 GCTCTGGAGTCAGACTGCCCGGG - Intronic
1138525197 16:57601189-57601211 CCTTTGGAGTCAGACAGACTGGG - Intergenic
1139994180 16:70964340-70964362 ACTCTGGAGTCAGAGAGCCCTGG + Intronic
1140596568 16:76422627-76422649 GCTTTGGAGTCAGAAAAGCCTGG + Intronic
1140702522 16:77594530-77594552 GCTATGGAATCAGACAGACCTGG + Intergenic
1140708887 16:77657735-77657757 TTTCTGGATTCAGCCAGGCCAGG + Intergenic
1140844375 16:78872485-78872507 GCTGTGGTGTCACACAGGCCTGG + Intronic
1140849976 16:78926031-78926053 ATTCTGGAGACAGACAGGACAGG + Intronic
1140896666 16:79330871-79330893 ATTTTGGAGTCAGGCAGGCCTGG - Intergenic
1140903419 16:79391127-79391149 CCTCTGGAGTCAGAAAACTCAGG + Intergenic
1141030156 16:80580552-80580574 CCGCAGGAGTCAGAAATGCCTGG - Intergenic
1141134472 16:81456693-81456715 ACTCTGGAGCCAGACAGCCTGGG - Intronic
1141230424 16:82162254-82162276 GCTCTGAAGTCAGGCAGACCTGG - Intronic
1141267775 16:82512499-82512521 ACTCTGGTGCCAGACAGGCCTGG + Intergenic
1141410749 16:83831363-83831385 ACTCTGGAGTCAGACAGCTTGGG - Intergenic
1141475611 16:84271138-84271160 ACTCTGGAGTCAGACTGCCTGGG + Intergenic
1141513966 16:84530734-84530756 GCTTTGGAGCCAGACAGTCCTGG + Intronic
1141553340 16:84820708-84820730 GCTCTGGAGACAGACAGAGCTGG - Intronic
1141607042 16:85159721-85159743 TCTCTGGAGCCAGACAGCCCGGG + Intergenic
1141684225 16:85561326-85561348 ACTCTGGAGCCAGACTGCCCAGG - Intergenic
1141942444 16:87286400-87286422 ACTCTGGGATCAGACAGACCAGG - Intronic
1141977540 16:87527439-87527461 ACTTTGGAATCAGACAGGCCTGG + Intergenic
1141986782 16:87585423-87585445 GCTTGGGAGTCAGACAGACCTGG - Intergenic
1142100978 16:88270993-88271015 GCTCTGGAATCAGACAGGCCTGG + Intergenic
1142191518 16:88720370-88720392 CCTTTGGGGTGAGCCAGGCCCGG - Exonic
1142194004 16:88731246-88731268 CCTCTGCATTCAAACAGCCCCGG - Intronic
1203090573 16_KI270728v1_random:1210291-1210313 ACTCTGGAGTCAGACAGTCCTGG + Intergenic
1142752017 17:1994620-1994642 ATGCTGGAGTCAGCCAGGCCTGG + Intronic
1143268080 17:5655478-5655500 GCCCTGGAGGCAGAGAGGCCTGG + Intergenic
1143322898 17:6079591-6079613 CCTCTGGAGTCCAGGAGGCCTGG + Intronic
1143384904 17:6523403-6523425 GTGCTGGAGTCAGAGAGGCCTGG - Intronic
1143735673 17:8910620-8910642 CCTTTGGAATGAGACAGACCTGG - Intronic
1143834056 17:9675913-9675935 ACTCTGGAGCCAGACGGCCCAGG + Intronic
1143897167 17:10145340-10145362 CCTCTGGAGCAAGTCATGCCTGG + Intronic
1144095576 17:11897635-11897657 GCTCTGGAGTCAGACATCCCTGG + Intronic
1144296905 17:13884974-13884996 ACCCTGGTGTCAGACAGGCGTGG + Intergenic
1144318249 17:14085035-14085057 CCTCTGGAGTCAGACTGGCTGGG + Intronic
1144565207 17:16353714-16353736 CCGCTGGATTCACACAGGGCAGG - Intergenic
1144685032 17:17220553-17220575 CCTTTGGCATCAGACAGACCTGG - Intronic
1144787052 17:17837726-17837748 AATCTGGGGTCAGACAGCCCTGG - Intergenic
1144823008 17:18088518-18088540 ACTCTGGAGTCTGGAAGGCCTGG + Intronic
1144827856 17:18116389-18116411 GCTCTGGACTCGGCCAGGCCTGG + Intronic
1144834425 17:18149479-18149501 CCTCCAGAGTCAGACAGTCTTGG + Exonic
1144887209 17:18471495-18471517 CTTTGGGAGTCAGCCAGGCCTGG - Intergenic
1145145007 17:20472800-20472822 CTTTGGGAGTCAGCCAGGCCTGG + Intergenic
1145263322 17:21367478-21367500 CCTCTGGAGTCAGACCAGCTTGG - Intergenic
1145305248 17:21670521-21670543 ACTCTGAAGTCAGAAAGACCTGG + Intergenic
1145746321 17:27322921-27322943 ACTCTGGAGTCAGATAGCCTGGG - Intergenic
1145890821 17:28414380-28414402 GCTTTGGAGTCAGACAGACATGG - Intergenic
1145915216 17:28569702-28569724 ACACTGGAATCAGTCAGGCCTGG + Intronic
1145994381 17:29097125-29097147 ACTCTGGGGGCAGGCAGGCCTGG - Intronic
1146012292 17:29205640-29205662 CCTTTGGAGCCAGACAGACCTGG + Intergenic
1146061063 17:29607667-29607689 CCTCCGGAGCCAGACAGCCCTGG - Intronic
1146353929 17:32118568-32118590 CTTTGGGAGTCAGCCAGGCCTGG - Intergenic
1146551405 17:33783263-33783285 GCTCTGGAATCAGACAGCCTAGG + Intronic
1146619072 17:34382619-34382641 GCTCTCAAGTCAGACATGCCTGG - Intergenic
1146626102 17:34436638-34436660 ATTCTGGAGTCAGCCAGGCCTGG - Intergenic
1146632707 17:34482523-34482545 ACTCTGGAGTCAGACAGCTTAGG - Intergenic
1146643599 17:34561156-34561178 ACTCTGGAGTCAGATGGCCCGGG + Intergenic
1147148756 17:38500896-38500918 ACTCTGCAGTCAGACAGTCCTGG + Intronic
1147328200 17:39680203-39680225 GCCCTGGAGCCAGACAGCCCTGG + Intronic
1147391382 17:40111518-40111540 CCTCAGGACTCTGACAGGCTGGG + Intergenic
1147453293 17:40519391-40519413 CCTCGGGAGTCAGGAAAGCCAGG - Intergenic
1147454901 17:40531041-40531063 TCTCTGGCCTCAGACAGGCCAGG - Intergenic
1147497151 17:40927730-40927752 GCTTTGGAGTTAGCCAGGCCTGG + Intronic
1147562952 17:41520147-41520169 GCTCTGGAGTCCCTCAGGCCCGG + Exonic
1147572502 17:41580016-41580038 CCTCTGGAGCCTGACAGCACAGG + Intergenic
1147790429 17:43011145-43011167 GCTCTGGAGTCAGACAGCCTAGG + Intronic
1147867525 17:43562959-43562981 CCTCTCGAGTTAGGCAGGCTTGG + Intronic
1147991850 17:44338831-44338853 CCTCTTGGGGCAGACAGCCCAGG + Intergenic
1148044754 17:44736537-44736559 ACTCTGGAGTCCCAGAGGCCTGG - Intronic
1148334320 17:46831624-46831646 GCTCTGGAGGCAGGCAGGTCAGG + Intronic
1148566559 17:48636424-48636446 CCTGTGAAGGGAGACAGGCCAGG - Intergenic
1148588326 17:48796774-48796796 GCTTTGGAGTCAGGCAGACCTGG + Intronic
1148659800 17:49320471-49320493 GCTTTGGAGTCAGGCAGGCCTGG - Intronic
1148739417 17:49884016-49884038 GCTTTGCAGTCAGACAGTCCTGG - Intergenic
1149963163 17:61134422-61134444 GCTCTGGAGTCAGACATGCGTGG - Intronic
1150810534 17:68353295-68353317 GCTCTGGACTCAGAGAGACCTGG - Intronic
1151354917 17:73552692-73552714 GCTCTGCAGTCAGCCTGGCCGGG - Intronic
1151509844 17:74551580-74551602 GCCCTAGACTCAGACAGGCCTGG + Intergenic
1151698752 17:75731457-75731479 CCCCTGGAGTCAGGCAGGCCTGG + Intronic
1151858558 17:76740513-76740535 CCTCTGGAGTCATGCAGTCCTGG + Intronic
1151892661 17:76959828-76959850 GCCATGGAGTCAGACAGCCCTGG + Intergenic
1151989446 17:77564804-77564826 CCCCTGGAGAAAGACAGACCTGG - Intergenic
1152080426 17:78183989-78184011 CTTCTGGAGTCAGTCAGATCCGG - Intronic
1152231471 17:79115950-79115972 GCTCTGGAGTCAGACACCCCTGG + Intronic
1152499493 17:80698311-80698333 CCACAGGAGTCAGTGAGGCCTGG - Intronic
1152599756 17:81256261-81256283 TCTTTGGAGTCAGACATGCTCGG + Intronic
1152769779 17:82160369-82160391 CTTTGGGAGGCAGACAGGCCAGG + Intronic
1152769787 17:82160421-82160443 CTTTGGGAGGCAGACAGGCCAGG + Intronic
1152769806 17:82160525-82160547 CTTTGGGAGGCAGACAGGCCAGG + Intronic
1152769816 17:82160577-82160599 CTTTGGGAGGCAGACAGGCCAGG + Intronic
1152820944 17:82437370-82437392 CCTCTGAGGACAGACTGGCCAGG - Intronic
1152988571 18:341815-341837 GCTCTGGAATCAGACAGAGCTGG - Intronic
1153496452 18:5704636-5704658 CCTCTGGAGTCAGAAACGCATGG - Intergenic
1153557640 18:6332724-6332746 CCTCTAGAGTCAGCCATGACTGG + Intronic
1153914342 18:9732547-9732569 GCTCTGGTGTCAGACAAGCCTGG - Intronic
1155266813 18:24102608-24102630 GCTCTGGAGTCAGACTGAGCAGG + Intronic
1156467286 18:37355847-37355869 CCTTTGGAGTCAAACCAGCCAGG + Intronic
1156989199 18:43386207-43386229 TCTCTGGAGTCAGATAGCCTGGG - Intergenic
1157028788 18:43879489-43879511 CCTCAGGAGACAGTCAGGCGGGG + Intergenic
1157288549 18:46393825-46393847 GCTCTGGAGTCTGACAGACCTGG + Intronic
1157356513 18:46940158-46940180 GCTCTGGAGTCATACAGGCCAGG - Intronic
1157663299 18:49464527-49464549 ACTTTGGAGTCAGACAGATCTGG + Intergenic
1157709277 18:49838342-49838364 GTTCTGGAGTCAGACAGACTTGG - Intronic
1157762640 18:50275686-50275708 CCTCTTGGGTCTGACAGCCCCGG + Exonic
1157799337 18:50606132-50606154 GCCCTGGAGTCAGACAGACATGG + Intronic
1159604190 18:70457990-70458012 GCTTTGGAGTCAGGCAGCCCTGG - Intergenic
1159870062 18:73751043-73751065 GTGCTGGAGTCAGATAGGCCTGG - Intergenic
1160334780 18:78029158-78029180 CCTCTGGAGTCTGATGGGCCTGG + Intergenic
1161017270 19:1989499-1989521 GCTCTGGAGCAAAACAGGCCTGG - Intronic
1161309647 19:3586542-3586564 CCTGGGGGGTCAGATAGGCCTGG + Exonic
1161381809 19:3969505-3969527 GCCGTGGAGTCAGACAGCCCCGG - Intronic
1161482304 19:4517175-4517197 CCCCTGGGGTCACACAGCCCAGG - Intronic
1161651349 19:5487414-5487436 ACTCTGCAATCAGACAGGTCTGG - Intergenic
1161885377 19:6990618-6990640 CCTCTTGAGTCAGTTAGGCTGGG - Intergenic
1161962801 19:7532001-7532023 CTTCTGGAATCAGACAGCCCTGG - Intronic
1162031613 19:7919977-7919999 GCTCTGGGGTCAGACAGGCCTGG - Intergenic
1162121844 19:8475194-8475216 GCTCTGGAGCCAGACAGCCTGGG - Intronic
1162157222 19:8686696-8686718 GCATTGGAGTCAGACAGGCCTGG - Intergenic
1162448300 19:10738023-10738045 CTTCTGGAGTCAAACAGGCCTGG + Intronic
1162824525 19:13243477-13243499 TCTCAGGAGTCACCCAGGCCTGG + Intronic
1162870816 19:13585399-13585421 GCTCTGGATTCTGACAGACCTGG + Intronic
1162996035 19:14335964-14335986 GCTCTGGAATCAGACAGCCAGGG - Intergenic
1162997892 19:14348099-14348121 ACTCTGGACTCACACAGGCCTGG + Intergenic
1163007473 19:14405967-14405989 GCTCTGGGGTCAGGGAGGCCTGG + Intronic
1163065169 19:14786974-14786996 ACTCTGGACTCACGCAGGCCTGG - Intergenic
1163244622 19:16085597-16085619 ACTCTGGAGTCAGACTGCCAAGG + Intronic
1163452373 19:17386019-17386041 CTTCTGGAGTCAGCCAGAGCTGG - Intergenic
1163455323 19:17403117-17403139 GCTCTGGAGGGAGACAGCCCTGG + Exonic
1163548226 19:17951588-17951610 CCTCTTGAGCCTGACTGGCCCGG - Intronic
1163792160 19:19313705-19313727 CCTCTGAAATAAAACAGGCCCGG + Intronic
1164858020 19:31540088-31540110 GCTCTAAAGTCAGACAGACCTGG - Intergenic
1165385967 19:35510864-35510886 GCTCTGGAGTCAGTGAGGCCCGG + Intronic
1165432815 19:35782100-35782122 GCTCTGGAGTCAGACAGTCTTGG + Intronic
1165716237 19:38047627-38047649 GCTCTGGGGTCAGCCCGGCCCGG - Intronic
1165758499 19:38307691-38307713 CCTCCAGGGTCAGCCAGGCCAGG + Exonic
1165857906 19:38890998-38891020 CCACTGGATTCAACCAGGCCTGG - Intronic
1166225296 19:41391414-41391436 GCTCTGGAGTCAGACTGGCCTGG + Intronic
1166295520 19:41887611-41887633 CCTCTGGTCTGTGACAGGCCTGG - Intronic
1166346024 19:42166524-42166546 ACTGTGGAGTCAGACACACCCGG - Intronic
1166556645 19:43704520-43704542 ACTCTGGACTCAGCCAGGACAGG - Intergenic
1166564802 19:43757337-43757359 GCTCTGGAGTGAGACAGGCTTGG - Intergenic
1166818212 19:45559875-45559897 CCTTTGGAGTCGCACAGACCTGG + Intronic
1167278510 19:48553011-48553033 GCTCTGGCGTGAGACAGACCGGG - Intronic
1167339822 19:48908582-48908604 CCTCTGGGCTCAGCCAGGGCCGG + Intronic
1167601479 19:50457524-50457546 GTGCTGGAGTCAGACAGGCCTGG + Intronic
1167848873 19:52187022-52187044 CCTTTGGAGTCAGACTGCCCAGG + Intergenic
1168070181 19:53945195-53945217 GCTCTGAGGTCAGACAGGCTGGG - Intergenic
1168525891 19:57088565-57088587 CCTTTGGAGGCAGGCAGGGCAGG + Intergenic
925346047 2:3172712-3172734 AATCTGGAGTCAGACAGGCCTGG - Intergenic
925409582 2:3632204-3632226 CCTCTGCCATCAGACAGGCCTGG - Intronic
925836017 2:7947708-7947730 GCCCTGGAGTCACACAGGCCAGG + Intergenic
926037784 2:9648611-9648633 GGTCTGGTGTCAGACAGGCAAGG + Intergenic
926272354 2:11376224-11376246 GATTTGGAGTCAGACAGACCGGG - Intergenic
926538838 2:14149620-14149642 CCTCTGGAGCCACACAGGCCAGG - Intergenic
926754330 2:16223412-16223434 GCTCTGGGGGCAGAGAGGCCTGG - Intergenic
927381653 2:22486439-22486461 CTTCAGGAGACAGAGAGGCCAGG + Intergenic
927459194 2:23283170-23283192 CCTCTGGAGGCAGGAAAGCCAGG + Intergenic
927657109 2:24958508-24958530 GCTCTGGAGTCAGACAGATCTGG + Intronic
927797232 2:26060725-26060747 TTTCTGGAGTCTGACAGACCTGG - Intronic
927854880 2:26521761-26521783 GCTCTGGAGTCAGACAGATGTGG + Intronic
927884413 2:26709841-26709863 GCTTTGGAGTCAGACAGGCCCGG - Intronic
927913104 2:26915323-26915345 ACTCTGGAGCCTGACAGACCTGG - Intronic
927944330 2:27125982-27126004 GCTCTAGAGTCAGACAGACCTGG + Intronic
928065252 2:28157931-28157953 TCTGTGGGGTCAGGCAGGCCTGG + Intronic
928151803 2:28837714-28837736 ACTCTGGAGTCAGACTGCCTAGG - Intronic
928179404 2:29057393-29057415 GCTTTGGAGTCAAACAGGCCTGG - Exonic
928271932 2:29864158-29864180 ACCCTGGAGTCAGACAGTTCTGG - Intronic
928283013 2:29965269-29965291 GCACTGGAGTCAGACGGACCTGG - Intergenic
928419438 2:31126369-31126391 GCTCTGGAGGCAGACAGACCTGG + Intronic
928435141 2:31249997-31250019 ACTCTGGAGTCAGGCTGGCAGGG + Intronic
928452055 2:31386212-31386234 GCTGTGGAGTCCCACAGGCCTGG - Intronic
928604440 2:32932496-32932518 TCTCTGGAGTCAGACAACCTCGG + Intergenic
928879479 2:36081954-36081976 GCTCTGGAGACAGAAAGACCTGG - Intergenic
929576921 2:43057730-43057752 ACTCTGCAGCCAGACAGGTCAGG + Intergenic
929685971 2:44035200-44035222 ACTCTGGAATCAGACAGATCTGG - Intergenic
929696250 2:44118418-44118440 ACTCTTGAGTCAGCCAGTCCTGG + Intergenic
929790070 2:45015684-45015706 GCTTTGGTGTCAGACAGGCCTGG + Intergenic
930048313 2:47193257-47193279 GCTCTAGAGTCAGACAGCCTGGG - Intergenic
930151870 2:48067816-48067838 CCTTTGGAGTCAGACAGATTGGG + Intergenic
930680036 2:54247796-54247818 ACTCTGGAGTCAGATAGACTTGG + Intronic
930919152 2:56730291-56730313 GCTCTGGAGTCAGACAGCCTAGG + Intergenic
931214414 2:60227929-60227951 GATTTGGAGTCAGACAGGCCTGG - Intergenic
931291779 2:60880527-60880549 GCTTTGGAGTCAGACAACCCTGG + Intergenic
931465486 2:62483133-62483155 ACTTTGGAATCAGACAGCCCTGG - Intergenic
931508070 2:62954165-62954187 GATGTGGAGTCAGACAGACCTGG - Intronic
931616154 2:64160284-64160306 GCTTTGGTGTCAGACAGACCTGG - Intergenic
931674090 2:64676424-64676446 ACTGTGGAGTCAGACAGTCCTGG + Intronic
932099228 2:68881466-68881488 CCTCTGGAGTCAGACTTCCTGGG - Intergenic
932122208 2:69112353-69112375 CCTTTGGAGTCCGACTGCCCAGG - Intronic
932260206 2:70320714-70320736 CCTCTGGAGCCAGACAGCCTGGG - Intergenic
932300231 2:70661835-70661857 GCTCTGGACTCAGACTGACCTGG + Exonic
932448453 2:71794800-71794822 CCCATGGAGCCAGGCAGGCCTGG + Intergenic
932449898 2:71802701-71802723 TCTTTGGAGTCAGACAGGGAAGG - Intergenic
932468369 2:71938387-71938409 GCTCTGGAGTTAGGCAGGCCTGG + Intergenic
932771735 2:74504184-74504206 GCCGTGGAGTCAGACCGGCCAGG + Intergenic
932871910 2:75409630-75409652 AGGCTGGAGTCAGCCAGGCCTGG - Intergenic
933612710 2:84453895-84453917 TCGCAGGAATCAGACAGGCCTGG + Intronic
933778611 2:85786713-85786735 GCTCTGGAGGCAGCCAGGCCGGG + Intronic
934558481 2:95300034-95300056 GCTCTGGAGTAAGACAGAGCAGG - Intronic
934652289 2:96099523-96099545 GCTCTGGAGGCAGATAGACCTGG + Intergenic
934737035 2:96694829-96694851 CATCTGCAGTCAGACAGGGCTGG - Intergenic
934893038 2:98087280-98087302 CCTCTCGGGTCAGGCGGGCCCGG + Exonic
934967274 2:98733439-98733461 GCTCTGGAATCAAACAGACCTGG - Intergenic
935627924 2:105186206-105186228 CCTTTGGGGGCTGACAGGCCAGG + Intergenic
935640497 2:105285494-105285516 CCTCTAGAATCAGAAAGGCCTGG - Intronic
936236558 2:110747385-110747407 CCTCAGGAGGGAGTCAGGCCTGG + Intronic
936693983 2:114926098-114926120 CCTCTGGAGGCAGAAAGCTCAGG + Intronic
937012403 2:118574158-118574180 TGTGTGGACTCAGACAGGCCTGG - Intergenic
937042856 2:118835068-118835090 CCACTGGAGTCAGAGGGCCCGGG - Intergenic
937265016 2:120609902-120609924 AATCTGGAGTCAGACAGGCTAGG + Intergenic
937355528 2:121196006-121196028 GCTCTGGTGTCAGACAGCCTGGG - Intergenic
937365059 2:121255594-121255616 CCTTCGGCGTCAGACAGACCAGG - Intronic
938100542 2:128495122-128495144 GCTCTGGGGTGAGCCAGGCCTGG + Intergenic
938155849 2:128939435-128939457 GCTTTGGAGTCACACAGACCAGG + Intergenic
938597725 2:132805305-132805327 ACTCTGCAGTCAGACTGTCCAGG - Intronic
938786449 2:134634252-134634274 TCTCTGGAGTCAGACAGACTCGG + Intronic
938982480 2:136539773-136539795 GCTCTGGAGGCAGACAGGCCTGG - Intergenic
940024913 2:149195947-149195969 CCTCTGGAGGCACTCAGGCCTGG - Intronic
940326676 2:152432959-152432981 ACTTTGGAGTCAGGCAGACCCGG + Intronic
940863828 2:158797163-158797185 CCTTTGGAATCAGACAGACCTGG + Intronic
940929286 2:159407479-159407501 ACTGTGGAGTCAGAAAGTCCTGG - Intronic
941125988 2:161584173-161584195 ACTCTGGGGTCAGACAACCCAGG - Intronic
941185564 2:162318184-162318206 CCTCTGCAGGCAGAAAGGTCAGG + Exonic
941290936 2:163673779-163673801 TGTCTGGAGTCAGACAGACCTGG + Intronic
941834283 2:169998834-169998856 GCTGTGGAGTCAGACAGACTTGG + Intronic
942099812 2:172569005-172569027 ACTATGGAGTCAGAAAGACCTGG + Intronic
942531904 2:176919584-176919606 ACTCTGGACTCAGACAGACCTGG - Intergenic
942548215 2:177086942-177086964 GCTCTGGAGTCAGAAAGATCTGG + Intergenic
942553800 2:177150194-177150216 GCTCTGGAGTCAGAAAGACCAGG - Intergenic
943080298 2:183251827-183251849 GCTCTGGAGTCAGACTGACTGGG - Intergenic
943683984 2:190797253-190797275 GCTCTGGAGTCAGATAGGTGTGG - Intergenic
943917682 2:193657748-193657770 ACTTTGGAGTCAGTTAGGCCTGG + Intergenic
943996846 2:194779198-194779220 ACTCTGGAGTCAAACTGCCCAGG + Intergenic
944185380 2:196942344-196942366 ACTCTAGAGTCAGACAGAACTGG + Intergenic
944809404 2:203312891-203312913 CCTCTAAAGTCAGACATGTCCGG - Intergenic
944889572 2:204103209-204103231 TCTCTGGAGTGAGAAAAGCCAGG + Intergenic
945268017 2:207910558-207910580 CCTTTGGAGTCAGAAAGTCCTGG - Intronic
945441816 2:209888423-209888445 TCTCTGCAGTCAGAGAGGCCTGG + Intronic
945898240 2:215509173-215509195 ACTCTGGAGTCAGACTGCCTGGG - Intergenic
946007084 2:216534520-216534542 CCTTGGGAGTCAGACAGGCTTGG + Intronic
946010028 2:216557237-216557259 GCTCTGAAGCCAGACAGTCCTGG - Intronic
946099011 2:217302813-217302835 GCTTTGGGGTCAGACAGGCCTGG + Intronic
946214197 2:218171142-218171164 GCTTTGAAGTCAGACAGACCAGG + Intergenic
946343652 2:219089970-219089992 GATCTAGAGTCAGACAGACCTGG + Intronic
946368786 2:219267542-219267564 CCTCTGGAGTCACACAGACCTGG - Intronic
946389406 2:219406333-219406355 GCTTTGGAGTCAGGCAGTCCTGG + Intergenic
946412150 2:219520775-219520797 CCTCAGGAGCCAGGCAGGTCAGG + Intronic
947033313 2:225822889-225822911 GTTCTGGAGTCAGACAGACCTGG - Intergenic
947500394 2:230667031-230667053 CCTCTGGGGCCAGGCAGGCCTGG + Intergenic
947823748 2:233090385-233090407 TCTCTTGACTCAGACAAGCCAGG - Intronic
947828763 2:233124512-233124534 CCTCTGGAATCAGGAAGGTCAGG + Intronic
948087562 2:235264318-235264340 GCTTTGGAGTCAGACAGGACTGG - Intergenic
948125566 2:235562665-235562687 CCCCTGGAGCCAGACAGCTCTGG + Intronic
948137011 2:235643992-235644014 CCTCTGTAGTAAGGGAGGCCTGG + Intronic
948185813 2:236020493-236020515 GCTGTGGAGTCACACACGCCTGG + Intronic
948266876 2:236641385-236641407 GCTCTGGAATAAGGCAGGCCTGG + Intergenic
948782304 2:240329401-240329423 GCACTGGAGGCAGCCAGGCCAGG + Intergenic
1168884469 20:1237320-1237342 GCTCTGGAGTCAGAGAGAGCTGG + Intronic
1168962013 20:1876449-1876471 GATCTGGAGTCTGACAGGCCTGG - Intergenic
1169329959 20:4708599-4708621 CCCCTGAAGGCAGACCGGCCAGG - Intergenic
1169413308 20:5393235-5393257 ACTCTGGAGCCAGACATGCTTGG - Intergenic
1169892882 20:10472594-10472616 CCTTTGGAGGCAGAAAGGCCTGG + Intronic
1170053863 20:12177251-12177273 GCTCTGGAGTCAGAGAGCCTGGG + Intergenic
1170425909 20:16235448-16235470 ACTCTGAAGTCAGAGAGGACAGG + Intergenic
1170601719 20:17846434-17846456 CCTCTGGCTTCAGATAGGCTTGG - Intergenic
1170740616 20:19052870-19052892 GCTTTGGAATCAGACAGACCTGG + Intergenic
1170939605 20:20837714-20837736 CTTTTGGGGTAAGACAGGCCAGG + Intergenic
1171522764 20:25787994-25788016 ACTCTGAAGTCAGAAAGACCTGG + Intronic
1171530507 20:25849963-25849985 ACTCTGAAGTCAGAAAGACCTGG + Intronic
1171554063 20:26067889-26067911 ACTCTGAAGTCAGAAAGACCTGG - Intergenic
1171723014 20:28584300-28584322 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1171755070 20:29099152-29099174 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1171787617 20:29483740-29483762 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1171860337 20:30395641-30395663 CCTCTGGAGTCAGCTGGGCCTGG - Intronic
1171989688 20:31686276-31686298 GCTCTGCAGTCAGACACACCTGG - Intronic
1172023646 20:31933650-31933672 GCTTTGGAGTCAGATGGGCCTGG - Intronic
1172129813 20:32648124-32648146 ACTCTGGAGTCAGCTAGACCCGG - Intergenic
1172169033 20:32917759-32917781 CCTCTGAAGTCAGACTGCCTGGG - Intronic
1172227380 20:33314322-33314344 TCTCTGCAGCCAGACAGGCCTGG - Intergenic
1172246000 20:33445265-33445287 GCACTGGTGTCAAACAGGCCTGG - Intergenic
1172271583 20:33658415-33658437 GCCCTGGAGTGAGTCAGGCCAGG - Intronic
1172361188 20:34313597-34313619 ACTCTGGAGTCAGACAGCATTGG - Intergenic
1172428729 20:34873379-34873401 CGTCTGCAGTCAAAGAGGCCTGG - Intronic
1172450425 20:35018811-35018833 TCTCTGCAGTCAGACAGCCCTGG + Intronic
1172484515 20:35290372-35290394 GCTCTGGAGTCAGAAAGAACTGG + Intronic
1172488648 20:35316400-35316422 ACTCTGGATTCAGACTGACCTGG - Intronic
1172512014 20:35507407-35507429 ACTCTCGAGTCACACAGGGCTGG - Intronic
1172593567 20:36134144-36134166 ACTTTGGAGACAGACAGACCTGG - Intronic
1172598324 20:36165915-36165937 ACTCTGGAGTCAGAGATACCTGG + Intronic
1172636778 20:36415440-36415462 GCTCTAGAGCCAGACAGGGCCGG - Intronic
1172657772 20:36547531-36547553 GCTTTGCTGTCAGACAGGCCTGG - Intronic
1172674178 20:36655706-36655728 GCTCTGGAGTCAGACTGTCAGGG + Intronic
1172756609 20:37289757-37289779 CCGCTGGAGACAGGCCGGCCGGG - Intronic
1172765664 20:37349407-37349429 GCTTAAGAGTCAGACAGGCCTGG + Intronic
1172809405 20:37636745-37636767 GTTCTGTAATCAGACAGGCCTGG - Intergenic
1172861602 20:38058210-38058232 GCTCTGAAGTCAGACACACCTGG - Intronic
1172964458 20:38824506-38824528 CCTTTGGAGTTAGGCAGACCTGG + Intronic
1172968559 20:38856811-38856833 ATTCTGAAGTCAGACAGTCCTGG - Intronic
1173066576 20:39718843-39718865 GCTCTGGAATCAGACAGACTTGG + Intergenic
1173339510 20:42141001-42141023 CCTCGGGAGTCAAACTGCCCAGG - Intronic
1173550165 20:43927523-43927545 GCTTTGGAGTCATACTGGCCTGG + Intronic
1173564528 20:44029414-44029436 ACTTTGGGGTCAGACAGACCTGG + Intronic
1173619930 20:44429204-44429226 CCGCTGGGGACAGCCAGGCCTGG + Intronic
1173660143 20:44727466-44727488 CCTCGGGATCCAGACAGACCAGG - Exonic
1173679561 20:44868305-44868327 GCTCTGAAGTCAGACAGAACTGG - Intergenic
1173704428 20:45099601-45099623 CTTCTGGAGTCAGGCAAACCTGG + Intronic
1173847368 20:46196642-46196664 GCTCTGGAGTCAGGCAGGCTGGG + Intronic
1173855004 20:46244624-46244646 GCTTTGGAGTCAAACAGACCGGG - Intronic
1174186590 20:48710577-48710599 ACTCTGGAGTCAGACTGGGTGGG - Intronic
1174188630 20:48724175-48724197 CCTCTGGAATCAGAATGCCCGGG + Intronic
1174275796 20:49403224-49403246 TCTTTGGAGTCACACAGCCCTGG - Intronic
1174302309 20:49591678-49591700 GCTCTGGAGTCAGGCAGCCGGGG - Intergenic
1174420303 20:50395214-50395236 GCTCTGGAGTCTGACAGGTGTGG - Intergenic
1174451743 20:50624849-50624871 GCTCTGGAGGCAGACAGGGCCGG + Intronic
1174527572 20:51185973-51185995 GCTCTGGAGTCAGGCAGACCTGG - Intergenic
1174635117 20:51992777-51992799 CCTCTGGATTCAGATGAGCCTGG + Intergenic
1174860470 20:54086501-54086523 GCCCTGGAATCAGACAGGCCTGG + Intergenic
1175160240 20:57002928-57002950 CCTCAGGGGACAGAGAGGCCAGG - Intergenic
1175288465 20:57855395-57855417 ACTCTGGAATCAGAGAGACCTGG + Intergenic
1175598954 20:60257217-60257239 ACTCCAGAGTCAGACAGACCTGG - Intergenic
1175794914 20:61765499-61765521 CATCTGCAAACAGACAGGCCGGG + Intronic
1175826459 20:61938941-61938963 CCTCTGCAGACAGCCAGTCCAGG + Exonic
1176019923 20:62957320-62957342 CCTGTAGAGGCAGACAGGCCAGG + Intronic
1176238368 20:64064625-64064647 CCACTGCAGTCACACAGCCCTGG - Intronic
1176910939 21:14564526-14564548 ACAGTGGTGTCAGACAGGCCTGG - Intronic
1178476113 21:32938719-32938741 CCTCTGGGGGCAGACGGGGCAGG + Intergenic
1179240122 21:39582473-39582495 ACTCAGAAATCAGACAGGCCTGG + Intronic
1179481045 21:41678848-41678870 ACTCTGGAGGCAGGCAGACCAGG + Intergenic
1179570204 21:42274059-42274081 CCTTTGGAGACAGACAGCCCTGG - Intronic
1179632367 21:42686434-42686456 CCTGTGGAGGCAGAGAGGCCCGG - Intronic
1180296569 22:10942970-10942992 CCTCTGGAGTCAGCTGAGCCTGG + Intergenic
1180412102 22:12623025-12623047 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1180733238 22:17997642-17997664 ACTCTGGAATCAGAAAGCCCAGG + Intronic
1180840399 22:18956404-18956426 ACTGTCCAGTCAGACAGGCCTGG + Intergenic
1181061092 22:20282372-20282394 ACTGTCCAGTCAGACAGGCCTGG - Intronic
1181286042 22:21753413-21753435 CCTCTGGAGTCAGATCTGGCAGG + Intergenic
1181517955 22:23426803-23426825 ACTCTGGAATCAGAAAGCCCAGG + Intergenic
1181730415 22:24842266-24842288 CCCCTGGAGTCAGACAAACCTGG + Intronic
1181787551 22:25237913-25237935 CCCCTGGAGTCAGGCAGGACTGG + Intergenic
1181846386 22:25712594-25712616 GCTTTGGAGTCAGACAGACTGGG + Intronic
1181894387 22:26093921-26093943 CCTCTGGAGTCAGGCAGGCCTGG + Intergenic
1181915416 22:26275904-26275926 ACTCTGGACACAGCCAGGCCAGG + Intronic
1181965080 22:26650832-26650854 CTTCTGGAATCAGACAGCACTGG + Intergenic
1181988366 22:26817751-26817773 ACTTTGGAGTCAGGCAGACCTGG + Intergenic
1182031215 22:27160881-27160903 GCTTTGGAGTCAGACAGACCTGG - Intergenic
1182081992 22:27536166-27536188 TCTTTGGAGTCAGAAAGTCCTGG + Intergenic
1182086366 22:27563820-27563842 GCTCTGGAGTCAGACAGGTCTGG + Intergenic
1182228944 22:28821743-28821765 GTTCAGGAGCCAGACAGGCCTGG - Intergenic
1182432486 22:30308190-30308212 GCTGTAGAGTCAGTCAGGCCTGG - Intronic
1182447659 22:30398796-30398818 GCTCTGGACTCAGACAGACCCGG + Intronic
1182511028 22:30820546-30820568 CCTCTGAGGTCAGCCAGACCAGG + Intronic
1182547935 22:31086283-31086305 GCCCTGGAGTCAGAGAGACCTGG + Intronic
1182831547 22:33308368-33308390 GTTTTGGGGTCAGACAGGCCTGG + Intronic
1182855132 22:33510443-33510465 CCTCTGGAGACAGGCAGCCTGGG - Intronic
1182865595 22:33601514-33601536 ATCATGGAGTCAGACAGGCCTGG + Intronic
1182940839 22:34275637-34275659 ATTCTGGAGTCAGAGAGCCCTGG - Intergenic
1182988235 22:34741590-34741612 ACTCTGCAGACAGACAGGCCTGG - Intergenic
1183075590 22:35424576-35424598 GGTCTGGAGGCAGACTGGCCAGG + Exonic
1183235849 22:36616945-36616967 CCTCAAGAATCACACAGGCCAGG + Intronic
1183303172 22:37068551-37068573 GCTCTGGAGGCAGCCAGCCCTGG + Intronic
1183371974 22:37437949-37437971 ACCCTGGAGTCCGAGAGGCCTGG + Intergenic
1183439159 22:37813459-37813481 CCTCTGGGGTCAGCAGGGCCTGG - Exonic
1183578440 22:38706972-38706994 ACTTGGGAGTCAGACAGGGCTGG + Intronic
1183598978 22:38829067-38829089 ACTTTGGAGTCAGACAGCCCAGG + Intronic
1183705951 22:39475003-39475025 TTCCTGGAGTCAGAGAGGCCTGG + Intronic
1183798060 22:40137348-40137370 CCTCTGGAGTCAGACAGGCCTGG - Intronic
1184015036 22:41779485-41779507 GCTCTAGAGTCAGGAAGGCCTGG + Intronic
1184274937 22:43404823-43404845 CCTGAGGCGTCAGACAAGCCTGG - Intergenic
1184444123 22:44537336-44537358 CTTTTGGAGTCAGAAAGGACTGG - Intergenic
1184450469 22:44579583-44579605 CTTCAGGGGTCAAACAGGCCTGG - Intergenic
1184549582 22:45197334-45197356 CCTCTGCAGTCTGTGAGGCCTGG - Intronic
1184619623 22:45666382-45666404 GCTCTGGAGTCAGACAGACCTGG - Intergenic
1185203954 22:49526103-49526125 GCTTTGGAGTGAGACAGACCAGG - Intronic
1185235180 22:49708251-49708273 CCTCTGGAGTCACAGAGGTCAGG + Intergenic
1185354842 22:50362068-50362090 CCTCTTGAGCCAGGGAGGCCTGG - Intronic
949552781 3:5125062-5125084 CCTTTGAAGTCAGACAGCCCTGG + Intronic
949710838 3:6869187-6869209 ATTCTGGAGCAAGACAGGCCTGG + Intronic
949851859 3:8428131-8428153 TCTCTGGAGTCTGACATGTCTGG + Intergenic
949875870 3:8625705-8625727 CCTTTGCAATCAGACAGACCTGG + Intronic
949918917 3:8986174-8986196 GCTCTGGAGTCAGACAGACACGG + Intronic
949948324 3:9207936-9207958 ACTCCGCAGTGAGACAGGCCTGG - Intronic
950187126 3:10952082-10952104 GCTCTGGAGTCACACAGGCCTGG + Intergenic
950202380 3:11054452-11054474 ACTCTGGAGTCAGACAATCCTGG - Intergenic
950206758 3:11086871-11086893 GCTTTGGTGTCAGACAGACCTGG - Intergenic
950472307 3:13193812-13193834 CTGGTGGAGTCACACAGGCCAGG - Intergenic
950486141 3:13275012-13275034 GCCCTGGAGGCAGACAGACCTGG + Intergenic
950541424 3:13615474-13615496 CCTCTGGAGTCAGGCAGACTTGG + Intronic
950618376 3:14180784-14180806 GCTTTGGAGTCAGGCAGTCCGGG - Intronic
950680659 3:14583078-14583100 CCTATGGAGTGAGAAAGACCTGG - Intergenic
950689347 3:14643288-14643310 TCTTTGCAGTCAGACAGCCCTGG + Intergenic
952135603 3:30415780-30415802 TCTCTGTACTCACACAGGCCTGG - Intergenic
952199628 3:31112733-31112755 CTTCTGGAGTCAGACTAGCAAGG + Intergenic
952312925 3:32206582-32206604 ACTCTGGAGTCAGACTGCCTAGG - Intergenic
952499335 3:33945315-33945337 GCTTTGAAGTCAGACAGACCTGG - Intergenic
952642767 3:35617536-35617558 CCTCTGGAGGAAGTCTGGCCTGG - Intergenic
952746737 3:36788570-36788592 AATTTGGAGTCAGACAGGCCTGG + Intergenic
952934246 3:38383270-38383292 CATCTGGAGCCAGACTGGCTTGG - Intronic
953440840 3:42915726-42915748 ACTCTGCAGTCAGATAGGCCTGG - Exonic
953459585 3:43071963-43071985 GCTCTGGAGTCAAACAGACCTGG - Intergenic
953487894 3:43319576-43319598 CATCTGGAGTGAGGCAGGCTTGG - Intronic
954810111 3:53242335-53242357 CCTGAGGAGTCACACAGGCCTGG + Intronic
954863512 3:53709968-53709990 GCTCTGGACTCTGACAGGCCAGG - Intronic
955082446 3:55670546-55670568 GCTCTGGAGTCAGACATACCTGG + Intronic
955132288 3:56182675-56182697 GCTCTGGAGTCAGACTGCCTGGG - Intronic
955277289 3:57558379-57558401 GCTTTGGAGTCAGGCAGACCTGG - Intronic
955354702 3:58221814-58221836 ACTCTGGTGTCAAACAGTCCTGG - Intergenic
955397540 3:58567598-58567620 TCTCTGCAGTCAAACAGGCCTGG - Intronic
955430617 3:58840930-58840952 CAGCTGGAATCAGACAGGCCTGG - Intronic
955687018 3:61559207-61559229 GCTGTGGAGGCAAACAGGCCTGG + Intergenic
955793844 3:62614744-62614766 ACTCTGGAATCAGACACACCTGG + Intronic
955904045 3:63788310-63788332 GCTCTGGAGTCAGAAAGACTTGG - Intergenic
956051234 3:65250767-65250789 CCTCTGGGGTGAGACAGTCCTGG - Intergenic
956859328 3:73307029-73307051 GCTCTGGAGTCTGAGAGGACTGG - Intergenic
957837346 3:85613825-85613847 TCTCTGAAGTCTGACAGGCCAGG + Intronic
957913198 3:86649884-86649906 CCTGTGGAATCAGAAAGGCAAGG - Intergenic
958660154 3:97056725-97056747 CCTCTGGAGTTAAACAGACCTGG + Intronic
958997434 3:100920869-100920891 ACTTTTGAGTCAGACAGACCTGG - Intronic
959538226 3:107511177-107511199 CTTCTGGAGTCAGAAAGATCTGG - Intergenic
959622637 3:108414669-108414691 TCTGTGGACTTAGACAGGCCTGG + Intronic
960036861 3:113110607-113110629 GCTCTGCAGTCAGACAGAGCTGG + Intergenic
960202518 3:114854580-114854602 GCTTTGGAGTCAGACAGACCTGG + Intronic
960460717 3:117931731-117931753 GCTTTGGGGTCAGAAAGGCCTGG - Intergenic
960660088 3:120048426-120048448 ACTCTGGAGCCAGACAGCCTGGG + Intronic
960675143 3:120186306-120186328 CCTTTGGAGTCAGTCAACCCTGG - Intronic
960723127 3:120644058-120644080 CCTTTGGAGTCAGACAGATATGG + Intronic
960801814 3:121547487-121547509 ACTCTGGAGTCAGTCAGTCTAGG + Intergenic
960962610 3:123082901-123082923 GCTCAGGAGTCAGACAGACCTGG - Intronic
961122823 3:124387532-124387554 CCTTTAGAGTCAGAAAGACCTGG - Intronic
961613117 3:128156365-128156387 GCTTTGGAGTCAGGCAGACCTGG - Intronic
961823548 3:129587321-129587343 ACTGTGGGGTCAGGCAGGCCTGG - Intronic
962636001 3:137332068-137332090 CCTTTGGGGTCAGAGAGCCCAGG - Intergenic
963198682 3:142564310-142564332 ACTTTGGAGTCAGACAGGCAAGG + Intronic
963264778 3:143229080-143229102 GCTTTGGGGTCAGACAGCCCTGG + Intergenic
963487737 3:145957327-145957349 ACTCTGGAGGCAGACAAGGCCGG + Intergenic
964177964 3:153848497-153848519 CTTTTGGAATCAGACAGCCCAGG - Intergenic
964310297 3:155385152-155385174 CCTCTGGAGTTTCAGAGGCCAGG + Intronic
964366074 3:155952025-155952047 ACTGTAGAGTCAGACAGGCCTGG + Intergenic
964402560 3:156314461-156314483 CCCCTGGAGTCAGGCAGGTTGGG - Intronic
964809379 3:160646948-160646970 CCTCTGGAGTCAGACAGACCTGG - Intergenic
965383539 3:168019107-168019129 ACTATGGAGTCAGAAAGACCTGG + Intronic
966026344 3:175287582-175287604 ACTCTGGAGTCAGACAGCATGGG - Intronic
966209706 3:177440406-177440428 TCTCTGGAGTCAGACGGACTTGG + Intergenic
966319489 3:178685180-178685202 GCTCTGAAGTGAGGCAGGCCTGG + Intronic
966407904 3:179618151-179618173 GCTTTGGAGTCAGACAGACCTGG + Intronic
966418031 3:179709047-179709069 GCTCTGGATGCAGACAGCCCAGG + Intronic
966738239 3:183207441-183207463 ACCCTGGAGTCAGACAGACCCGG + Intronic
966846482 3:184134664-184134686 ACTCTGCAGTCAGACAGATCGGG + Intergenic
966943784 3:184763340-184763362 ACTCTGGGATCAGACAGACCTGG - Intergenic
967197397 3:187040441-187040463 CTTTTAGAGTCAGACAGACCTGG + Intronic
967408826 3:189147105-189147127 GCTCTGGAGTCAAACAGACCGGG - Intronic
967516697 3:190378020-190378042 TCTCTGGAGTCAGTCAAACCTGG + Intronic
968498564 4:932480-932502 CCGCTTGAGTCAGCCCGGCCGGG - Exonic
968946046 4:3664875-3664897 CCTCTCCAGACAGACAGCCCTGG + Intergenic
969081029 4:4618221-4618243 GCTTTGGAGTTAGACAGGCCTGG + Intergenic
969084910 4:4649053-4649075 GCTTTGGAGTCAGACAGACCTGG - Intergenic
969211658 4:5692491-5692513 GATTTGGAGTCACACAGGCCTGG - Intronic
969327042 4:6450108-6450130 GCTTTGGAGTCAGACAAGGCTGG + Intronic
969398474 4:6938346-6938368 CCTCTGGAGAGGGCCAGGCCAGG + Intronic
969538553 4:7771680-7771702 GCTCTGGGGTCACACAGGCCAGG - Intronic
969659390 4:8517729-8517751 GCTCTGGGGTCAGACACACCTGG + Intergenic
970431018 4:15989190-15989212 GCTTTGGAGTTAGACAGACCTGG - Intronic
970602373 4:17650517-17650539 GCTGTGGAGTCAGAAAAGCCAGG + Intronic
971172902 4:24251755-24251777 GCTGTGGAGTCAGACAGGCCTGG - Intergenic
971888638 4:32486810-32486832 GCTCTGGAGTCAGATAGCCTAGG + Intergenic
972285235 4:37642012-37642034 ACCCTGGAGTCAGACAGACCAGG - Intronic
972337024 4:38116242-38116264 GCCCTAGAGTCAGAGAGGCCTGG - Intronic
972998247 4:44910999-44911021 CCTCTGGAGTAAGACTGCCTGGG + Intergenic
973197959 4:47467152-47467174 GGTCTAGAGTCAGACAGACCTGG + Intergenic
973643547 4:52927040-52927062 CCTCTTGAGTAGGACAGTCCCGG + Intronic
973720010 4:53713630-53713652 GCTTTGGAGTCAAGCAGGCCTGG + Intronic
973942033 4:55920823-55920845 CAGCTGAAGTCAGACAAGCCAGG - Intergenic
974088441 4:57285548-57285570 ACTTTGGAATCAGACAGACCTGG + Intergenic
974356741 4:60822289-60822311 GCTTTGAAGTCAGGCAGGCCAGG - Intergenic
974397338 4:61354701-61354723 CCTCTGGGTTCAGAGAGGCCAGG + Intronic
975168121 4:71201033-71201055 GCTCTGGAGCCAGAGAGCCCAGG + Intronic
975468042 4:74732397-74732419 AGTTTGGAGTCAGACAGACCTGG - Intergenic
976770391 4:88646061-88646083 GCTTTGAAGTCAGACAGACCTGG + Intronic
977109198 4:92930186-92930208 CCTTTGGATTCAGACAGATCCGG - Intronic
977852263 4:101844592-101844614 GGTTTGGAGTCAGACAGACCTGG + Intronic
977916453 4:102599640-102599662 GCTTTGGAGTAAGACAGGCCTGG + Intronic
978424104 4:108564124-108564146 GCTCTGACGTCAGACAGCCCTGG - Intergenic
979694674 4:123599412-123599434 ACTTTGGAGTCAGACAGGCCTGG - Intergenic
979729539 4:124007769-124007791 CCTCTGTAGTCAGACAAATCTGG - Intergenic
979734493 4:124065607-124065629 CCTCTGGAGTGAGGCAGGCTAGG + Intergenic
980101919 4:128550445-128550467 GCTTTGGAGTCAGACAGACCGGG - Intergenic
980809705 4:137859946-137859968 GCTCTGGAGTCAGACCAGCTGGG + Intergenic
980872614 4:138626887-138626909 CCTCTGGGGTAAAACAGTCCAGG + Intergenic
981107789 4:140900979-140901001 ACTTTGGAGTCAGACAGATCTGG - Intronic
981483886 4:145264568-145264590 CCTTTAGAGTCAGAAAGACCTGG + Intergenic
981772756 4:148328840-148328862 CATCTGGACTCAGAAAGCCCTGG - Intronic
983280858 4:165679380-165679402 GCTTTGGAGTCAGACAGACCTGG + Intergenic
983286699 4:165748996-165749018 ACTCTGGAGTCAGACGGCCTGGG + Intergenic
984388348 4:179094339-179094361 ACTTTGGAGTGAGACAGCCCTGG - Intergenic
984838909 4:184050308-184050330 CTTCTGGAGTCAGACAATCTGGG - Intergenic
984980760 4:185278320-185278342 GCTCAAGAGTCAGACAGACCTGG + Intronic
985121488 4:186647422-186647444 ACTCTGGAATCAGACAGACTTGG - Intronic
985438502 4:189959463-189959485 CCTCTGGAGTCAGCTGGGCCTGG - Intronic
986044626 5:4025204-4025226 CCTGTGGGGCCTGACAGGCCTGG - Intergenic
986352483 5:6893482-6893504 GCTCTGGAGTCAGATAGAACTGG + Intergenic
987212373 5:15695793-15695815 TCTCTGGATTCAGACAGGCCAGG - Intronic
987243742 5:16027474-16027496 CCTCTGGATCCAGACAACCCGGG + Intergenic
987243854 5:16028518-16028540 TCTCCAGAGTCAGACAGTCCTGG - Intergenic
987312055 5:16690555-16690577 GCTCAGGACCCAGACAGGCCAGG + Intronic
988593677 5:32571139-32571161 CCTCTGGAGTCCAATAGGCCTGG + Intronic
988706480 5:33730929-33730951 GCTCAGGAGTCAGACAGACCCGG + Intronic
988959898 5:36359296-36359318 ACTCTGAAGTCAGGCAGGACTGG - Intergenic
988985443 5:36614048-36614070 GCTCTGGAGTCAGACAGCCTAGG + Intronic
989213777 5:38882927-38882949 CCTCTGGAGCCAGACTGTCTGGG - Intronic
990902819 5:60771537-60771559 ACTCTGATGTCAGACAGACCTGG + Intronic
991569450 5:68039041-68039063 CCTCTGTAGTCAGTCAGACTAGG - Intergenic
991922067 5:71666952-71666974 GCTCTGGAGTCAGACAAACTTGG - Intergenic
991983260 5:72255784-72255806 GCTCTGGAGTCAGACTGTCTGGG - Intronic
992023307 5:72646899-72646921 GCTCTGGAGTCAGACAGACTTGG - Intergenic
992328628 5:75690765-75690787 TCTCTGGAGTCAGGCAAGTCTGG - Intronic
992993895 5:82313654-82313676 ATTTTGGAGTCAGACAGACCTGG + Intronic
993126935 5:83846858-83846880 CTCCTGGAGCCAGACAGGCTGGG - Intergenic
993463138 5:88210502-88210524 CTGCTGGAGTCAGAGTGGCCTGG - Intronic
993565672 5:89471971-89471993 ACTCTGGAGTGAGGCAGACCTGG + Intergenic
994005758 5:94835674-94835696 GCTTTGAAGTAAGACAGGCCCGG - Intronic
994118826 5:96091120-96091142 GCTTTGGAGACAGACAGGCCTGG + Intergenic
995132408 5:108644331-108644353 GCTCTGAAGTTAGGCAGGCCTGG + Intergenic
995150379 5:108837110-108837132 GCTTTGGAGTCAGAGAGTCCTGG + Intronic
995250741 5:109990590-109990612 ACTTTGGAGTCAAACAGTCCTGG - Intergenic
995813892 5:116144493-116144515 ACTATGGAGTCAGACAGACCTGG - Intronic
996316152 5:122162979-122163001 CAACTGGAATCAGACAGACCTGG + Intronic
996705073 5:126489489-126489511 ACTTTGCAGTCAGACAGGCCTGG - Intronic
997379741 5:133427097-133427119 GCTCTGGAGTCAGGCAGCCCTGG + Intronic
997522091 5:134529420-134529442 CTTCTGGAGTCAGACAGCCTAGG + Intronic
997612155 5:135222883-135222905 ACTCTGCAGTCAGACAGGCAGGG - Intronic
997722384 5:136089491-136089513 GCTTTGGAGTCAGCAAGGCCTGG - Intergenic
997825439 5:137102663-137102685 GCTCTTGAGTCAGACAGACCAGG + Intronic
997847232 5:137297996-137298018 TCTCTGGAATCAGACAGACGTGG + Intronic
997882217 5:137601382-137601404 GCTCAGAAGTCAGACAGACCTGG - Intergenic
998006444 5:138660066-138660088 ACTCTGGAGTCAGACTGATCTGG + Intronic
998133498 5:139662749-139662771 ACTCTGGAGTTGGACAGGCCTGG + Intronic
998135456 5:139671876-139671898 GCCCTGGAGTCACACAGACCTGG + Intronic
998147747 5:139739909-139739931 CCTCTTGCATGAGACAGGCCTGG - Intergenic
998257027 5:140595785-140595807 CATCTGGAGTGAGGAAGGCCTGG - Intergenic
998393752 5:141804965-141804987 GCTCTGCAGGCAGACAGGACTGG + Intergenic
998411271 5:141913456-141913478 GCTCTGGAGTCAGACTGCCTGGG - Intergenic
998416450 5:141949700-141949722 CCTCTAGAGTCAGACCAACCTGG + Intronic
998482226 5:142472312-142472334 GCTCTGGAGTCACACAGACTTGG + Intergenic
998556512 5:143130131-143130153 CCTCTGCAGTCAGACAAACCTGG - Intronic
998566333 5:143219149-143219171 TCTCTGGAGTCAAACAAGCTGGG + Intronic
998793508 5:145792199-145792221 ACTCTGGGGTCAGACAAGCTTGG + Intronic
998880610 5:146641268-146641290 GCTCTGGAGTCAGACAAGCTTGG - Intronic
999132467 5:149294889-149294911 GATGTGGGGTCAGACAGGCCAGG + Intronic
999293406 5:150442406-150442428 CCTCAGGAGGCAGACACACCTGG - Intergenic
999327216 5:150650737-150650759 CCTGTGGAGTCAGCCAGCCGAGG + Exonic
999377496 5:151096992-151097014 TCTGTGGAGGCAGGCAGGCCTGG - Intergenic
999378689 5:151104851-151104873 GCTCTGGAGGCACACAGGGCTGG - Intronic
999388372 5:151171926-151171948 GCTCTGGAGTTAGGCTGGCCTGG + Intergenic
999473373 5:151875852-151875874 CCTCAGGAGTCAGGCAGCCTGGG + Intronic
999495419 5:152091709-152091731 GCTCTGGAGTCAGGCAGCCTGGG + Intergenic
999716072 5:154361273-154361295 GCTCTGGAGTCAACCCGGCCTGG + Intronic
999750411 5:154624273-154624295 CCTCTGGAGTTGCACAGACCAGG + Intergenic
999825541 5:155270138-155270160 GATCTGGGGGCAGACAGGCCTGG + Intergenic
999855398 5:155587678-155587700 CCTCTGCCCTGAGACAGGCCTGG + Intergenic
999871478 5:155756052-155756074 CCTCTGGAGTTAGCCAGACATGG + Intergenic
1000005953 5:157185142-157185164 CTTCTGGAATCAGACAGATCTGG + Intronic
1000039143 5:157472210-157472232 GCTCTAGAGTCAGACAAACCCGG - Intronic
1000260260 5:159581344-159581366 ACTCTGGAGTCAGATAGGCTGGG + Intergenic
1000274709 5:159723619-159723641 CATGTGGAGTCGCACAGGCCAGG + Intergenic
1000378013 5:160602286-160602308 ACTCTGGAGTCAGACACGTTGGG - Intronic
1000385678 5:160672631-160672653 CCTCTGAAGGCAGCCAGACCGGG + Intronic
1000433999 5:161185533-161185555 CCTCTGGAGTCCCACAGGGCAGG - Intergenic
1000505230 5:162108591-162108613 CCACGGGAGTCAGACAGCTCAGG + Intronic
1000617629 5:163446439-163446461 CCTCTGGAGTCAGAACTGCCTGG - Intergenic
1000724615 5:164753875-164753897 ACTCTGGAGCCAGACTGCCCTGG - Intergenic
1000978141 5:167787402-167787424 GCTCTGGATTCAGCCAGGCCTGG - Intronic
1001080516 5:168663988-168664010 GTTCTGGAGTCAGACAGCCTGGG + Intronic
1001087955 5:168715122-168715144 GCTCTGGAGTCAGACTGCCTGGG + Intronic
1001193591 5:169652383-169652405 TCTCTGGAGTCAGACAGATGTGG - Intronic
1001246224 5:170107388-170107410 CTTCTGGGGACAAACAGGCCTGG - Intronic
1001489527 5:172145639-172145661 ACTCTGGAGCCAGACACACCTGG + Intronic
1001513104 5:172337334-172337356 GCACTGAAGTCAGGCAGGCCTGG + Exonic
1001633985 5:173196786-173196808 GCTTTGGACTCAGACAGCCCTGG - Intergenic
1001652286 5:173324385-173324407 CCTCTGTTTTTAGACAGGCCCGG + Intronic
1001659712 5:173382270-173382292 GCTTTGGAGTCAGACAGACTGGG + Intergenic
1001715962 5:173816306-173816328 GCTCTGAAGTCAGACAGACTCGG + Intergenic
1001809659 5:174618197-174618219 GCCTTGCAGTCAGACAGGCCTGG - Intergenic
1001828336 5:174764582-174764604 GCTCAGGAATCAGACAGGCGTGG + Intergenic
1001941238 5:175741157-175741179 CCTCTGGAGACAGAGGGGTCTGG - Intergenic
1002109972 5:176902058-176902080 GCTCTGGGGTCAGGCAGACCTGG + Intergenic
1002292564 5:178209807-178209829 GCTTTGGAGTCAGAGGGGCCTGG - Intronic
1002292683 5:178210357-178210379 GCTTTGGAGTCAGACAGGCCTGG + Intronic
1002803284 6:547355-547377 CCTCTGGTGTGAGCCAGGGCAGG - Intronic
1002931485 6:1637920-1637942 TCTTTGGAGTCAGATAAGCCTGG - Intronic
1002981109 6:2139704-2139726 TCTCTGGAGTCAGACTGTCTGGG - Intronic
1003487424 6:6591749-6591771 GTTCTGGAGTCAGGCAGGCTGGG - Intronic
1004276868 6:14244364-14244386 GGTCTGGAGTCAGACAGACCTGG - Intergenic
1004412054 6:15390251-15390273 GCTCTGCAGTCAGACAGCTCAGG - Intronic
1004570292 6:16838315-16838337 GCTTTGGAGTCAGGTAGGCCTGG + Intergenic
1005059232 6:21761106-21761128 GCTCTGGCCTCAGCCAGGCCAGG - Intergenic
1005120146 6:22380330-22380352 CATCTGGAGTCACACAGACCTGG + Intergenic
1005502012 6:26436900-26436922 ACTCTGGAGTGAGACAGCCTGGG + Intergenic
1005821316 6:29602009-29602031 GCTCTGGAGTCAGACTGCCAGGG - Intronic
1006429985 6:33989421-33989443 ACTCTGGAGGCAGCCAGGCCTGG + Intergenic
1006565445 6:34952494-34952516 CCTCTGGACTTTGACAAGCCAGG + Intronic
1006639413 6:35481737-35481759 GCTCTGGAGTCAGACCGCCTGGG - Intronic
1006775930 6:36592589-36592611 GCTCTGGAGTCAGGCAGTCCTGG - Intergenic
1006812123 6:36826829-36826851 GCTCTGCAGTCAGACAAGCTGGG + Intronic
1007169281 6:39851258-39851280 GCTTTAGAGTCAGACAGTCCTGG + Intronic
1007291137 6:40787752-40787774 GCTTTGGAGTCAGACAGAACAGG + Intergenic
1007325524 6:41056550-41056572 GATTTGGAGTCAGACAGTCCTGG - Intronic
1007350670 6:41271412-41271434 GTTCTGGAATCAGACAGGGCTGG - Intronic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007476460 6:42122856-42122878 CCCTCTGAGTCAGACAGGCCTGG - Intronic
1007684564 6:43657678-43657700 GCTGTGGAATCAGACAGGCTGGG + Intronic
1007790936 6:44307795-44307817 CACCTGGAGTCCAACAGGCCCGG - Intronic
1007814651 6:44512968-44512990 GCTCTGGAGTCCAACAGACCTGG + Intergenic
1007835880 6:44673256-44673278 GCTTTGGAGTCAGACAGCACTGG + Intergenic
1007989866 6:46243965-46243987 TCTCTGGAGTCAGAAGCGCCAGG + Intronic
1008904040 6:56656658-56656680 GCTCTGTAGTCAGACAGACCTGG - Intronic
1010036022 6:71326772-71326794 CCTCTGGAGTCAGTCTAGCTGGG - Intergenic
1010515111 6:76762956-76762978 CCTCTGAATTCAGACAGGAAGGG - Intergenic
1011460515 6:87598458-87598480 GCTCTGGAATCAGACAGGTTGGG - Intronic
1012219492 6:96631113-96631135 ACTTTGGTGTCAGACAGACCTGG + Intergenic
1012553792 6:100488507-100488529 GACTTGGAGTCAGACAGGCCTGG - Intergenic
1013080099 6:106804992-106805014 GCTCTGGAGTCAGACAGATTTGG - Intergenic
1013434370 6:110087406-110087428 GCTGTGGAGTCAGACAGACCTGG + Intergenic
1013911077 6:115277127-115277149 CCTTTGGAGTCAAATATGCCTGG + Intergenic
1014175235 6:118324887-118324909 TCTTTGCAGTCAGACATGCCTGG - Intergenic
1014211639 6:118714585-118714607 GCTTTAGAGTCGGACAGGCCTGG + Intergenic
1014227001 6:118860748-118860770 CCTCTGGTGCCAGAAAGGCTGGG - Intronic
1014803695 6:125806028-125806050 CCTTTAAAGTAAGACAGGCCTGG - Intronic
1015283879 6:131462952-131462974 CCTCTGGAGTCAGGCTGCCTGGG + Intergenic
1015382227 6:132582718-132582740 GCTAAGGAGTCAGACAGGCCTGG - Intergenic
1015555742 6:134459643-134459665 CCTCTGGAGAAAGACAAGGCTGG - Intergenic
1015607157 6:134970072-134970094 GCCCTGAAGTCAGACAGACCTGG + Intronic
1015729071 6:136329905-136329927 GCTCTGGAGGCAGACAGACCTGG + Intergenic
1015818965 6:137239879-137239901 ATTCTGGAGTCAGACAGCCATGG + Intergenic
1015828584 6:137342987-137343009 GCTCTGGAGGCAGGCAGGCTGGG + Intergenic
1015865605 6:137723535-137723557 ACTCTGGACTCAGACAGACCTGG + Intergenic
1016528971 6:145037339-145037361 TCTCTGGAGTCAGACAGATCTGG + Intergenic
1016760894 6:147735871-147735893 ACTCTGGATTTAGACAGGCTTGG + Intronic
1016788497 6:148040648-148040670 TCTTTGGAGTCAGATAGACCTGG + Intergenic
1017183820 6:151579970-151579992 GCTTTGGAGTCAGATAGCCCTGG - Intronic
1017281999 6:152636148-152636170 CCGCTGGAGTCTGACGCGCCAGG + Intronic
1017466023 6:154694537-154694559 GGTCTGGAATCAGACAGGCCTGG - Intergenic
1017712392 6:157182324-157182346 TGTCTGGAGTCAGACAGACCTGG - Intronic
1017771546 6:157648680-157648702 CCACAGGGGTCAGACATGCCTGG + Intronic
1018203814 6:161417987-161418009 CCCATGGAGTCAGCCAGGCCTGG - Intronic
1018435287 6:163753399-163753421 GCTCTGGAATCAGACAGCCTGGG + Intergenic
1019023413 6:168938326-168938348 GCTCCTGAGTCAGACAGACCTGG - Intergenic
1019352231 7:559690-559712 GCTGTGGAGTCAGGGAGGCCAGG + Intronic
1019417801 7:935295-935317 CCTCTGGAGCCAGAGATGCCGGG - Intronic
1019426548 7:980174-980196 GGGCTGGAGTCAGACAGACCTGG - Intergenic
1019563295 7:1668192-1668214 CCTCTGGGGTCAGGCAGTACCGG + Intergenic
1019648589 7:2144106-2144128 GCTCTGGAGACCCACAGGCCTGG + Intronic
1019807304 7:3137344-3137366 CCACTGGCGTAAGACAGGCAGGG - Intergenic
1019851045 7:3557805-3557827 TCTCTGGAGTCATACAGTCAGGG - Intronic
1019896919 7:3989960-3989982 GCTCTGGAGTCAGACAGCACAGG - Intronic
1020185500 7:5956295-5956317 ACTCTGGAGTCACACAGACTTGG + Intronic
1020297414 7:6768454-6768476 ACTCTGGAGTCACACAGACTTGG - Intronic
1020357205 7:7290638-7290660 ACTTTGGAGTCAGATAGACCTGG - Intergenic
1020800107 7:12722387-12722409 CCACTGGAATCAGACAGATCTGG + Intergenic
1021573145 7:22084919-22084941 CCTCTGGAATCATACAGCCCTGG + Intergenic
1021765173 7:23941728-23941750 GCTATGGAGTCAGACAGGTCTGG + Intergenic
1021816318 7:24450836-24450858 GCCCTAGAGTCAGACAGACCTGG - Intergenic
1022259857 7:28693630-28693652 GTTTTGGAGTCAGACAGACCTGG + Intronic
1022319953 7:29278950-29278972 CCTCTGGAGGGAGACAGGCCTGG - Intronic
1022320436 7:29283120-29283142 CCACTGGAGTCAGTCAGTCCTGG + Intronic
1022702974 7:32778642-32778664 ACCCTGGAGTCAGGCAGGCAGGG + Intergenic
1022747371 7:33186378-33186400 CCTCTAGATGCAGACAGGCTGGG - Intronic
1022981165 7:35606115-35606137 CCTGGGGTGGCAGACAGGCCAGG + Intergenic
1023034583 7:36119183-36119205 ACTCTGAAGCCAGACAGCCCCGG - Intergenic
1023167655 7:37358733-37358755 GCTTTGGAGGCAGACAGACCTGG + Intronic
1023454767 7:40326253-40326275 GCTTTGGGGTCAGACAGGCCTGG + Intronic
1023781555 7:43660615-43660637 GCCCTGGAGTCAGGCAGACCTGG - Intronic
1023874498 7:44279433-44279455 CCTCTGGAGCCACACACGGCTGG + Intronic
1024064215 7:45719128-45719150 TCTCTGGAGGCAGACAGGGTGGG + Exonic
1024083424 7:45874307-45874329 ATTTTGGAGTCAGACAGTCCTGG - Intergenic
1024411967 7:49054083-49054105 CCTCTGGATTCTGATAGGTCTGG + Intergenic
1024659731 7:51482033-51482055 GCTTTGAAGTCAGACAGGCCTGG - Intergenic
1025250663 7:57349272-57349294 GCTCTGGAGTCTGACAGGTGTGG + Intergenic
1026329632 7:69340493-69340515 GCCCTGGAGTCGGACAGTCCTGG - Intergenic
1026338161 7:69412487-69412509 ACTCTGGAGGCAGACAGTCTAGG - Intergenic
1026468400 7:70674034-70674056 GCTCTGGAGTGAGGCAGACCAGG - Intronic
1026683718 7:72490382-72490404 ACTCTGGAGTCAGGCAGACGCGG + Intergenic
1028081156 7:86578556-86578578 TCTCTGGAGTCAGACAGACATGG + Intergenic
1029365340 7:100112860-100112882 CCCCTGAAGTCAGCCAAGCCAGG - Exonic
1029654023 7:101912594-101912616 CCTCTGGAGAGAGCCAGGCACGG + Intronic
1029894766 7:103971209-103971231 TCTCTGGAATCAGACATGCCTGG - Intronic
1030148061 7:106376442-106376464 TCTCTGAAGTCTGACAGGCTTGG + Intergenic
1030928115 7:115482484-115482506 ACTCTGGAGCCAGACTGTCCGGG + Intergenic
1031018075 7:116597141-116597163 TCTCTGGGATCAGACAGACCTGG - Intergenic
1031086557 7:117307438-117307460 ACTTTGGTGTCAGACAGGCTTGG - Intronic
1031101790 7:117490092-117490114 ACTTTGGAATCAGACAGACCTGG + Intronic
1031607956 7:123792345-123792367 CTTTTGGAGTCAGACAGCTCTGG + Intergenic
1031913067 7:127537592-127537614 CCCCTGGAGTCAGGAAGGCAGGG + Intergenic
1032000780 7:128263829-128263851 TGTCAGGAATCAGACAGGCCAGG - Intergenic
1032333232 7:130999720-130999742 GCTTTGGAGTCAGACAGACTTGG - Intergenic
1032381261 7:131484310-131484332 GCTTTGGAGTCAGACAGACATGG + Intronic
1032468795 7:132163515-132163537 CCTTTGGGATCAGACAGACCTGG - Intronic
1032522521 7:132556586-132556608 ACTTTGGAGGCAGACAGGTCTGG - Intronic
1032641170 7:133770334-133770356 GCTCTGGAATCACACAGGCCTGG - Intronic
1032643801 7:133798674-133798696 GGTCTGAGGTCAGACAGGCCTGG - Intronic
1032696985 7:134345621-134345643 ACTCTGGAGCCAGACAGACCCGG - Intergenic
1032758615 7:134916191-134916213 CCTCTGGAGTCAGGCAGGTAGGG + Intronic
1032793522 7:135259655-135259677 GCTTTGGAGTCACACAGGACTGG - Intergenic
1034113512 7:148561884-148561906 ACTCTGGAGTCAGACTGACCAGG + Intergenic
1034562411 7:151889591-151889613 GCTCTGGAGTCAGACCTGCCTGG + Intergenic
1034872963 7:154699906-154699928 GCTCTGGAGTCGGACAGCCTGGG + Intronic
1034939015 7:155218490-155218512 ACTCTGGAGCCAGACAGCCTCGG + Intergenic
1035623874 8:1056687-1056709 GCTCTGGAGTCAGACTGAGCTGG + Intergenic
1036025189 8:4899854-4899876 TCTCTGGTGTCAGACATACCTGG + Intronic
1036213672 8:6862722-6862744 ACTCTCAAGTCAGACAGACCTGG - Intergenic
1036564763 8:9929261-9929283 CCTTTGGAATCAGACAGACTTGG - Intergenic
1036782511 8:11659313-11659335 CCTCTGGAAGCAGGCAGGACAGG - Intergenic
1037251915 8:16905475-16905497 GCTCTGGAGTCAGTCAGCTCTGG - Intergenic
1037537179 8:19835661-19835683 ACTCTGGAGTTGGATAGGCCTGG - Intronic
1037610135 8:20469116-20469138 GCTCTGGCATCAGCCAGGCCTGG + Intergenic
1037625682 8:20604819-20604841 GCTCTGGAGTCAGACAGACGTGG - Intergenic
1037693859 8:21207056-21207078 CCTCTGGAGTCAGACCACCCTGG + Intergenic
1037818589 8:22124873-22124895 CCTCTTGCCCCAGACAGGCCAGG - Intronic
1037929048 8:22866549-22866571 CCTCTGGAGTCAGACTGTCTGGG - Intronic
1038547794 8:28439292-28439314 GCTTTGCAGTCAGACAGACCTGG - Intronic
1039180782 8:34863846-34863868 ACTCTGGTGTCAGACAGACTGGG - Intergenic
1039349517 8:36746441-36746463 GCTTTGGAGTCACACTGGCCTGG - Intergenic
1040603601 8:48908716-48908738 CCCCTGGAGACACACACGCCTGG + Intergenic
1040616592 8:49043710-49043732 GCTCTGGAGCCAGGCAGACCTGG - Intergenic
1040960506 8:53027213-53027235 CCTCTGCAGTCAGAAAGGCAGGG + Intergenic
1040987740 8:53314870-53314892 GCTCTGCAGCCAGGCAGGCCAGG + Intergenic
1041362572 8:57068503-57068525 CTTTTGGAGTCAGACAGATCTGG - Intergenic
1041874845 8:62676217-62676239 TCTTTGGAGTCAGACAGATCTGG - Intronic
1042181536 8:66092428-66092450 GCTGTGGAGTCAGACAATCCTGG + Intronic
1042963301 8:74325194-74325216 CCTCTAAAGTCACACAGACCTGG - Intronic
1044109868 8:88259134-88259156 CCTCTGGAGTTACACAGACGTGG - Intronic
1044485963 8:92754844-92754866 GCTCTGGAGTCAGATAGAGCAGG - Intergenic
1045247557 8:100456848-100456870 CCTTTGGAGTTGGACAGGCCTGG + Intergenic
1045332862 8:101170705-101170727 ACTTTGGAGTCACACAGACCTGG + Intergenic
1045553542 8:103193808-103193830 CTTTTGGAGTCAGGCAGGCCTGG - Intronic
1045637256 8:104206710-104206732 ACTCAGGAATCAGACAGGCTTGG - Intronic
1046098036 8:109583331-109583353 GATTTGGAGTCAGACAGACCTGG - Intronic
1046374601 8:113360237-113360259 GCTCTGGATTCAGACAGACCAGG + Intronic
1046612264 8:116439154-116439176 CCATTGGAGTCAGACAGATCTGG - Intergenic
1046800734 8:118423675-118423697 GCTTTGGATTCAGACAGCCCTGG + Intronic
1046899307 8:119506680-119506702 TCTCTGGAGTCAGACTCACCTGG + Intergenic
1046941356 8:119934448-119934470 GCTCTGGAGTCACACAGCCTGGG + Intronic
1046952722 8:120033477-120033499 GCTCTGGAGCCAGACAGACCTGG - Intronic
1047235141 8:123034598-123034620 ACTCTGGAGTCAGACTGTCTGGG - Intronic
1047519288 8:125582167-125582189 GCTCTAGAGTCAGACAGTTCTGG + Intergenic
1047752369 8:127891471-127891493 CATGTGGAGGCAGACAGGCCTGG + Intergenic
1047962184 8:130018503-130018525 GCTCTGGAGTCAGACAATCTAGG - Intergenic
1048111403 8:131472424-131472446 CCTCTTGAATCAGCCTGGCCTGG + Intergenic
1048193177 8:132308863-132308885 ACTCTGGAGTCAGATAGACTTGG - Intronic
1048201059 8:132374131-132374153 GCCCAGGAGTCAGACAGACCTGG + Intronic
1048359924 8:133688943-133688965 TCTCTGGAGTCAGGTAGACCTGG - Intergenic
1048397862 8:134031890-134031912 GCTTTGGAGTCAGACAGCCCTGG - Intergenic
1048460433 8:134616801-134616823 ACTCCGGAGTCAGAGAGGCTGGG + Intronic
1048541908 8:135349630-135349652 GTTCTGGAGTCAGAATGGCCTGG - Intergenic
1048795897 8:138149572-138149594 ACTCTGGAGTCAGACTGCCAAGG + Intronic
1048990530 8:139757704-139757726 CCTCAAGAATGAGACAGGCCTGG - Intronic
1049001584 8:139828739-139828761 TCTCTGGAGCCAGACAGACCTGG - Intronic
1049051570 8:140201084-140201106 CCTCTGGACTCTTAGAGGCCTGG - Intronic
1049203341 8:141352185-141352207 ACCCTGGAGTCAGGCAGGGCTGG + Intergenic
1049241803 8:141541606-141541628 CCTCTGGAGCCTGAGAGCCCTGG - Intergenic
1049274279 8:141711910-141711932 CTTCTGGGCTCAGGCAGGCCTGG - Intergenic
1049607964 8:143538488-143538510 CCTCAGGACCCAGGCAGGCCCGG - Exonic
1049748589 8:144273278-144273300 GCTCTGGACGCAGACAGGCCCGG + Intronic
1049785918 8:144450770-144450792 TCTGTGGAGACAGACAGGGCCGG + Exonic
1050116701 9:2270983-2271005 CCTAGGGAGTCAGAGAGACCTGG - Intergenic
1050203680 9:3175830-3175852 ACTCTGCAGGCAGACAGACCAGG - Intergenic
1050261508 9:3845874-3845896 ACTCTGGAGTCAGATGGTCCTGG + Intronic
1050326487 9:4502664-4502686 GCTTTGGAATCAGACAGTCCTGG - Intronic
1050463124 9:5894026-5894048 ACTCTGGAGGCAAACAGACCTGG - Intronic
1050685929 9:8169270-8169292 CCTCTGGGATCAGCCAGGGCTGG - Intergenic
1050791545 9:9477163-9477185 ATTGTGGAGTCAGACAGTCCTGG - Intronic
1051710798 9:19928410-19928432 GCTCTGGAGGCAGGCAGACCTGG + Intergenic
1051983794 9:23057593-23057615 CCCCTGGAGTCTGGCAGTCCAGG - Intergenic
1052261212 9:26518527-26518549 ACTTTTGACTCAGACAGGCCTGG - Intergenic
1053277701 9:36795780-36795802 GCTCTGGAGTCAGATCAGCCTGG + Intergenic
1053292258 9:36888899-36888921 AGTTTGGAGTCACACAGGCCTGG + Intronic
1053747521 9:41214799-41214821 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1054338862 9:63835726-63835748 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1054479764 9:65650569-65650591 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1054717604 9:68572044-68572066 CTTTTGGCTTCAGACAGGCCTGG - Intergenic
1054969855 9:71072606-71072628 GCTCTGGAGTCAGACGGGTTGGG - Intronic
1055423118 9:76164292-76164314 CCTTTGGAGTTAGACAGAGCTGG + Intronic
1056027699 9:82516555-82516577 ACTTTAGAGTCAGACAGTCCTGG - Intergenic
1056096539 9:83260319-83260341 GCTTTGGAATCAGACAGGCATGG - Intronic
1056269478 9:84932961-84932983 ACTCTGGAATCAGACAGACTCGG + Intronic
1056281377 9:85044215-85044237 CCTTTGGAATCAGACAGGTCTGG + Intergenic
1056746337 9:89306934-89306956 ACTCTGGAGTCAGACAGTTTGGG + Intergenic
1057210566 9:93198930-93198952 CCTCGGGTGTGAGTCAGGCCTGG + Intronic
1057329131 9:94095973-94095995 ACTCTGGAGTCAGACAACCATGG - Intronic
1057416403 9:94867394-94867416 CCTCTGAAAGCAAACAGGCCAGG - Intronic
1057583537 9:96308999-96309021 CCTCTGGAATCAGACGGCCTGGG - Intergenic
1057702609 9:97374729-97374751 ACTCTGAAGTCAGACAGACCTGG + Intronic
1057726418 9:97571717-97571739 ACTCTGGAGTCACACAGACCTGG - Intronic
1058372662 9:104287868-104287890 GCTTTGGAGTCACACAGACCTGG + Intergenic
1058416965 9:104799334-104799356 CCTTTGGAGTCATACAGATCTGG - Intronic
1058481396 9:105399295-105399317 CCTCTCTAGTCTGACAGTCCTGG - Intronic
1058574857 9:106389714-106389736 CATTTGGAGTCAGACAGATCAGG + Intergenic
1058635991 9:107039125-107039147 ACTCTGGAGTCAGAAAGACCTGG + Intergenic
1059387824 9:113978708-113978730 ACTTTGGAGTCAGACAGACCTGG + Intronic
1059446796 9:114342962-114342984 ACTCTGGAGTCACAAAGACCTGG + Intronic
1059449016 9:114358262-114358284 GCTCTGGAGTCAGACATCCCTGG + Intronic
1059456769 9:114404655-114404677 ACTCTGGAGTCTGGCAGGTCAGG + Intronic
1059485900 9:114626612-114626634 GCCCTGGAGTCAGACAGCCCTGG - Intronic
1059731472 9:117061222-117061244 ACTTTGGAGTCAGACAGATCTGG + Intronic
1059974702 9:119702948-119702970 ACTCTGGAGTCAGAGAGAACTGG - Intergenic
1060040550 9:120296499-120296521 GCTCTGGAGTCAGACAGATCAGG + Intergenic
1060182710 9:121545494-121545516 GCTCTGGAGTCAGACAGACCAGG - Intergenic
1060276413 9:122186325-122186347 CCTCTGGTGTCAGAGGGACCTGG - Intronic
1060400246 9:123344426-123344448 GCTCTGGACTCAGCCAGTCCTGG - Intergenic
1060432951 9:123566105-123566127 ACTCTGGAGTAAGACAGACTTGG - Intronic
1060728500 9:126022046-126022068 ACTCTGGAGGCAGACAGAGCTGG + Intergenic
1060806970 9:126583908-126583930 CTTTTGGAGCCAGACAGGACTGG - Intergenic
1060862313 9:126964605-126964627 CCTCTGAGGTCAGATAGGCCTGG - Intronic
1060890647 9:127186007-127186029 GATCTGAAGGCAGACAGGCCTGG - Intronic
1060931895 9:127494363-127494385 GCTCTGGAGCAAGACAGGCCTGG + Intronic
1060971521 9:127741016-127741038 GCTCTGAAGTCAGCCAGACCTGG + Intronic
1060994731 9:127869499-127869521 CCTCCGGCGTCAGACTGACCTGG + Intronic
1061011152 9:127955394-127955416 ACTCTGAAGTCATACAGTCCTGG - Intronic
1061013209 9:127967459-127967481 GCTCTGGGGTCAGACAGCCCTGG - Intronic
1061083252 9:128384853-128384875 ACCCTGGAGTCAGACAGGCCTGG - Intronic
1061319479 9:129819184-129819206 GCTTTGGAGTGAGACAGGACTGG - Intronic
1061414328 9:130438225-130438247 ACTCTGGAGTCAGATGGACCTGG - Intergenic
1061478165 9:130883027-130883049 CGTCTGGGCTCAGACAGGCCTGG + Intronic
1061488158 9:130930695-130930717 CCTCTGCAGCCAGACGGGACAGG + Intronic
1061525066 9:131153769-131153791 GCTCTTGAGTCAGACTGCCCAGG - Intronic
1061543001 9:131288473-131288495 GCTCTGGAGTCAGACAGACGGGG - Intergenic
1061631574 9:131875411-131875433 AGGCTGGAGTCAGACAGACCTGG - Intronic
1061681749 9:132245943-132245965 GCTCTGGAGTCAGGCAGCCCTGG - Intergenic
1062095480 9:134701009-134701031 CCTCTGGAATCAGACAAGTTAGG - Intronic
1062378206 9:136274476-136274498 GTGCTGGAGTCAGACAGACCTGG + Intergenic
1062565976 9:137164152-137164174 ACTCTGGAGACAGAGGGGCCAGG - Intronic
1202783653 9_KI270718v1_random:25570-25592 CCTCTGGAGTCAGCTGGGCCTGG - Intergenic
1202803422 9_KI270720v1_random:23997-24019 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1203775546 EBV:71183-71205 GCTCTAGGGTCAGAGAGGCCAGG + Intergenic
1203448221 Un_GL000219v1:81220-81242 CCTCTGGAGTCAGCTGGGCCTGG + Intergenic
1185933642 X:4230964-4230986 CCTCTGGAGTCAGCCAGGTCAGG + Intergenic
1186201293 X:7157808-7157830 ACTTTGGAGTCAGACAGACATGG - Intergenic
1186586461 X:10879016-10879038 GGTTTGGAGTCAGACAGACCTGG - Intergenic
1186684880 X:11915746-11915768 CCTCTGGAGTCAGACTGATTGGG + Intergenic
1187373150 X:18727102-18727124 GCTATGGAGTCAGTCAGACCAGG + Intronic
1187536240 X:20143979-20144001 GCTTTGGAGTTAGAGAGGCCTGG + Intergenic
1187657575 X:21495193-21495215 ACTCTGGAGTCAGACTGCCTGGG + Intronic
1187670671 X:21663261-21663283 GCTTTGGAGTCAGACAGACTTGG + Intergenic
1188353077 X:29156173-29156195 TCTTTGGAGTCAGACAGACCAGG - Intronic
1188475900 X:30591776-30591798 GCTTTGGAGTCAGAAAAGCCTGG - Intergenic
1189348742 X:40261822-40261844 GATCTGGAGTCGGACAGGCTTGG - Intergenic
1189471328 X:41316485-41316507 CCACTGCAGTCAGACCAGCCAGG - Intergenic
1189564790 X:42230569-42230591 TCTTTGGCGTCAGACAGACCTGG + Intergenic
1189601753 X:42634355-42634377 ACTTTGGAATCAGACAGACCTGG - Intergenic
1189745377 X:44163059-44163081 CCTTTGGAGTCAGACAGAGCTGG - Intronic
1189907101 X:45772755-45772777 CTTCTGGAGTCAGACTTGCTGGG + Intergenic
1190286309 X:48963578-48963600 ACTCTAGAGTCAGATAGTCCTGG + Intronic
1190453721 X:50605705-50605727 GCTTTGGAGTCAGACAGCTCTGG + Intronic
1190516556 X:51229748-51229770 CCTTTGGAGTCCAACAGGTCTGG - Intergenic
1190522643 X:51295921-51295943 CATCTGGACTCAGACAGACCAGG + Intergenic
1190525875 X:51329099-51329121 CATCTGGACTCAGACAGACCAGG + Intergenic
1190585081 X:51932104-51932126 CATCTTGAGACAGACAGGCTGGG + Intergenic
1190744041 X:53310539-53310561 GCTTTGGAGACAGACAGACCTGG - Intronic
1190856967 X:54305623-54305645 CTTCTAGAGTCAGACAGACTTGG + Intronic
1191029263 X:55950398-55950420 CCTCTAGAGTAAAACAGACCCGG + Intergenic
1191171424 X:57451242-57451264 GATTTGGAGTCAGACAGACCTGG - Intronic
1192118777 X:68435252-68435274 CCTCTAGAGCCAGCCAGGCTGGG - Intergenic
1192184237 X:68935825-68935847 GCTCAGAAGTCAGACTGGCCTGG + Intergenic
1192227515 X:69239247-69239269 GCTCAGGAGTCAGACTGACCTGG - Intergenic
1192259364 X:69495224-69495246 ACTTTGGAATCAGGCAGGCCTGG - Intergenic
1192342243 X:70273594-70273616 GCTTTGGAGTCAGACAGGCCTGG + Intronic
1192497998 X:71629086-71629108 CCGCTAGAGGCAGACTGGCCTGG - Intergenic
1192585145 X:72313383-72313405 CCTCAGGAGTGAGCCAGACCCGG - Intergenic
1194820042 X:98494271-98494293 CCTCTAGAGTCAGACAGACCTGG + Intergenic
1195068602 X:101259040-101259062 GCTCTGGAGTCAGGCAGCTCTGG + Intronic
1195155959 X:102125262-102125284 GCTCTGGAGTCAGGCAGAGCCGG + Intergenic
1195158152 X:102142838-102142860 GCTCTGGAGTCAGGCAGAGCCGG - Intronic
1195705610 X:107736029-107736051 GCTCTGGAATTACACAGGCCTGG - Intronic
1195717833 X:107834823-107834845 ACCCTGGAGTCAGACAGACCTGG + Intronic
1195907734 X:109862410-109862432 CCTCTGGAGTCAAATAGACTTGG - Intergenic
1195964079 X:110414321-110414343 CCTCTGGAGTCAGACTGTCTGGG + Intronic
1196116396 X:112004158-112004180 ACTCTGGGGTCAAACAGGTCTGG - Intronic
1196144972 X:112306546-112306568 GCTCTGGAGTCAGGCTGGCTAGG - Intergenic
1196185521 X:112740892-112740914 GCCCTGGAGTCAGACAGAGCTGG - Intergenic
1196805401 X:119579657-119579679 GCTCTGCAGTCAGACAGGTCTGG - Intronic
1196941324 X:120779003-120779025 GCTTTGTAGTCAGACAGACCTGG + Intergenic
1197291963 X:124669288-124669310 ATTCTGGAGTCAGAGAGACCTGG - Intronic
1197840466 X:130740836-130740858 CCTTTGGAGTCAGACAGACCTGG + Intronic
1198040893 X:132851390-132851412 TCTCTGGCATCAGAAAGGCCTGG + Intronic
1198235056 X:134729479-134729501 GCTCTGGAGTCAGACTGTCTGGG - Intronic
1198376772 X:136048515-136048537 GCTCTGGAGTGACACAGACCTGG + Intergenic
1198406890 X:136322057-136322079 GCTCTGGAGTCAGACAGCCTGGG - Intronic
1198581283 X:138067523-138067545 GATATGGAGTCAGACAGGCTTGG - Intergenic
1198765472 X:140075452-140075474 GCTCTGGGGTCAGCCAAGCCTGG - Intergenic
1198765636 X:140076651-140076673 ACTCTGGAGTGAGACAGATCTGG - Intergenic
1198771829 X:140138654-140138676 GCTCTGGGGTCAGCCAAGCCTGG - Intergenic
1198812697 X:140551651-140551673 CCTCTGGAGGCTGACAGGGGAGG + Intergenic
1198848100 X:140935160-140935182 TCTCTGGAGTCTGACACACCTGG - Intergenic
1199769107 X:150962759-150962781 GCTTTGGAGTCAGAGAGACCTGG - Intergenic
1200015404 X:153158656-153158678 GCTCTGGAGTCAGACAAGCTCGG + Intergenic
1200209946 X:154342690-154342712 CCCCAGGAGACAGTCAGGCCAGG - Intergenic
1200220906 X:154389402-154389424 CCCCAGGAGACAGTCAGGCCAGG + Intergenic
1200900183 Y:8423623-8423645 TTTCTGGAGGCAGAGAGGCCTGG + Intergenic
1201395314 Y:13541223-13541245 TCTCTTGTGTAAGACAGGCCTGG - Intergenic
1201714549 Y:17029975-17029997 CCTCTGGAGTCAACCGGGCCAGG + Intergenic
1202579001 Y:26359378-26359400 GCTTTGGAGTCAGACAGACCAGG + Intergenic