ID: 1183799277

View in Genome Browser
Species Human (GRCh38)
Location 22:40148191-40148213
Sequence GTACTGCTATTGATGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183799275_1183799277 17 Left 1183799275 22:40148151-40148173 CCATGATTAGAATTGGCTAAAAT No data
Right 1183799277 22:40148191-40148213 GTACTGCTATTGATGAGACATGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183799277 Original CRISPR GTACTGCTATTGATGAGACA TGG Intronic
903977269 1:27158914-27158936 GTACTGTTTTTTCTGAGACAGGG - Intronic
905050377 1:35046031-35046053 TTACTGTTATTATTGAGACAAGG + Intergenic
908801611 1:67886204-67886226 GTAGTGCTATTCATAAGCCAAGG + Intergenic
909169059 1:72271022-72271044 GTACTTCTGTTGTGGAGACAAGG + Intronic
909417341 1:75421938-75421960 GGACTGCTATTCATGTGACAAGG + Intronic
918294469 1:183143137-183143159 CTGCTGGTATCGATGAGACAGGG - Exonic
919809968 1:201402799-201402821 GAGATGCCATTGATGAGACAGGG + Intergenic
920462355 1:206150956-206150978 GTACTTCTAGAGATGAAACATGG - Intergenic
921019071 1:211220017-211220039 GCTCTGCTGTTGCTGAGACAGGG + Intergenic
923318425 1:232804944-232804966 CTACTGTAATTGATGAGGCAGGG + Exonic
1062921365 10:1282484-1282506 ATACTGCCATTGATGACATAGGG + Intronic
1064435670 10:15309213-15309235 TTACTACTATTTTTGAGACAGGG + Intronic
1065894065 10:30146013-30146035 GTTCTCCTTTTGATGTGACATGG - Intergenic
1070407999 10:76113605-76113627 TTTCTGCTATGGATGAGAAATGG - Intronic
1073008790 10:100344352-100344374 GTATTTTTATTGTTGAGACAAGG + Intergenic
1074188743 10:111117709-111117731 CCACTGCTACTGCTGAGACATGG + Intergenic
1081401429 11:42647676-42647698 GAATTGCTAATGATGAGAAAAGG - Intergenic
1085814010 11:79716715-79716737 GTACAATTATTGATGAGAGAGGG + Intergenic
1088048542 11:105482174-105482196 GTATTGCTTTTGATGGGCCAAGG - Intergenic
1088774154 11:113066014-113066036 TTACTGTGATTCATGAGACAGGG + Intronic
1098417361 12:70250606-70250628 GTACAGCAATTGATTAGAAATGG + Intronic
1099097482 12:78392742-78392764 CTACTGCTAGTTATGTGACAAGG + Intergenic
1101195550 12:102378249-102378271 ATACTGTGATTGAGGAGACAAGG - Intergenic
1105497796 13:20945963-20945985 GTACTACTTTTGTTGAGAAAGGG + Intergenic
1109437190 13:62319518-62319540 GTACTGAATTTGATGACACAAGG + Intergenic
1109953211 13:69529671-69529693 GATCTGCTATTTATGAGCCAAGG + Intergenic
1110382579 13:74871281-74871303 GTTCTGCTAATGATAAGACAAGG + Intergenic
1111449108 13:88390917-88390939 GTACTGCTACTGATTACACAGGG - Intergenic
1115875856 14:37860820-37860842 GTACTGCTAATGCTGAGGAATGG + Intronic
1116800480 14:49438587-49438609 GTATTGTTAATGATGAGCCAGGG - Intergenic
1119404176 14:74386360-74386382 GTAAGCCTAGTGATGAGACAAGG + Intergenic
1120333123 14:83118931-83118953 GTACTGCTATTGTGTAGATACGG - Intergenic
1128461390 15:67870439-67870461 GTATTGTTGTTGTTGAGACAAGG + Intergenic
1129611157 15:77058638-77058660 GTACTGTTCTAGATGATACAAGG - Intronic
1133067927 16:3222966-3222988 GTAAGGTTATTGATGAGACATGG + Exonic
1134489393 16:14684813-14684835 TTACTTCTTTTGTTGAGACAGGG - Intronic
1137285497 16:47012886-47012908 TTATTGTTATTGTTGAGACAGGG + Intergenic
1137325592 16:47432074-47432096 CTACAGATATTGATGAGTCAAGG - Intronic
1140339752 16:74146169-74146191 GTGCTCCTAATGATGGGACAAGG - Intergenic
1141138009 16:81479074-81479096 GTTCTGCTATTGACCGGACAGGG + Intronic
1143733836 17:8896735-8896757 GCACTGGTATTAATGACACACGG + Intronic
1145098343 17:20051660-20051682 GTACTGATATTCAGCAGACAAGG + Intronic
1149695477 17:58612896-58612918 GTCCTGCTTTTTTTGAGACAGGG - Intronic
1152337150 17:79705399-79705421 TTATTGCTATTTTTGAGACAGGG - Intergenic
1156697848 18:39789106-39789128 GAACTGCTTCTGATGAGATATGG - Intergenic
1163936420 19:20448732-20448754 CTAATGCTAGTAATGAGACAAGG + Intergenic
1164140931 19:22462205-22462227 TTACTGCTAATGATGAGCCCAGG + Intronic
926348868 2:11977206-11977228 GAACAGCTATTGATCAAACACGG - Intergenic
936889472 2:117351971-117351993 GTACTGCGATTGATGAGGGATGG + Intergenic
945046004 2:205782373-205782395 GTATTGATACTGATGATACAGGG + Intronic
946766856 2:223048690-223048712 GTACTGCTAGTGATTTGACCTGG + Intergenic
947738743 2:232474940-232474962 CTACTGCTGTTCATGTGACATGG - Intergenic
1175481329 20:59313331-59313353 GTCCTGCTGTTGCTGAGCCAGGG + Intronic
1179727998 21:43350926-43350948 GTGATGCTAGTGGTGAGACAGGG - Intergenic
1183799277 22:40148191-40148213 GTACTGCTATTGATGAGACATGG + Intronic
949755040 3:7399529-7399551 GTACTGCTATGGTTTAGATATGG + Intronic
955261162 3:57391888-57391910 GTACAGCAATTGATGAGGGATGG + Intronic
956117344 3:65931655-65931677 TTACTGTTGTTGTTGAGACAAGG - Intronic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
960153544 3:114275162-114275184 GTACTGCTACTGATTATTCAGGG + Intergenic
962829335 3:139126278-139126300 GTACTGCTCTTGAGGAGCCAAGG - Intronic
965425728 3:168520369-168520391 GTACTGCTGTTTCTGAGACTAGG - Intergenic
965572130 3:170183213-170183235 GTACTGCTATTAGGTAGACAAGG - Intergenic
969094679 4:4723399-4723421 ATACTGCTACTGATCTGACAGGG + Intergenic
969537450 4:7765432-7765454 GTACATCTATTGCTGTGACATGG - Intronic
970403377 4:15739129-15739151 GCACAGCTATTGCTGAGACTGGG + Intergenic
972454241 4:39237557-39237579 GTACTTCTTTTTTTGAGACAGGG - Intronic
973214611 4:47655150-47655172 GTACTGCTACTGATTATTCAGGG - Intronic
978900487 4:113943504-113943526 GTACTAGTATAGATGAGACAGGG + Intronic
979396349 4:120194005-120194027 GTCCTGCAATTCATGAGACTTGG + Intergenic
984011976 4:174382219-174382241 GGACTGCAATTCCTGAGACAAGG - Intergenic
984245432 4:177269570-177269592 GAACTTCTATGGATGAAACATGG - Intergenic
993020803 5:82588161-82588183 GTATTGCTTCTGATGAGAAAGGG + Intergenic
994144030 5:96372649-96372671 GTATTGCTTTTGTAGAGACAGGG - Intergenic
998214435 5:140226829-140226851 GTACTGCTGATGCTGAGAGAAGG + Intronic
1001181489 5:169525076-169525098 GCACTGCTATGGATTAGATATGG + Intergenic
1009839019 6:69042759-69042781 TTTCTACTATTGATGAGACAAGG + Intronic
1011713880 6:90084224-90084246 TTCCTGCGAATGATGAGACAAGG + Intronic
1014038940 6:116801127-116801149 GTACTTGCATTGATGAGAGATGG - Intronic
1015204419 6:130618711-130618733 GTTCTGCTGTTAATGAGACCTGG - Intergenic
1017032678 6:150238007-150238029 GTACTGCTTGTGATGAGGCTGGG - Intronic
1020765222 7:12311418-12311440 GTACTGCTATACCTGAGACTGGG + Intergenic
1031820603 7:126496726-126496748 GTTCTGCAACTGATTAGACAGGG - Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1039532270 8:38273799-38273821 GTACTTCTGTTGATTAGATATGG - Exonic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1044206399 8:89496211-89496233 GCACTGTTATTTATGTGACAGGG + Intergenic
1045330081 8:101148076-101148098 TTTCAGCTATTGATGTGACATGG + Intergenic
1050355218 9:4776438-4776460 ATGCTGCTGTTGTTGAGACAGGG - Intergenic
1050855749 9:10352298-10352320 GTACTTCTAGCGATGAAACAAGG - Intronic
1055855457 9:80680920-80680942 GATCTGCCATTGATGAGAAAAGG - Intergenic
1055988589 9:82080254-82080276 GTAATGGTATGGATCAGACATGG - Intergenic
1058499371 9:105594734-105594756 TTACTATTATTAATGAGACAGGG - Intronic
1060439947 9:123628946-123628968 TTACTGCTATGCATGAGAGAGGG + Intronic
1186900100 X:14045340-14045362 ATACTGCTATAGATGGGGCAGGG - Intergenic
1193032768 X:76917486-76917508 TGGCTGCTATTGATGATACAAGG - Intergenic
1194617663 X:96126910-96126932 GGACTTCTATTCAAGAGACACGG + Intergenic
1195033013 X:100944884-100944906 GTGCTGCCATTTTTGAGACAAGG - Intergenic
1200113301 X:153755446-153755468 TTATTGCTATTATTGAGACAGGG + Intergenic
1201533613 Y:15020649-15020671 GTACTTGTATTTATGGGACAAGG - Intergenic