ID: 1183804564

View in Genome Browser
Species Human (GRCh38)
Location 22:40197229-40197251
Sequence GTGCAGAATAGGAGGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183804559_1183804564 30 Left 1183804559 22:40197176-40197198 CCTCAGCACTGCATTCATGATAA 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG 0: 1
1: 0
2: 2
3: 14
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183804564 Original CRISPR GTGCAGAATAGGAGGTCTTT GGG Intronic
904243637 1:29169237-29169259 GTGAAGAATCCCAGGTCTTTGGG - Intronic
905105234 1:35559836-35559858 CTGCAGCAGAGGAGGTGTTTAGG + Intronic
905121682 1:35687229-35687251 ATGCAGGATAGAAGGTTTTTGGG - Intergenic
908154298 1:61336641-61336663 GTGGAGAACAGGAGATATTTAGG - Intronic
908450237 1:64247430-64247452 TTGGAAAATAGGAGGTGTTTGGG + Intronic
908830366 1:68172719-68172741 TTGCAGAATAGGAGTTCACTAGG + Intronic
909757903 1:79250156-79250178 CTGCACAACAAGAGGTCTTTAGG - Intergenic
910240212 1:85078465-85078487 GTGCAGAGGAGGAGGCCTTCAGG - Intronic
913014909 1:114722913-114722935 GTGCTGAATAGCAGGTCATTTGG - Intronic
913334660 1:117698191-117698213 TTGCAGAATAGGTAGTATTTGGG + Intergenic
915588400 1:156857557-156857579 GTGCAGAAGAGGAGGGGGTTCGG + Intronic
915929662 1:160052101-160052123 GAGAAGAATAGGAGGCTTTTGGG - Intronic
916504627 1:165416926-165416948 GTGGAGATTAGGATGACTTTGGG + Intronic
916697504 1:167253998-167254020 GTGTAGAATGGAAGCTCTTTTGG + Intronic
922927662 1:229363761-229363783 GGGCTGAATGGGAGGTGTTTGGG + Intergenic
924536676 1:244941316-244941338 GTGCAGAAGTGAAAGTCTTTTGG - Intergenic
1064934440 10:20664216-20664238 GTGCCTAGTAGGAGGTGTTTGGG + Intergenic
1066034596 10:31468542-31468564 ATGCAAAGTTGGAGGTCTTTTGG - Intronic
1067808410 10:49408924-49408946 GTGCACAAAAGGAGATCATTTGG + Intergenic
1068479128 10:57566816-57566838 TTGAAGAATATGTGGTCTTTAGG - Intergenic
1069269412 10:66506212-66506234 GTGCCTAATGGGAGGTGTTTAGG - Intronic
1070934402 10:80282117-80282139 GTGCAGAACAGGACAGCTTTTGG - Intronic
1072532390 10:96331640-96331662 GGGCCTAATGGGAGGTCTTTGGG - Intronic
1077941669 11:6849419-6849441 GGGCCTAATAGGAGGTGTTTGGG + Intergenic
1079537193 11:21528334-21528356 GGGCCGAGTAGGAGGTGTTTGGG + Intronic
1080448160 11:32356239-32356261 GGGCAGAATATGAGGTCATTTGG + Intergenic
1082469178 11:53219634-53219656 GTGGACATTTGGAGGTCTTTGGG + Intergenic
1083285513 11:61656385-61656407 GAGAAGAATAGGAAGTCCTTGGG + Intergenic
1083966660 11:66047766-66047788 GTGCAGAATGGGAGGTGTAAGGG - Intronic
1088124154 11:106403899-106403921 GTGCCTAGTAGGAGGTATTTGGG + Intergenic
1089002087 11:115060356-115060378 GTCCAGAAGATGAGGCCTTTTGG + Intergenic
1089753013 11:120665038-120665060 GTACAGAATTGGAGCTCATTGGG - Intronic
1090697993 11:129268008-129268030 GGGCCTAATAGGAGGTTTTTGGG - Intronic
1090929745 11:131284943-131284965 GTGCTAAATAGTAGGTCTGTAGG + Intergenic
1091316209 11:134615750-134615772 GTGAGGAAGAGGAGGTCTTGAGG - Intergenic
1092577274 12:9800452-9800474 GGGAAGAATAGGAGGGGTTTTGG - Intergenic
1096751476 12:53761561-53761583 GTGCAGACCAGGAGGCCTTGTGG + Intergenic
1099117562 12:78646813-78646835 GTGCAGGATAGGATATTTTTAGG + Intergenic
1100465350 12:94839623-94839645 GTGCCTAATGGGAGGTGTTTGGG - Intergenic
1100560022 12:95738943-95738965 GAGGAGAATGGGAGGTCTTCAGG - Intronic
1101476053 12:105049488-105049510 GGGCCTAATAGGAGGTGTTTAGG + Intronic
1104663685 12:130632276-130632298 GAGCAGAATAGGATGTGTGTTGG - Intronic
1108133620 13:47331447-47331469 GTTCAGTACAGGAGGGCTTTTGG + Intergenic
1111099746 13:83568142-83568164 GTGCAGATTTGGGTGTCTTTAGG + Intergenic
1111442254 13:88295073-88295095 GGGCCTAATAGGAGGTGTTTGGG + Intergenic
1115402811 14:32982289-32982311 GGGCCTAATAGGAGGTGTTTAGG - Intronic
1115805523 14:37046778-37046800 GTGCAGGATAGGGGATTTTTAGG + Intronic
1118426502 14:65669492-65669514 GTGCAGCATATGAGATCTCTGGG + Intronic
1120434336 14:84461509-84461531 CTGCAAAATAGGAGGTGCTTAGG + Intergenic
1121240297 14:92424990-92425012 GTGCCTAATGGGAGGTGTTTGGG - Intronic
1129417659 15:75396097-75396119 GTGCAGAATGGAACTTCTTTTGG - Intronic
1129593161 15:76935697-76935719 ATGCAGAAGAGGAGTCCTTTAGG + Exonic
1130662784 15:85843700-85843722 GGGCAGAAGAGGAGGTCTGGTGG + Intergenic
1133502046 16:6375879-6375901 GTGTAGGATAATAGGTCTTTGGG - Intronic
1134431920 16:14217630-14217652 GTGCAAAATAGGAGGTCCCCAGG + Intronic
1135196046 16:20395668-20395690 GGGCCTAATAGGAGGTGTTTGGG + Intronic
1135734403 16:24919181-24919203 GGCCAGGCTAGGAGGTCTTTGGG + Intergenic
1136705124 16:32181222-32181244 GTGCAGAATGGGAACGCTTTGGG - Intergenic
1136762788 16:32748184-32748206 GTGCAGAATGGGAACGCTTTGGG + Intergenic
1136805312 16:33122202-33122224 GTGCAGAATGGGAACGCTTTGGG - Intergenic
1137907775 16:52341794-52341816 GTGGAAAAGAGGAGGTCCTTTGG + Intergenic
1138143079 16:54585170-54585192 GAGGAGAATAGCAGGGCTTTGGG + Intergenic
1138695821 16:58812383-58812405 GTGCAGAATAGGGGTTAGTTGGG + Intergenic
1139141429 16:64267458-64267480 GGGCAGAGTGGGAGGTGTTTAGG - Intergenic
1141855652 16:86679688-86679710 GGGCCCAATAGGAGGTGTTTGGG + Intergenic
1203064944 16_KI270728v1_random:1008503-1008525 GTGCAGAATGGGAACGCTTTGGG + Intergenic
1143121199 17:4608102-4608124 GGGAAGAACAGGAGGACTTTGGG - Exonic
1143521635 17:7447430-7447452 GTGGAGTTTGGGAGGTCTTTGGG - Intronic
1144630140 17:16867294-16867316 GGGCCTAATAGGAGGTGTTTAGG - Intergenic
1144651236 17:17008502-17008524 GGGCCTAATAGGAGGTGTTTAGG + Intergenic
1150450789 17:65266016-65266038 GGGCTGAGTAGGAGGTGTTTGGG + Intergenic
1150579979 17:66464003-66464025 GTGGAGCATAGAAGATCTTTAGG - Intronic
1151324417 17:73370039-73370061 GTGCAAAATTGGAGGTCATTTGG + Intronic
1153257640 18:3188300-3188322 ATGAAGAATATGTGGTCTTTTGG - Intronic
1156356230 18:36343482-36343504 GGGCATAATGGGAGGTGTTTGGG + Intronic
1168194680 19:54765465-54765487 GTGCAGTCTAGGAGGTGTTTAGG - Intronic
927120716 2:19958754-19958776 GTGCAGGTTAAGAGGTATTTTGG + Intronic
929024991 2:37591921-37591943 ATGCTTAATGGGAGGTCTTTGGG + Intergenic
929098568 2:38286980-38287002 ATGGAGGACAGGAGGTCTTTTGG + Intergenic
930146613 2:48013639-48013661 GGACATAATAGGAGGTGTTTAGG + Intergenic
931554243 2:63482424-63482446 GTGCACAAAAGGAGGTCCCTTGG + Intronic
939127346 2:138193322-138193344 CTGCAGAACATGAGGACTTTTGG - Intergenic
941856174 2:170233518-170233540 GTGAGGAAAGGGAGGTCTTTGGG + Intronic
946669362 2:222085896-222085918 GTGAAAGAGAGGAGGTCTTTTGG + Intergenic
1169823785 20:9743545-9743567 GTGCAGAAAAGGGGATCTTTAGG + Intronic
1169949778 20:11031152-11031174 GGGCCCAATAGGAGGTGTTTGGG - Intergenic
1171199752 20:23231606-23231628 ATGCAGAAATGGAGGTCTTGGGG + Intergenic
1171728272 20:28648382-28648404 GTGGATAATAGGAGTGCTTTGGG + Intergenic
1171728363 20:28650085-28650107 GTGGATAATAGGAGTACTTTGGG + Intergenic
1171728483 20:28652293-28652315 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171728601 20:28654389-28654411 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171728713 20:28656387-28656409 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171728814 20:28658260-28658282 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171728915 20:28660132-28660154 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729118 20:28663877-28663899 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729218 20:28665749-28665771 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729319 20:28667621-28667643 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729521 20:28671369-28671391 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729623 20:28673241-28673263 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729723 20:28675113-28675135 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729822 20:28676985-28677007 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171729925 20:28678858-28678880 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730025 20:28680730-28680752 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730142 20:28682835-28682857 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730244 20:28684707-28684729 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730346 20:28686579-28686601 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730577 20:28690591-28690613 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171730777 20:28694336-28694358 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731081 20:28699664-28699686 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731182 20:28701536-28701558 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731283 20:28703408-28703430 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731391 20:28705455-28705477 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731492 20:28707327-28707349 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731593 20:28709199-28709221 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731797 20:28712943-28712965 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731895 20:28714819-28714841 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171731997 20:28716692-28716714 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171732104 20:28718738-28718760 GTGGATAATAGGAGTGCTTTGGG + Intergenic
1171732229 20:28720972-28720994 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171732329 20:28722844-28722866 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171732427 20:28724717-28724739 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171732608 20:28728126-28728148 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171739284 20:28842744-28842766 GTGCATATTTGGAGGTCATTGGG + Intergenic
1171744951 20:28961950-28961972 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745050 20:28963822-28963844 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745149 20:28965694-28965716 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745248 20:28967566-28967588 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745398 20:28970459-28970481 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745498 20:28972331-28972353 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745598 20:28974203-28974225 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745697 20:28976075-28976097 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745796 20:28977947-28977969 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745895 20:28979819-28979841 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171745994 20:28981691-28981713 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746093 20:28983563-28983585 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746193 20:28985435-28985457 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746292 20:28987307-28987329 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746392 20:28989179-28989201 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746491 20:28991051-28991073 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746590 20:28992923-28992945 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746690 20:28994795-28994817 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746790 20:28996667-28996689 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746890 20:28998539-28998561 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171746990 20:29000411-29000433 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747091 20:29002283-29002305 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747191 20:29004155-29004177 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747290 20:29006027-29006049 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747390 20:29007899-29007921 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747490 20:29009771-29009793 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747590 20:29011643-29011665 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1171747689 20:29013515-29013537 GTGGATAATAGGAGCGCTTTGGG + Intergenic
1172469719 20:35183251-35183273 GGGCATAATGGGAGGTGTTTGGG + Intergenic
1175287569 20:57847392-57847414 GTGCCTAATAGGAGGAGTTTGGG - Intergenic
1176317848 21:5266235-5266257 GTGGATAATAGGAGTGCTTTGGG - Intergenic
1176475712 21:7203010-7203032 GTGGATAATAGGAGTACTTTGGG - Intergenic
1179389050 21:40970689-40970711 GTGCCTAATGGGAGGGCTTTGGG + Intergenic
1179495545 21:41769296-41769318 GTGCAGACTTGAAGGTTTTTAGG + Intergenic
1180221890 21:46364400-46364422 GTGCAGACTTGGGGGGCTTTGGG - Intronic
1183525365 22:38319395-38319417 CTGAAGAAGAGGAGGGCTTTGGG - Intronic
1183709098 22:39491939-39491961 GGGCAGCATGGGAGATCTTTGGG + Exonic
1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG + Intronic
1184067289 22:42128028-42128050 GTGCAGAATTGGAGGTCATTTGG - Intronic
1184070016 22:42141722-42141744 GTGCAGAATTGGAGGTCATTTGG - Intergenic
949744944 3:7279839-7279861 TTTCAGAATAGCAGTTCTTTTGG - Intronic
949838592 3:8295903-8295925 GTGCCTAAAAGGAGGTCTTTGGG - Intergenic
951215664 3:20022426-20022448 GTGGAGAACAGGAGATTTTTAGG + Intergenic
952722585 3:36548624-36548646 GGGCTGAATGGGAGGTGTTTGGG - Intergenic
953406293 3:42661462-42661484 CTGCAGAATAAGAGGACTTGAGG - Intronic
953749699 3:45599908-45599930 GGGCAGAGGAGGAAGTCTTTCGG + Intronic
955269961 3:57487497-57487519 GTGCAGAATCTGAGTCCTTTGGG + Intronic
957656466 3:83084184-83084206 CTGCAGAATAGGAGGAATATTGG - Intergenic
958103403 3:89043542-89043564 GTGCACAATGGGAGGCATTTTGG + Intergenic
958720173 3:97834075-97834097 GGGCCCAATAGGAGGTGTTTGGG - Intronic
958937397 3:100271723-100271745 GTGCTGAATAGGAGATTTTCAGG + Intronic
959967965 3:112377797-112377819 GGGCCGAATGGGAGGTGTTTCGG + Intergenic
962592915 3:136908920-136908942 GGGCATAATGGGAGGTGTTTGGG + Intronic
966554102 3:181239534-181239556 GAGCAAAATAGGAGCTCTTATGG - Intergenic
971009599 4:22418783-22418805 CTGCAGAACAGGAGGCCTCTGGG - Intronic
974156820 4:58084100-58084122 GGGCTTAATGGGAGGTCTTTGGG + Intergenic
975807445 4:78127504-78127526 GTGGAGAAGAGGAGGGATTTGGG + Intronic
976096818 4:81517195-81517217 GGGCCCAATAGGAGGTGTTTGGG + Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977586298 4:98779090-98779112 TTGCAGAAGAGAAGGGCTTTAGG + Intergenic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
984305778 4:177988527-177988549 GTAGAGCATAGGGGGTCTTTAGG + Intronic
984398720 4:179233632-179233654 CTGGGGAATAGGATGTCTTTGGG - Intergenic
985190206 4:187364735-187364757 TTGCAGCATAGGACGTCATTGGG + Intergenic
986316442 5:6591858-6591880 GAGCAGATAAGGAGGTCTTCAGG + Intergenic
986672591 5:10156354-10156376 GAGCATAATAGGAGGTGATTAGG - Intergenic
986739609 5:10694588-10694610 GTGCAGAAGAAGAGGCCCTTGGG + Intronic
987069377 5:14321575-14321597 GCACAGAATAGGAGATCCTTCGG - Intronic
987367740 5:17164284-17164306 GGGCAGAAGATGAGGTCTTAAGG - Intronic
988661136 5:33270011-33270033 GGGCAGACTGGGAGGTGTTTGGG - Intergenic
989541957 5:42628218-42628240 GTGCACGATAGGGGGTGTTTTGG + Intronic
989542232 5:42630897-42630919 GTGCAGGATAGGGGGTGTTTTGG + Intronic
992461064 5:76960679-76960701 GTGCAAAATTGAAGGTTTTTTGG - Intronic
993256458 5:85596721-85596743 GGGCCTAATAGGAGGTGTTTGGG + Intergenic
995165892 5:109041212-109041234 GTGCAGAATAGGCAGAGTTTTGG + Intronic
995668071 5:114567188-114567210 GGGCCTAATAGGAGGTGTTTGGG - Intergenic
996402435 5:123076763-123076785 GGGCCTAATAGGAGGTGTTTGGG - Intergenic
996685482 5:126275725-126275747 GTGCAGAATAGGAAGTCTGGAGG + Intergenic
996976186 5:129438148-129438170 TGGCAGAATAGGAGGTCACTTGG + Intergenic
998590230 5:143470553-143470575 GTGCAGGATAGGAGGTATATGGG - Intergenic
999566425 5:152867653-152867675 GTGCCTAATGGGAGGTATTTGGG + Intergenic
1000006717 5:157192235-157192257 TTGCAGAGTAGGAGACCTTTTGG - Intronic
1005132247 6:22522607-22522629 GTACAGAATATGTTGTCTTTGGG + Intergenic
1006820515 6:36890224-36890246 GTGCTGTATAGTAGGTCTCTAGG + Intronic
1010069913 6:71731654-71731676 GTGCAGATTTAGAGGTCTTTAGG + Intergenic
1014376726 6:120684645-120684667 GTGCAGAGTGAGAGGTATTTAGG - Intergenic
1016936903 6:149454550-149454572 GAGCAGGAGAGGAAGTCTTTGGG - Intronic
1017319794 6:153076946-153076968 GTGCAGAATATGTGATATTTGGG - Intronic
1020656227 7:10930862-10930884 GTGCTTAATGGGAGGTGTTTGGG + Intergenic
1021097748 7:16552410-16552432 GTGCAGAAAAAGAGGACATTGGG + Intronic
1021195714 7:17672215-17672237 GTGTAGAGTAAGAAGTCTTTGGG + Intergenic
1022389970 7:29934995-29935017 GAGAAGAATAGGGGTTCTTTAGG - Intronic
1023600327 7:41876015-41876037 GTGCACAGAAGTAGGTCTTTGGG - Intergenic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1034750854 7:153567774-153567796 GAGCCGAATGGGAGGTGTTTGGG - Intergenic
1036010744 8:4719730-4719752 GTGCATATTAGGAATTCTTTAGG - Intronic
1038132886 8:24753006-24753028 GTATAGAAAAGGAGGTGTTTGGG + Intergenic
1038582133 8:28757250-28757272 GTGCAGCACAGGAAGTTTTTAGG - Intergenic
1039377084 8:37045351-37045373 GGGCCTAATAGGAGGTGTTTAGG - Intergenic
1039491320 8:37949620-37949642 GGGCCTAATGGGAGGTCTTTGGG + Intergenic
1039985447 8:42443884-42443906 ATGCAGAATAGGTGCTCTTCCGG + Intronic
1041090644 8:54298029-54298051 ATGGAGAATAGCAGGTTTTTAGG - Intergenic
1041489055 8:58411416-58411438 GAGCAGGAGAGGAGGTCTTCCGG + Exonic
1042381198 8:68116288-68116310 GTAGTGAATAGGAGTTCTTTTGG + Intronic
1045342614 8:101268031-101268053 GGGGAGAATGGGAGGGCTTTGGG - Intergenic
1045416255 8:101970884-101970906 GGGCCTAATAGGAGGTATTTGGG + Intronic
1046551792 8:115727473-115727495 GGGCATAATGGGAGGTGTTTAGG - Intronic
1052454120 9:28672191-28672213 GTGCAGAATAGTAGGACACTAGG + Intergenic
1055998984 9:82194103-82194125 GTGCAGAATAGGAGGTGTGGTGG - Intergenic
1057113478 9:92497751-92497773 GTGCTTAATGGGAGGTGTTTGGG + Intronic
1058453759 9:105120382-105120404 GTGAAGAAAATGAGGTCTATAGG + Intergenic
1058765093 9:108174762-108174784 ATGTGGAATAGGAGGTCATTAGG + Intergenic
1059069256 9:111118186-111118208 GGGCCTAATAGGAGGTGTTTGGG - Intergenic
1061987852 9:134140482-134140504 CTACAGAAGAGGAGGTCTTGTGG + Intronic
1203411145 Un_KI270579v1:5699-5721 GTGGATAATAGGAGTGCTTTGGG - Intergenic
1203409949 Un_KI270587v1:2705-2727 GTGCATATTTGGAGGTCATTGGG - Intergenic
1186252357 X:7681949-7681971 GTGCAAAATGGGAGGTCACTTGG - Intergenic
1188952239 X:36390351-36390373 GTGCCTAATGGGAGGTGTTTAGG + Intergenic
1190234379 X:48604645-48604667 GTGCAGAATGCGAGGTCTCTGGG - Intronic
1190375945 X:49788354-49788376 GTGCAGAATTTGAGGTCTCTGGG + Intergenic
1192707019 X:73537426-73537448 TGGCAGAATAGGAGGTCTCCAGG + Intergenic
1198916612 X:141679518-141679540 GTGCAGAAGAGAAGCTCTTTAGG + Intronic
1199100936 X:143799239-143799261 CTGCTGAGTAGGAGGTCTTCTGG + Intergenic
1201564134 Y:15348099-15348121 GTGCAGGACAGGAGGTGTTATGG + Intergenic
1201695249 Y:16817637-16817659 GAGCACAATGGGAGGTATTTGGG + Intergenic