ID: 1183806462

View in Genome Browser
Species Human (GRCh38)
Location 22:40215600-40215622
Sequence GGCCAGTGTCAACACCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183806462_1183806463 -10 Left 1183806462 22:40215600-40215622 CCTCAGGGGTGTTGACACTGGCC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1183806463 22:40215613-40215635 GACACTGGCCCAAAGCTCCATGG 0: 1
1: 0
2: 0
3: 14
4: 169
1183806462_1183806468 21 Left 1183806462 22:40215600-40215622 CCTCAGGGGTGTTGACACTGGCC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1183806468 22:40215644-40215666 TCCCTTTGTTCCCCCAGCCCTGG 0: 1
1: 1
2: 16
3: 72
4: 423
1183806462_1183806472 23 Left 1183806462 22:40215600-40215622 CCTCAGGGGTGTTGACACTGGCC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1183806472 22:40215646-40215668 CCTTTGTTCCCCCAGCCCTGGGG 0: 1
1: 2
2: 12
3: 69
4: 375
1183806462_1183806470 22 Left 1183806462 22:40215600-40215622 CCTCAGGGGTGTTGACACTGGCC 0: 1
1: 0
2: 1
3: 14
4: 147
Right 1183806470 22:40215645-40215667 CCCTTTGTTCCCCCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183806462 Original CRISPR GGCCAGTGTCAACACCCCTG AGG (reversed) Intronic
900418547 1:2545985-2546007 GGCCCCTGTCCTCACCCCTGAGG + Intergenic
901513486 1:9730195-9730217 GGCCAGTGTCCTCTCCCCGGGGG + Exonic
901668509 1:10839969-10839991 GGCCAGTGTGGCCAGCCCTGGGG + Intergenic
901940021 1:12654881-12654903 GGCTTGAGTCAACACACCTGTGG - Intronic
902297922 1:15481122-15481144 GGCCAGTGGTACCACACCTGCGG + Exonic
902519966 1:17010754-17010776 GGGCAGTGTCACCAGCACTGTGG + Intronic
904501505 1:30915354-30915376 GGTCAGTATCCACAGCCCTGGGG - Intergenic
905370406 1:37479920-37479942 GGCCACTTGCAACACACCTGGGG - Intronic
905389509 1:37627161-37627183 AGCCAGAGTCAACAACCCTGAGG + Intronic
906199962 1:43953606-43953628 GGCCAATGTCAGGACACCTGGGG - Intronic
909350897 1:74652339-74652361 GGCCAGTGTCAGCTACACTGTGG + Intronic
912495140 1:110086726-110086748 GTGCAGTGTCTACACCACTGGGG + Intergenic
912540672 1:110412608-110412630 GGCCAGTGTGGATAGCCCTGGGG - Intergenic
915081458 1:153355499-153355521 GTCCAGTGTCCCCAACCCTGAGG + Intergenic
916248419 1:162710984-162711006 GCTCAGTGTCAAGATCCCTGGGG + Intronic
917964153 1:180167999-180168021 GGGCAGTGGCTGCACCCCTGCGG - Intronic
918315272 1:183317783-183317805 TGCTAGTGTCAAAAGCCCTGGGG - Intronic
1062971848 10:1654387-1654409 GGCCTGTCTCAGCACCCCTGGGG - Intronic
1065598393 10:27341216-27341238 GGCCTGTGTCAACAGCCATGTGG - Intergenic
1067275564 10:44829969-44829991 GGCCAGTGAGAACACCTCAGAGG + Intergenic
1067318453 10:45194217-45194239 GGCCTGTGTCAACGGCCATGCGG - Intergenic
1070753545 10:78977698-78977720 GGACCGTCTCACCACCCCTGTGG + Intergenic
1073254192 10:102140595-102140617 GTGCAGTGTCATCAGCCCTGGGG + Exonic
1075452616 10:122562465-122562487 GCCCAGTCTCCACTCCCCTGAGG - Intronic
1079134117 11:17766576-17766598 GGGCAGTGTCCCCACCCATGGGG + Intronic
1079866479 11:25741613-25741635 GGCCAGTGTCAAAACCACAGAGG + Intergenic
1084446218 11:69205129-69205151 GGCCAGTGACGAAACCCCGGGGG - Intergenic
1088907064 11:114162926-114162948 GGCCAGTGACGACACCACTCTGG - Intronic
1093459964 12:19398926-19398948 GGACATTTTCAACACTCCTGGGG + Intergenic
1094502271 12:31032194-31032216 GGCCAGGGCCAACACGCATGTGG + Intergenic
1096196371 12:49651389-49651411 GCCCACTGTCAACACCACAGAGG + Exonic
1096692397 12:53329054-53329076 GCCCAGTGTCTACACCTCTCTGG - Exonic
1101419979 12:104542926-104542948 GTCCCCTGTCAACACCCCTTCGG - Intronic
1103971787 12:124677242-124677264 GGCCAGTGTCATGCGCCCTGGGG - Intergenic
1104415511 12:128594201-128594223 GGGCAGTGTCCCCACCCCAGGGG + Intronic
1104775765 12:131389347-131389369 GGTCAGTGTAGACACACCTGGGG + Intergenic
1104775775 12:131389387-131389409 GGCCAGTGTAGACACACATGGGG + Intergenic
1104775783 12:131389426-131389448 GGACAGTGTAGACACACCTGGGG + Intergenic
1104775792 12:131389465-131389487 GGTCAGTGTAGACACACCTGGGG + Intergenic
1104775800 12:131389505-131389527 GGCCAGTGTAGACCCACCTGAGG + Intergenic
1104775810 12:131389545-131389567 GGCCAGTGTAGACACACCTGAGG + Intergenic
1104775820 12:131389585-131389607 GGTCAGTGTAGACACACCTGGGG + Intergenic
1104877595 12:132046830-132046852 TGCCAGTGTCCACACCCATTGGG + Intronic
1105545711 13:21349189-21349211 AGCCAGAACCAACACCCCTGGGG - Intergenic
1112419115 13:99231300-99231322 TGGCAGTGTCAACATTCCTGTGG + Intronic
1112474876 13:99722250-99722272 TCAGAGTGTCAACACCCCTGGGG - Intronic
1119992503 14:79215073-79215095 TGCCAGTCTCAGCATCCCTGAGG - Intronic
1120123496 14:80712466-80712488 GGACAGTGTGAACACCTCTCTGG - Intronic
1122200444 14:100119393-100119415 GGCCAGCGTCACAAACCCTGTGG + Intronic
1122406797 14:101505621-101505643 GGCCAGTCTACCCACCCCTGGGG + Intergenic
1122970029 14:105148696-105148718 GGCCTGTGCCTCCACCCCTGTGG - Intronic
1126476189 15:49067876-49067898 GACCAATTTCATCACCCCTGAGG + Intergenic
1126585030 15:50276721-50276743 GGCCAGTGTCTTCACCCCAGAGG - Intronic
1126849966 15:52790758-52790780 GGACTGTGTCATCACCCCTTCGG + Intronic
1131287657 15:91075074-91075096 GGCCTGTGGCAGCTCCCCTGGGG - Intergenic
1131333762 15:91527024-91527046 GGCTTGTGTCAACCCCTCTGGGG + Intergenic
1138341580 16:56292989-56293011 GGCCCGAGCCAACTCCCCTGTGG + Intronic
1138366108 16:56479005-56479027 GGCCAATGTCAACAACTCTTAGG + Exonic
1139437308 16:66943654-66943676 GGCTAGTGTCAGCACCAGTGGGG - Intronic
1139451921 16:67034755-67034777 GCCCCGTGTCAAAATCCCTGTGG - Intronic
1142139688 16:88467377-88467399 GGCCATGGCCAACCCCCCTGAGG + Intronic
1142331752 16:89458887-89458909 TGCCAGTGCCAGGACCCCTGAGG - Intronic
1143776998 17:9206108-9206130 AGCCAGTGTCAACTCTGCTGAGG - Intronic
1147377424 17:40031166-40031188 GGCCAGCGTCAACAACCTTATGG - Exonic
1148070245 17:44904507-44904529 GGCCAGGGACCACACGCCTGAGG + Exonic
1151432960 17:74077021-74077043 GGCAAGTGTCAATAGCTCTGAGG - Intergenic
1151454256 17:74216643-74216665 GGCCTGTGTCACCAGCCTTGTGG + Intronic
1152014227 17:77739241-77739263 GGACAATGACAACACCTCTGTGG + Intergenic
1152089514 17:78239018-78239040 CGCCAGTGTCAGGACACCTGGGG - Exonic
1153113103 18:1617949-1617971 AAACAGTGTCATCACCCCTGAGG - Intergenic
1159644588 18:70902661-70902683 GGTCATTGGCAACACCCTTGAGG + Intergenic
1160911276 19:1474908-1474930 CGCCTGTGTCAACACCCACGTGG + Exonic
1161257130 19:3315591-3315613 GGCCAGTGTCCACGGCCCTTGGG + Intergenic
1162445237 19:10718604-10718626 GGCCCGTGACACCGCCCCTGGGG - Intronic
1162607289 19:11719456-11719478 AGCCAGTGTCAATTCTCCTGTGG - Intergenic
1163641210 19:18463181-18463203 GGCCAGTGCTCACACCTCTGGGG + Intronic
1165173043 19:33906725-33906747 GCCCAGTGCCACCACCTCTGTGG + Intergenic
1167049959 19:47072164-47072186 GGGCAGTGGCCACACCCCAGAGG + Intronic
1167731639 19:51261933-51261955 GACCAGTGTAACCACCACTGAGG + Intronic
1168712920 19:58512038-58512060 TGCCAGGGCCACCACCCCTGGGG - Exonic
927455811 2:23248370-23248392 AGTCAGTGTCTTCACCCCTGAGG + Intergenic
927569405 2:24145002-24145024 AGCCACTGCCAACACCCGTGTGG + Intronic
933690096 2:85172990-85173012 GGACAGTGTCAGCACACCGGAGG + Intronic
940404903 2:153289768-153289790 GGCCAGTGTAAACATTTCTGGGG + Intergenic
941843560 2:170112274-170112296 GGCCTGAGTCAACACACTTGTGG - Intergenic
941844477 2:170119568-170119590 GGCCTGAGTCAACACACTTGTGG - Intergenic
943298072 2:186162989-186163011 GGTCAAGGTCAAGACCCCTGAGG - Intergenic
944434334 2:199671065-199671087 GGCAAGTGTCAAGACCCATTAGG + Intergenic
947799615 2:232920463-232920485 GGCCAGTGAGGACACCCCGGAGG - Exonic
1168767098 20:389011-389033 GGACAGGGTCAAGGCCCCTGAGG + Intronic
1170071542 20:12374590-12374612 GGTCAGTGACAAGAGCCCTGAGG + Intergenic
1170370032 20:15638548-15638570 GGCCAGTGCCCACAGTCCTGAGG - Intronic
1171180004 20:23085103-23085125 GGAGTGTGTCAACACCCCTGGGG - Exonic
1173647315 20:44641521-44641543 GGCAAGTTTAAACACCCATGGGG + Intronic
1175545034 20:59772681-59772703 GCCCAGTCTCAAGGCCCCTGGGG - Intronic
1175800981 20:61800886-61800908 GGCCAGTGTCCACTCCACAGTGG + Intronic
1175835300 20:61989905-61989927 TGCCTGTGTCGCCACCCCTGGGG - Intronic
1177096522 21:16842173-16842195 GGCCAGTGTCAGGACTCCTCTGG + Intergenic
1177962067 21:27679812-27679834 GGCCAGTGTGAAAACCTTTGGGG + Intergenic
1179063665 21:38004074-38004096 GCCCAGTGCCAACTCCCCAGTGG - Intronic
1180715781 22:17871359-17871381 GGCCCGTGTTAACACCTCTCTGG - Intronic
1181574209 22:23783560-23783582 GGCAGGGGTCAGCACCCCTGAGG - Exonic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1183806462 22:40215600-40215622 GGCCAGTGTCAACACCCCTGAGG - Intronic
1184952642 22:47855167-47855189 GGCCAGTGTCAAGGCCCCGTAGG - Intergenic
1185179352 22:49350242-49350264 GCCCAGTGTGGACACCCCTGTGG + Intergenic
952520798 3:34155260-34155282 GGACAGTGTCAACACACTTGTGG - Intergenic
953768062 3:45759238-45759260 GGCCGGTGTCCTCACTCCTGGGG + Intronic
954139871 3:48599332-48599354 GGACAGGCTCAGCACCCCTGGGG - Intronic
954444528 3:50539636-50539658 AGCCATCGTCAACTCCCCTGTGG - Intergenic
955175838 3:56612439-56612461 TGCCAGTGTATACAGCCCTGGGG - Intronic
964192709 3:154023506-154023528 GGCCAGTTTCAGCACACCAGTGG + Intergenic
966702890 3:182875837-182875859 GGACAGTGTCAACAACATTGTGG + Intronic
968068657 3:195772684-195772706 GGAGGGTGTCTACACCCCTGAGG - Intronic
968204904 3:196790798-196790820 GGCTTGAGTCAACACACCTGTGG + Intronic
968493617 4:903562-903584 GGCCTGGGCCAACACCACTGGGG + Intronic
968630503 4:1648455-1648477 GGACAGTGCCAAGACTCCTGAGG - Intronic
969269366 4:6088660-6088682 GGCCAGTGTCTTAACCTCTGGGG - Intronic
969962810 4:10962740-10962762 GGCCAGTGCCCTCACTCCTGCGG - Intergenic
970176497 4:13344975-13344997 GGACACTGTCAACACTCCTATGG + Intergenic
975734742 4:77370379-77370401 GGCAAGTGTCAACATGCATGTGG + Intronic
976503435 4:85818199-85818221 AGCCAGTGTGAACTCACCTGGGG - Intronic
983942037 4:173544332-173544354 GGCCACTGTTAACCCCTCTGTGG + Intergenic
984847174 4:184117785-184117807 GGACAGTGTCTACAGCCTTGAGG + Exonic
985633960 5:1027022-1027044 GGTCATTGTCACCACCCCTGTGG - Intronic
988542829 5:32127604-32127626 GGCCAGTGGCTACACCCCACAGG + Intronic
999947500 5:156613110-156613132 GGGCAGTGGCAAGATCCCTGTGG - Intronic
1001397047 5:171424965-171424987 GGCCAGTGTCAGCAGGCTTGGGG + Intronic
1004843795 6:19615506-19615528 TGCCAGTGTAAACTGCCCTGGGG + Intergenic
1006369594 6:33635771-33635793 AGCCAGTGCCCACTCCCCTGGGG + Intronic
1014336356 6:120141837-120141859 GGCTTGAGTCAACACACCTGTGG - Intergenic
1018720604 6:166569218-166569240 GGCCAGTCTCAAGGCCCCTGCGG - Intronic
1018855295 6:167670292-167670314 GGGCTGTGTCACCAGCCCTGGGG - Intergenic
1021936044 7:25632339-25632361 GGACTGTGTCAACACCACTTGGG - Intergenic
1022523570 7:31023095-31023117 TGCCATTGTCAGCACCCCTTGGG + Intergenic
1022773875 7:33503928-33503950 GGCCAGAGTTAACATCCCTGGGG - Intronic
1023622696 7:42088902-42088924 GGCCAGTGAGATCACCACTGAGG - Intronic
1023920603 7:44626649-44626671 GCCCAGTGTCCACAGCACTGTGG - Intronic
1028949524 7:96619512-96619534 TGCCAGTGTCAACTGCTCTGGGG - Intronic
1031484613 7:122311843-122311865 TGCCAGCGTCAACACCCGCGCGG - Intergenic
1034273718 7:149815186-149815208 GGCCAGAGTCTGCATCCCTGTGG + Intergenic
1034531207 7:151697371-151697393 GCCCACTCTCTACACCCCTGGGG - Intronic
1036703989 8:11032826-11032848 GGCCAGTGTCAACACCTTTGTGG - Intronic
1036765440 8:11546945-11546967 GGCCAGAGGCTCCACCCCTGGGG + Intronic
1037009596 8:13824030-13824052 GGCAAGTATACACACCCCTGGGG + Intergenic
1038321527 8:26531625-26531647 GGCCAGTGTGAACAATGCTGTGG - Intronic
1045188476 8:99861240-99861262 GAAGAGTGTCATCACCCCTGTGG + Intronic
1047373804 8:124277445-124277467 AGACAGTGTCCACACCCCTAAGG - Intergenic
1048002041 8:130386492-130386514 GCCCTGTGTCGACAGCCCTGTGG - Intronic
1049286907 8:141780792-141780814 GCCCCGTGACACCACCCCTGGGG - Intergenic
1049373927 8:142280224-142280246 GGCCGGGCTCCACACCCCTGCGG - Intronic
1049413739 8:142485559-142485581 GGAGAGTGTCACCTCCCCTGTGG + Intronic
1053168179 9:35859364-35859386 GGCCAGTGTCAGGACGGCTGTGG + Intergenic
1055804467 9:80077031-80077053 GGTCAGTGCCAACATCACTGTGG - Intergenic
1057057042 9:91971329-91971351 GGCCAGTATCAGCACAGCTGCGG - Intergenic
1060825970 9:126688365-126688387 GGCCAGGGTCAGCACACCTTGGG - Intronic
1061621543 9:131814232-131814254 GGCCAGGGTCACTTCCCCTGCGG - Intergenic
1061621553 9:131814262-131814284 GGCCAGGGTCACTTCCCCTGCGG - Intergenic
1189682977 X:43535951-43535973 GGCCATTTTCAACAGCCCAGTGG + Intergenic
1192128960 X:68530228-68530250 GGCCAGTTTCAACTTCCCTGTGG + Intronic
1199935266 X:152567282-152567304 GGTCAGTGGCAACACCACTGGGG + Intergenic
1200021852 X:153218507-153218529 GGCCAGTGTCAAGGCCCCGTAGG + Intergenic
1200235229 X:154464847-154464869 GGGCAGGGTCCACAGCCCTGAGG + Exonic