ID: 1183807261

View in Genome Browser
Species Human (GRCh38)
Location 22:40221830-40221852
Sequence CTGGGTAAGGACAGGTATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183807261_1183807271 20 Left 1183807261 22:40221830-40221852 CCCAAATACCTGTCCTTACCCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1183807271 22:40221873-40221895 AGATGGTCACTTGGTGAGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 165
1183807261_1183807269 3 Left 1183807261 22:40221830-40221852 CCCAAATACCTGTCCTTACCCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1183807269 22:40221856-40221878 TTCTGTGTAGGAGAATGAGATGG 0: 1
1: 0
2: 2
3: 41
4: 351
1183807261_1183807270 11 Left 1183807261 22:40221830-40221852 CCCAAATACCTGTCCTTACCCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1183807270 22:40221864-40221886 AGGAGAATGAGATGGTCACTTGG 0: 1
1: 1
2: 2
3: 43
4: 250
1183807261_1183807266 -9 Left 1183807261 22:40221830-40221852 CCCAAATACCTGTCCTTACCCAG 0: 1
1: 0
2: 1
3: 11
4: 161
Right 1183807266 22:40221844-40221866 CTTACCCAGGTGTTCTGTGTAGG 0: 1
1: 0
2: 2
3: 15
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183807261 Original CRISPR CTGGGTAAGGACAGGTATTT GGG (reversed) Intronic
903831631 1:26178606-26178628 CCGGGTAAGGGCAGGAATTCAGG + Intronic
905508871 1:38502793-38502815 CTGGGTCATGACAGGTCCTTGGG - Intergenic
905598263 1:39227917-39227939 CTGGGTAGGGACAGGAAATATGG - Intronic
906833328 1:49057996-49058018 CTGGGTAGGGATGGGTATTGTGG + Intronic
907742709 1:57182686-57182708 CGGGGTAAGGAAAGGTGTTCTGG + Intronic
910028917 1:82691961-82691983 CTGTGTACGGACAGGAATCTAGG - Intergenic
910612912 1:89164557-89164579 CTTGGTAAGCACAAATATTTTGG - Intronic
912681035 1:111729294-111729316 CTGAGAGAGGACAGGTGTTTGGG - Intronic
914990073 1:152491833-152491855 CTTGGTAAGAACAGTTAATTTGG - Intergenic
916916039 1:169407897-169407919 CTGGGAAAGGGGTGGTATTTGGG - Intronic
919793686 1:201308529-201308551 CTGGGTTAGAACAGGCCTTTTGG + Intronic
920960331 1:210657784-210657806 CTTGGTAAGTCCAGGTGTTTAGG + Intronic
921826718 1:219680018-219680040 TTGGGTAATGACAAGTAGTTCGG - Intergenic
922344106 1:224681701-224681723 CTGGGTGGGGACAGGTGTTTTGG + Intronic
924568992 1:245220802-245220824 GTGGGTATGGACAGGCTTTTGGG + Intronic
1062992851 10:1836489-1836511 CTGGGTGAGGCCAGGGATCTGGG + Intergenic
1066749498 10:38638455-38638477 CTGAGCAAGGAAAGGTAATTTGG + Intergenic
1066967148 10:42279337-42279359 CTGAGCAAGGAAAGGTAATTTGG - Intergenic
1067585796 10:47475298-47475320 CTGAGTAAGGACAGGTGTGGGGG + Intronic
1069102668 10:64342419-64342441 CTGGAGAAGGAGAGGTATTATGG - Intergenic
1069126725 10:64644061-64644083 ATGGGTAAAGACAGGTAATTTGG - Intergenic
1074298003 10:112209015-112209037 CAGGGCAAGGACAGGGATTGGGG + Intronic
1075220914 10:120583833-120583855 CTAGGTAATGACATGTAGTTGGG + Intronic
1075621831 10:123933903-123933925 TTGGGTAAGGAGAGGTATTTGGG - Intronic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075694327 10:124422426-124422448 CCAAGTCAGGACAGGTATTTAGG + Intergenic
1078657335 11:13253904-13253926 CTGGGAAAGGACTGGAATTCTGG + Intergenic
1081148017 11:39587468-39587490 CTGGGAAAGGCAAAGTATTTTGG + Intergenic
1084169809 11:67395670-67395692 CTGGGCAGGGCCAGGCATTTCGG + Intronic
1087851308 11:103033284-103033306 CTTGGTAAAGACATGTTTTTTGG - Intergenic
1090917628 11:131179942-131179964 CTGGGGAAGGAGAAGTTTTTGGG - Intergenic
1091844533 12:3645667-3645689 CTGGGTAAGAACCGTTTTTTTGG + Intronic
1095572192 12:43696212-43696234 CTGGGTAAAGCCAGGGATTTTGG - Intergenic
1095864226 12:46954183-46954205 CTGGGTAATAAGAGGGATTTTGG - Intergenic
1098207529 12:68128221-68128243 CTGGGCAATGCCAGCTATTTGGG - Intergenic
1098232254 12:68383904-68383926 CTGGATAAAGAGAGTTATTTTGG + Intergenic
1099454098 12:82843644-82843666 CTGGGTAAAGAAAGGTGATTTGG + Intronic
1101476478 12:105054204-105054226 CTGGTTAAGAACATGAATTTTGG - Intronic
1103241766 12:119419368-119419390 CTGGGGCAGGACATGTATGTAGG + Intronic
1105942853 13:25165569-25165591 CTGGGTTAGGTGAAGTATTTGGG + Intronic
1108587378 13:51882412-51882434 CTGGTTAAGGAAAATTATTTGGG - Intergenic
1112028332 13:95433675-95433697 CTGAGGAAGTACAGGAATTTAGG - Intronic
1114405719 14:22454117-22454139 GTGGGTTAGGACTGGTATTCAGG - Intergenic
1114732692 14:25010680-25010702 CTGGGGAATGCCAGGAATTTGGG - Intronic
1115201025 14:30854325-30854347 GTTGGTAATGACAGTTATTTTGG - Intergenic
1115252729 14:31366119-31366141 CTGGGTAAGGCCAGGCATGGTGG + Intronic
1115754808 14:36519996-36520018 CCGGGCACGGACAGGTCTTTAGG + Intronic
1118107686 14:62678751-62678773 CTGTGTAACTACAAGTATTTTGG - Intergenic
1118108428 14:62688209-62688231 GTGGGAAAGGACTGGGATTTGGG + Intergenic
1118605705 14:67501664-67501686 CTGGAGCAGGACAGGTCTTTGGG - Intronic
1119101414 14:71883458-71883480 TTGTCTAAGGACAGGTAATTTGG - Intergenic
1119375717 14:74190894-74190916 CTGGATGAGGACGGGTCTTTTGG - Intronic
1119569220 14:75655296-75655318 CTGGATCAGGACAGGTTTTGGGG + Intronic
1119805391 14:77478716-77478738 CTGGGTTAAGACAGGGAGTTGGG + Intronic
1121780926 14:96622085-96622107 CTGGGTAAGGAAAGGTCTCCTGG + Intergenic
1125298693 15:38231212-38231234 CTGTGTCAGCCCAGGTATTTAGG + Intergenic
1125834987 15:42741215-42741237 CTGGGTGAGGACAGGGAAGTAGG + Exonic
1128390173 15:67177368-67177390 CAGGGTAAGGATAAGTACTTTGG + Intronic
1129912894 15:79242829-79242851 CTGGGAGAGGACAGGAATGTGGG - Intergenic
1132752432 16:1464972-1464994 CAGGGCAAGGACAGGGATCTTGG - Intronic
1136733215 16:32438677-32438699 CTGAGCAAGGAAAGGTAATTTGG - Intergenic
1137520105 16:49185818-49185840 GTGGAAAAGGACTGGTATTTAGG - Intergenic
1138739941 16:59296319-59296341 CTGGATAATGAAAGGGATTTAGG + Intergenic
1140219322 16:73032563-73032585 CTGGGGAAGGCTAGTTATTTTGG - Intronic
1140957498 16:79878859-79878881 CTGGGTAAGAGCAGGTATGCAGG + Intergenic
1141211826 16:81988065-81988087 CTGGGGAACGACAGGTTTCTTGG + Intergenic
1203019868 16_KI270728v1_random:390925-390947 CTGAGCAAGGAAAGGTAATTTGG + Intergenic
1203038203 16_KI270728v1_random:664083-664105 CTGAGCAAGGAAAGGTAATTTGG + Intergenic
1146477190 17:33172496-33172518 GGGGGTAAGGACAGGCATGTGGG - Intronic
1148086086 17:44994668-44994690 CTGGTTACGGACAGGTAATTTGG - Intergenic
1149269936 17:54967331-54967353 TAGGGTAGGGACAGGAATTTCGG - Intronic
1149528608 17:57377426-57377448 CGGGGAAAGGACAGGGAATTTGG + Intronic
1151890548 17:76948492-76948514 CTGGGTAAGGAAATGTGTTACGG - Intronic
1153032984 18:732477-732499 CTGGGAAAGAACAGTTATTTAGG + Intronic
1156390873 18:36649392-36649414 CAGGGCAAGGACAGGTACCTAGG + Exonic
1158746994 18:60212498-60212520 CTGGGGAAAGACAGCTATTTGGG + Intergenic
1158849611 18:61482315-61482337 CTGGGTTAGGGCAGGAAGTTGGG - Intronic
1161148469 19:2694127-2694149 CTGGGTAAGCACAGGGGATTTGG + Intronic
1163784828 19:19269668-19269690 CTTGGTAAGGACAAGGCTTTGGG - Exonic
1164842737 19:31405670-31405692 CGAGGTAAGGACAGAGATTTAGG - Intergenic
1167637397 19:50662704-50662726 GTGGGGGAGGACAGGGATTTAGG + Intronic
1168253952 19:55156092-55156114 TTGGGTAAGGACAGCCATATTGG + Intronic
1168527916 19:57103522-57103544 CTGGGTGAGGAGAGGCAGTTTGG - Intergenic
926664015 2:15500078-15500100 CTTGGAAAGGACAGTTAGTTAGG - Intronic
927566493 2:24117909-24117931 CTGGGAAGGGACAGCTATCTTGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930028584 2:47044699-47044721 CAGGGTCAGGAAAGGCATTTTGG + Intronic
933560595 2:83880918-83880940 CTGGGTAAACATAGTTATTTTGG + Intergenic
934312495 2:91880573-91880595 CTGAGCAAGGAAAGGTAATTTGG + Intergenic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
939468022 2:142583142-142583164 CTGGGTAAGGCCAGTCTTTTGGG - Intergenic
941500915 2:166275087-166275109 CTGTGAAAAGAAAGGTATTTAGG - Intronic
942061444 2:172231903-172231925 GTGGGAAAGGAGAGGCATTTGGG - Intergenic
944794071 2:203164372-203164394 CTGGGTAGGGGCAGTTATATAGG + Intronic
945965180 2:216179405-216179427 TTTGGTAAGGACAGGAATGTGGG + Intronic
948982946 2:241504097-241504119 CTGGGGAAGGAAAGGCAGTTAGG + Intronic
1172089551 20:32419488-32419510 CTTGGTAAGGCCAGGCATGTTGG - Intronic
1172436232 20:34930795-34930817 CTGGGAGGGGACAGGGATTTAGG - Intronic
1174783107 20:53408170-53408192 CTGTGGAAGGACAGGCATTCTGG - Intronic
1174841259 20:53903600-53903622 CTCATTAAGGACAGATATTTGGG - Intergenic
1176714473 21:10338446-10338468 CTGTGTACGGACAGGTAGGTTGG - Intergenic
1180539249 22:16426408-16426430 CTGAGCAAGGAAAGGTAATTTGG + Intergenic
1182228104 22:28815747-28815769 TTGGGGAAGGCCAGGTATTGTGG + Intergenic
1183807261 22:40221830-40221852 CTGGGTAAGGACAGGTATTTGGG - Intronic
1184755474 22:46513396-46513418 CTTGGTATGGTCAGGTATGTGGG - Intronic
951093670 3:18603308-18603330 CTGGGTAAGGACAGCCATGGTGG + Intergenic
951578040 3:24133724-24133746 CAGAGAAAGGACAGGAATTTGGG + Intronic
951659805 3:25050070-25050092 GTGGGTGAGGAAGGGTATTTTGG + Intergenic
952580196 3:34824232-34824254 CTAGGTAAGGACAGGTCATCCGG + Intergenic
953976456 3:47385237-47385259 CTGGTTAAGGGCAAGTGTTTGGG - Intronic
961047148 3:123717204-123717226 CTGGTTATGCACAGGTACTTTGG - Intronic
962837562 3:139202709-139202731 CTGGGTGAGGACAGGGACTGGGG - Intronic
966199689 3:177349029-177349051 CAGGGTAAGGACAGAACTTTGGG - Intergenic
969944224 4:10766329-10766351 CTAGGCAATGACATGTATTTTGG - Intergenic
973033856 4:45380006-45380028 CAGGATAAGAACAGGTATCTAGG + Intergenic
974020384 4:56687731-56687753 CTGGGGAAGGCCAGGTGGTTGGG - Intergenic
974611287 4:64220680-64220702 CTGGTTCAGGAGAGATATTTAGG - Intergenic
974791646 4:66698259-66698281 CTAGGTAAGGAAAGATATTCTGG - Intergenic
975064572 4:70044642-70044664 TTGGGGAAGGATAGTTATTTGGG + Intergenic
977944692 4:102898610-102898632 CTGAGCAAGGAAAGGTAATTTGG + Intronic
978322238 4:107510463-107510485 CTGTGTATGGAGAGGTAGTTAGG + Intergenic
979203622 4:118008634-118008656 CTGGGTGGGCACAGGTATTTTGG - Intergenic
979735840 4:124082463-124082485 CTGGGGAAAAACACGTATTTAGG + Intergenic
980097852 4:128511936-128511958 ATATGTAAAGACAGGTATTTGGG + Intergenic
988175705 5:27721992-27722014 CTGTGTAAGAACAACTATTTGGG - Intergenic
994121127 5:96114164-96114186 CTGGGCAAGGAAAAGTATTCTGG + Intergenic
999377396 5:151096206-151096228 CTGGGAAAGGAGAGGTGTGTGGG - Intergenic
1001233552 5:170010331-170010353 CTGGGTAAGGACTGGGATATAGG + Intronic
1001334534 5:170786231-170786253 CAGGGAAAGGACAGGGATTGGGG + Intronic
1002462907 5:179384961-179384983 ATGGGAAAGGAGAGGTATTTGGG - Intergenic
1004002368 6:11606967-11606989 GTTGGTAAGGAAAGGAATTTAGG + Intergenic
1004231587 6:13838498-13838520 CTGGGTAATGGCAAGTAGTTTGG + Intergenic
1007636443 6:43302515-43302537 CTGGGTAAGAGCAGGGATCTGGG - Intronic
1007799740 6:44381954-44381976 CTGGGGAAGTACAGATTTTTTGG + Intergenic
1009996318 6:70899271-70899293 CTGGGTCATGAAAGGTATATAGG + Intronic
1010915934 6:81618972-81618994 GTGGGTAAGCAGAGATATTTTGG + Intronic
1015198583 6:130552509-130552531 CTGGGTGAGGAAAGGGATATAGG - Intergenic
1015564480 6:134553671-134553693 CTGGGTAAGGAAAGTTTATTTGG - Intergenic
1017155647 6:151320515-151320537 CTGGGAATGGACAGGGATTAGGG - Intronic
1019608083 7:1920113-1920135 CTGGGGAAGGACAGGGATGCTGG - Intronic
1019947990 7:4345341-4345363 CTGGGTTTGGACAGGAATCTAGG + Intergenic
1021370965 7:19846161-19846183 ATGGGTAAGGATAGGAATATAGG - Intergenic
1023344312 7:39255716-39255738 CTGGGTGAGGAAAGGGATTTAGG + Intronic
1023683392 7:42711758-42711780 CTGGGCAACTACAGGTAATTAGG + Intergenic
1028123853 7:87088691-87088713 CAGGGGAAGGACAGGAGTTTGGG - Intergenic
1028268595 7:88759368-88759390 CGGGGTGAGGACAGGGAGTTGGG - Exonic
1030370905 7:108698085-108698107 GTAGGAAAGGACAGGGATTTGGG - Intergenic
1033939582 7:146635879-146635901 CTGGCTAGAGACAGGCATTTCGG - Intronic
1034255095 7:149720481-149720503 CTGGGCAAGGCCAGGCATTTAGG + Intronic
1037078710 8:14756131-14756153 CTGGGTTATGACAGGCATATAGG + Intronic
1037454832 8:19052834-19052856 CTGGGGAGGGACAGGTGCTTGGG + Intronic
1037521328 8:19682919-19682941 ATGGATAAGTACAGGTAATTGGG - Intronic
1039354942 8:36804590-36804612 CAGGGTTAGGGCAGCTATTTTGG + Intronic
1045913981 8:107444261-107444283 AGGGGAAAGGACAGGTTTTTAGG + Intronic
1048284774 8:133133241-133133263 CTGGGTGAGGAAAGGTGTTAAGG - Intronic
1048730601 8:137436334-137436356 CTGGGAAAGAACAGCTAATTAGG + Intergenic
1050695002 9:8268920-8268942 CTGGATAAGCACAAGTCTTTAGG + Intergenic
1050851855 9:10297773-10297795 CTGGAAAATGACAGGAATTTTGG + Intronic
1051730106 9:20132196-20132218 CTTGGTTAGAACAGTTATTTGGG + Intergenic
1053837381 9:42154190-42154212 CTGGGTAAAGGTAGGTATATGGG + Intergenic
1055428391 9:76218787-76218809 TTGGGTAAGGACACACATTTTGG - Intronic
1059196801 9:112378319-112378341 TAGTGTAAGTACAGGTATTTAGG + Intergenic
1060730769 9:126035546-126035568 CTTGGGAAGTACAGGTCTTTAGG + Intergenic
1061867204 9:133499008-133499030 CTGGTTAAGGAGAGCTATTCAGG - Intergenic
1188263136 X:28040778-28040800 CAGGGAAAGGACAGGCCTTTGGG - Intergenic
1188945097 X:36290792-36290814 CTGAGATAGGACAGGAATTTAGG + Intronic
1190860418 X:54339527-54339549 CAGGGTAAGGACAGACATATAGG + Intronic
1192016455 X:67336715-67336737 CTGGGGAAGGTAAGATATTTAGG + Intergenic
1194074835 X:89377381-89377403 CTTGGAAAGGAAAGTTATTTGGG - Intergenic
1195915492 X:109931181-109931203 CTCCCTAAGGGCAGGTATTTTGG - Intergenic
1197130108 X:122995463-122995485 CTGGGTAAGGGAAGGTAAGTAGG - Intergenic
1199370201 X:147038538-147038560 CTGTGTAAGCAAAGATATTTGGG - Intergenic
1199671204 X:150149826-150149848 GTGGGTAAGAACAGGTAATCAGG - Intergenic
1200730433 Y:6731551-6731573 CTTGGAAAGGAAAGTTATTTGGG - Intergenic