ID: 1183809149

View in Genome Browser
Species Human (GRCh38)
Location 22:40239293-40239315
Sequence CCGGAAGGCACAGACTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183809149_1183809153 -1 Left 1183809149 22:40239293-40239315 CCAAGTCAGTCTGTGCCTTCCGG No data
Right 1183809153 22:40239315-40239337 GTCTGTGCCTGTTACCACCCTGG 0: 1
1: 0
2: 0
3: 17
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183809149 Original CRISPR CCGGAAGGCACAGACTGACT TGG (reversed) Intronic
No off target data available for this crispr