ID: 1183809694

View in Genome Browser
Species Human (GRCh38)
Location 22:40244383-40244405
Sequence CCAGAGGTGCAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183809687_1183809694 26 Left 1183809687 22:40244334-40244356 CCTCCTTGGTTGTGTGGATTTTG 0: 1
1: 0
2: 0
3: 14
4: 188
Right 1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG 0: 1
1: 0
2: 5
3: 46
4: 521
1183809688_1183809694 23 Left 1183809688 22:40244337-40244359 CCTTGGTTGTGTGGATTTTGCAT 0: 1
1: 0
2: 1
3: 17
4: 221
Right 1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG 0: 1
1: 0
2: 5
3: 46
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183809694 Original CRISPR CCAGAGGTGCAGAAGGAGAA AGG Intronic
900521371 1:3106937-3106959 CCAGACGACCAGAAGGAGAGGGG + Intronic
900788491 1:4664604-4664626 ACACAGGTGAAGAAAGAGAATGG + Intronic
901168133 1:7234405-7234427 CCAGAGCTGCAGGAGGGAAAGGG - Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
902189711 1:14753815-14753837 CCAGAGCTGCAGAAGGAAACAGG - Intronic
904052348 1:27647202-27647224 CCAGAGGAGCAAAAGAAGGAAGG + Intergenic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904772875 1:32890695-32890717 TCAGAGATGCAGAAGGAAAGGGG - Intronic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906237631 1:44221466-44221488 CCAGAGGGGAAGAGGGAGAGTGG - Exonic
906745971 1:48222448-48222470 CCAGATGAGCAGGAGGAGAAAGG - Intergenic
906838926 1:49114755-49114777 CCTGAGGTGAGGAAGGAGAAGGG + Intronic
906955526 1:50370775-50370797 TCAGAGGGGCAGAAGGACAGGGG - Intergenic
907705353 1:56827846-56827868 CCTGAAGAGCAGAAGGATAATGG + Intergenic
907731352 1:57069455-57069477 TCAGAGGTGAAAAAGAAGAAAGG + Intronic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908074364 1:60497807-60497829 CCAAAGGAGAAGAAAGAGAAAGG + Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909921395 1:81385103-81385125 CCAGGTGTGCAGAAGAACAAAGG - Intronic
910766413 1:90787110-90787132 CCAGAGGAATAGAAGGAGACAGG - Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911491566 1:98575540-98575562 CCAGAGTTGGAAAAGGAGAAAGG + Intergenic
911828580 1:102520450-102520472 CATGAAGTGCAGAAGGTGAATGG - Intergenic
912229812 1:107779612-107779634 AAAGATGTGCAGAATGAGAAGGG + Intronic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
914383591 1:147144888-147144910 CCAGAGGCTGGGAAGGAGAATGG - Intergenic
915107863 1:153545687-153545709 CCAGGGCTGGGGAAGGAGAAGGG - Intronic
915579045 1:156802488-156802510 GCCAAGGGGCAGAAGGAGAAAGG + Intergenic
916085638 1:161267056-161267078 CTAGAGGTGCAGGAAGTGAAGGG - Intronic
916213142 1:162374463-162374485 CCAGAGGTGCAGCAGGATGAGGG - Exonic
916464790 1:165062918-165062940 AAAGAGGTTCAGGAGGAGAAAGG + Intergenic
916585872 1:166149779-166149801 CCAGAGGTGGGGATGGAGCATGG - Intronic
917013439 1:170501835-170501857 CCAAAGGTACAGAAAGAAAAAGG + Intergenic
917829652 1:178866923-178866945 CAAGAGTAGCAGAAGTAGAATGG + Intronic
918355649 1:183704987-183705009 TCATTGGTGTAGAAGGAGAAAGG + Intronic
918995861 1:191758532-191758554 CCAGAAGTGGAGAAGGAGGGAGG + Intergenic
919057245 1:192586389-192586411 CCACAGGAGCAGAAGGAGAAGGG - Intergenic
919507487 1:198417472-198417494 TCAGTGGAGCAGAAGGAGAGTGG - Intergenic
919666005 1:200293182-200293204 ACAGTGGGGCAGAAGGAAAATGG + Intergenic
920116914 1:203628014-203628036 CCAAAGGGGAGGAAGGAGAAGGG + Intronic
920306730 1:205023180-205023202 CAAGCGGTGCAGAAAGAGGAGGG - Intergenic
920369806 1:205471490-205471512 GGAGAGGTACAGAAGGAGAGAGG + Intergenic
921221959 1:212979763-212979785 CCAGAGGAGCAGTGTGAGAAAGG - Intronic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922802086 1:228369032-228369054 CCAGGGCTGCAGGAGGAGACAGG - Intronic
923054044 1:230412085-230412107 ACAGAGATAGAGAAGGAGAAGGG + Intronic
923371667 1:233320498-233320520 AGAGAGGTGAGGAAGGAGAAAGG - Intergenic
924222335 1:241890882-241890904 CCAGAGGTGCAGAATAAGGCTGG + Intronic
1062938171 10:1403098-1403120 CCGGAGGTGGGGATGGAGAAAGG + Intronic
1063661517 10:8037559-8037581 CCGGAGGGGGAGAGGGAGAAAGG - Intergenic
1064257735 10:13758569-13758591 CCACATGTGCACTAGGAGAAGGG + Intronic
1064681896 10:17818692-17818714 CCAGAGCTGAGGCAGGAGAATGG + Intronic
1065841253 10:29703368-29703390 CAGGTGGTGGAGAAGGAGAAAGG - Intronic
1067055740 10:43048843-43048865 GCAGATGTGCAGAATGACAATGG + Intergenic
1069290865 10:66778178-66778200 CCGGAGGTGAAAAAGTAGAAAGG - Intronic
1069373034 10:67767150-67767172 CCAAAGGAGAAGGAGGAGAAGGG - Intergenic
1069613718 10:69792728-69792750 TCAGAGGTGGAGCAGGAGTAGGG - Intergenic
1069757933 10:70785217-70785239 CCAGAAGGGCAGAGGTAGAAAGG - Intronic
1069797346 10:71061867-71061889 CCGGAGCTGCAGAAAGAGCAGGG - Intergenic
1069815640 10:71191970-71191992 CCAGAGAGGCAGGAGGAGAGGGG + Intergenic
1069946261 10:71987947-71987969 CCAGAGGTGCAGAACAAAATGGG + Intronic
1070526589 10:77300788-77300810 CCAGAGGGGCTGGAGAAGAAAGG - Intronic
1071714576 10:88082567-88082589 CCAGATGTGCTGGATGAGAATGG - Intergenic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1072234422 10:93440805-93440827 CCAGAGAGGCTGAAAGAGAAAGG - Intronic
1072295822 10:94008781-94008803 CAAGAGGCACATAAGGAGAAAGG + Intronic
1072446436 10:95502796-95502818 CAAGTGGTAGAGAAGGAGAAAGG - Intronic
1072446707 10:95505020-95505042 CAAGTGGTAGAGAAGGAGAAAGG + Intronic
1073065939 10:100759235-100759257 CCAGAGGTGATGAAGGAGAAAGG + Intronic
1073496239 10:103893618-103893640 CCAGAGGTGCTGAAAAAGAGTGG + Intronic
1073991400 10:109266196-109266218 ACAGAGATGCCAAAGGAGAAGGG - Intergenic
1074400712 10:113139284-113139306 GCTGAGGTGGAGAAGGAAAAGGG - Intronic
1074812432 10:117119162-117119184 CCAGAGGTTAAGAAGGATAGGGG + Intronic
1075173818 10:120141011-120141033 CCTGGGGTCCAGAAAGAGAAGGG - Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075347466 10:121694203-121694225 ACAGAGGAGAAGAAGGAAAAAGG - Intergenic
1075733666 10:124651318-124651340 CCAAAGGTGCAGAAGGAGGCTGG + Intronic
1076281800 10:129252642-129252664 CCAAAGGTGAAGGAGGAGCAAGG + Intergenic
1077107574 11:848696-848718 CCAGAGGTGGGGAATGAGGAAGG - Intronic
1077230529 11:1456474-1456496 GGGGAGGCGCAGAAGGAGAACGG + Exonic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077504833 11:2925136-2925158 CCAGAGGACCAGGAGGACAAGGG - Exonic
1078720502 11:13879625-13879647 CCAGAGGTGCCAAAGGAGAGAGG - Intergenic
1079210424 11:18456055-18456077 CAAGAGGTGAAGAAAGAGAATGG - Exonic
1079908670 11:26281796-26281818 CCATAGTTGCAGAAGGACAATGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082262005 11:50083593-50083615 CCAGTGGAGCAGAAGGATAGAGG - Intergenic
1083173867 11:60937629-60937651 GCAGAGTTCCAGAAGCAGAAAGG + Intronic
1083310211 11:61780073-61780095 CCAGAGGGGAAGAGGCAGAAAGG - Intronic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1085637631 11:78170647-78170669 CCACAGCTGCACAAGGGGAAGGG - Intergenic
1086344824 11:85885262-85885284 CCAGAGGTCCAGAAGGACTCAGG - Intronic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1088250750 11:107858998-107859020 CCAGGGTGGCAGGAGGAGAAAGG + Exonic
1089495753 11:118907997-118908019 CCAGAGCTCCAGAAGGGGAGAGG - Intronic
1089612957 11:119679820-119679842 CCACAGGTGGAGAAGGGGAAGGG - Intronic
1089750890 11:120650270-120650292 CAAGGGGTGCAGAGGGAGAGGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090523209 11:127501024-127501046 CCAGAGGAGAAGAGGGAGACGGG - Intergenic
1090582870 11:128179118-128179140 CCAGAGCTGCAAAAGAAGCAGGG - Intergenic
1091187912 11:133663116-133663138 CCAGATGTGCAGCAGCACAAGGG + Intergenic
1091230469 11:133984769-133984791 CCAGGGGTGCAAAGGGAGCAGGG + Intergenic
1091463207 12:661577-661599 CCAGAGGTTCAGAAGGAAAGAGG - Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091663025 12:2398681-2398703 CCAAAGCTGCAGAAAGAGAGGGG + Intronic
1092017750 12:5173417-5173439 CCAGAGGTGCAACAGGAGGTTGG - Intergenic
1092353794 12:7777825-7777847 CCAGAGGCTGAGGAGGAGAATGG + Intergenic
1092976938 12:13754493-13754515 TCAGTGGTCCAGAAGGTGAATGG + Intronic
1094698214 12:32842600-32842622 GAAGAGGGGCAGAAAGAGAAGGG + Intronic
1095220963 12:39613948-39613970 TCAGAGGTGAAAATGGAGAAAGG - Intronic
1096001795 12:48136189-48136211 CCAGAGGTTAAGAATGAGGAGGG - Intronic
1096245855 12:49985737-49985759 CAAGAGTTACAGAGGGAGAAAGG + Intronic
1096886018 12:54720008-54720030 CGAGAGGTGATGAAGGGGAAGGG + Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097039140 12:56144055-56144077 CCAGGGGCCCAGAAGGATAAAGG - Intronic
1097275150 12:57808071-57808093 CCTGAGGTGCCGGAGGGGAAAGG + Intronic
1097634887 12:62110556-62110578 CCAGAGGTGCAAAAGGAAGCTGG - Intronic
1097769277 12:63562598-63562620 CCAGTGGTGCAGAAGTAATATGG - Intronic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1098054045 12:66484662-66484684 CCAGAGGTTGGAAAGGAGAAGGG + Intronic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1099565196 12:84233797-84233819 CAAGAGATGCTTAAGGAGAAAGG - Intergenic
1099637514 12:85233292-85233314 CTAGATAAGCAGAAGGAGAATGG + Intronic
1099972447 12:89514231-89514253 CCAGAGCTGGAGGAAGAGAAGGG - Intronic
1100214410 12:92432998-92433020 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1101031503 12:100665024-100665046 CCAGAGTTGAAGAAGGGGAGAGG - Intergenic
1101538399 12:105641810-105641832 CCAGAAGTCCAGAAGGAGGCAGG + Intergenic
1102558809 12:113747641-113747663 CCAGAGGTGCAGGGGGTGAGGGG - Intergenic
1102648258 12:114417940-114417962 CTAGAGGTGCAGAGAGTGAAGGG + Intergenic
1102793641 12:115669870-115669892 CCAAAAGTGCTGAAGGAGGAAGG - Intergenic
1102822966 12:115923847-115923869 ACAGAAGAGGAGAAGGAGAAGGG - Intergenic
1103033978 12:117641521-117641543 ACAGAGATGCACAGGGAGAAAGG - Intronic
1103618733 12:122172725-122172747 CCACAGGTGGAGGAAGAGAAGGG - Exonic
1103851560 12:123936920-123936942 CAAGAGAAGCAGAAGGAGAATGG + Exonic
1104252327 12:127107300-127107322 CCACAGGTTAAGAAGGGGAACGG + Intergenic
1104381302 12:128310285-128310307 CCAGAGGCCAAGAAGGATAATGG + Intronic
1104428523 12:128697431-128697453 CCAGAGGTTCAGAGGGAGCAGGG + Intronic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105040923 12:132960583-132960605 AAAGAGATGCAGAAGCAGAAGGG - Intergenic
1105284736 13:18994782-18994804 CCAGAGGAGCAGAAGGCCAGAGG + Intergenic
1105862540 13:24428923-24428945 CCAGGGTTTCAGAAGGTGAAAGG - Intronic
1105932159 13:25062746-25062768 CATGAGGGGAAGAAGGAGAATGG + Intergenic
1106276184 13:28209808-28209830 CCAGAGTGGTAAAAGGAGAAAGG - Intronic
1106606205 13:31231623-31231645 CCAGAAGAACAGAAGGGGAAAGG - Intronic
1106879133 13:34110066-34110088 CCAGAGTTGCTGAAGAAGCAGGG + Intergenic
1109481882 13:62965486-62965508 ACAGAGGTGGAAAAAGAGAAAGG + Intergenic
1110273535 13:73617446-73617468 CCAGGGTTGGAGAGGGAGAAGGG - Intergenic
1110972057 13:81776204-81776226 CCAGGGGTTCAGAGGGAGAAAGG - Intergenic
1111061643 13:83027039-83027061 CCAGAGGTACAAAAAGACAAGGG + Intergenic
1111518868 13:89373060-89373082 TCAGAGGGGAAGAAAGAGAATGG + Intergenic
1111670033 13:91319192-91319214 CCAGAGGAGCAGAAGTGGAAGGG + Intergenic
1112422118 13:99261848-99261870 CCAGAGGTGCAAATGGAGATGGG + Intronic
1112855022 13:103757892-103757914 CCAGAGGTGGAGGAGGAGGCAGG - Intergenic
1113451786 13:110415356-110415378 CCAAAGGAGGAGAAGGACAATGG + Intronic
1113565587 13:111317822-111317844 ACAGAGGTGAAGAAGGAGCAAGG - Intronic
1113774043 13:112932404-112932426 CAAGAGGAGCTGAAGGAGACAGG + Intronic
1114149140 14:20015384-20015406 CCAGAGGCTGGGAAGGAGAAGGG + Intergenic
1116561797 14:46388788-46388810 CCAGAGGCTCAGAAGGATAGTGG + Intergenic
1116661618 14:47717343-47717365 CCAAAGTTTCAGAAGGGGAAAGG + Intergenic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1118342527 14:64906855-64906877 CGGGAGATGGAGAAGGAGAAAGG - Intergenic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1119055710 14:71417643-71417665 GCAGAGGTGGAGGAGGAGGAAGG + Intronic
1119364957 14:74084071-74084093 GCAGAGCTGGAGAAGGAGAGTGG + Intronic
1119384887 14:74251876-74251898 CCAGAGGGGAAGAAAGAGACTGG + Intronic
1119601686 14:75980952-75980974 GCAGACGTGCAGAAGGAGGGAGG + Exonic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1122047766 14:99035828-99035850 CCAAGGTTGCAGAAGGAGAAGGG + Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122602291 14:102927917-102927939 CCAGGGGTGCAGGAGGAGGCAGG - Intronic
1122836942 14:104435108-104435130 CCAGACCTGCAGAATGGGAAAGG + Intergenic
1122874898 14:104659491-104659513 GCAGGGGTGGAGTAGGAGAAGGG - Intergenic
1123139360 14:106060351-106060373 CCAGAGGTGGAGCAGCAGTATGG + Intergenic
1124020568 15:25918591-25918613 CCAGAGGGTGAGAAGGAGAAGGG - Intergenic
1124029092 15:25992858-25992880 CAAGAGGTGCAAAAGGACCATGG + Intergenic
1124070153 15:26384102-26384124 CCAGAGATGCTGATTGAGAATGG + Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124589843 15:31043296-31043318 CCAGAGGTGAGGCAGGAGAATGG - Intronic
1124632460 15:31345401-31345423 CCAGCGGTGCAGCAGGGCAAAGG - Intronic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125775246 15:42207031-42207053 CCAGAGCTGCTAAAGGAGGAAGG + Intronic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1128296472 15:66524894-66524916 GCAGGGGTGCAGAGAGAGAAGGG - Intronic
1129167580 15:73787470-73787492 GCAGAGGAGCAGATGGAGATGGG + Intergenic
1129492478 15:75942142-75942164 CCAGAGGTTCAGTGGGAGAGAGG + Exonic
1129538446 15:76332883-76332905 GGAGTGGGGCAGAAGGAGAATGG + Intergenic
1129703928 15:77783885-77783907 ACTGAGGTGCAAACGGAGAAAGG - Intronic
1130009204 15:80135051-80135073 GCAGAGGTGGAGAAGGTAAAAGG - Intronic
1130344297 15:83027537-83027559 ACAGAGGTGGAGAAGGGGAGGGG - Intronic
1130572687 15:85062559-85062581 ACAGAGGTGCAGACAAAGAAGGG - Intronic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1131781614 15:95865819-95865841 CCAGGGCTGCTGCAGGAGAAAGG - Intergenic
1132103250 15:99043159-99043181 CCAGAGTTACAGAGGGAGCATGG + Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1134334208 16:13281123-13281145 CCAGAGATGAAGATGGAGATGGG + Intergenic
1135401526 16:22169551-22169573 CCAGGCCTGCAGCAGGAGAAGGG - Intronic
1135522406 16:23187546-23187568 CCAGGGGTGCAGATGCAGATGGG - Intronic
1135675835 16:24414151-24414173 CCAGGTTTGCAGCAGGAGAAAGG + Intergenic
1137749062 16:50845254-50845276 CCAGAGGAGCAGAGGGAGACTGG + Intergenic
1137791002 16:51174672-51174694 GCAGAGGTTCAGGAGCAGAAAGG - Intergenic
1138326709 16:56178310-56178332 CCAGAGCTGAGGCAGGAGAATGG - Intergenic
1138513333 16:57521448-57521470 CCTGAGGTGCAGCAGGAGAGAGG - Intronic
1138513744 16:57524292-57524314 CCTGAGGTGCAGCAGGAGAGAGG + Intronic
1138776372 16:59728953-59728975 CCAGAGGTCCATAGTGAGAATGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1140247795 16:73267168-73267190 GCGGAAGGGCAGAAGGAGAAGGG + Intergenic
1141533409 16:84662077-84662099 CCAGAGGACAAGAAGAAGAAAGG + Exonic
1141775574 16:86120914-86120936 CTAGAGGAGGAGGAGGAGAAGGG - Intergenic
1142617583 17:1145476-1145498 CCAGAGCTGCAGAAGGCGGGTGG + Intronic
1143165578 17:4895763-4895785 CCAGAAGTGGAGAAGAAGCAGGG + Exonic
1144874234 17:18388840-18388862 CAAGAGCTGAAAAAGGAGAAAGG - Exonic
1145157994 17:20555578-20555600 CAAGAGCTGAAAAAGGAGAAAGG + Intergenic
1145841374 17:27998000-27998022 CCCGAGGTGAGGAAAGAGAAGGG - Intergenic
1146147678 17:30435808-30435830 CCACAGTTTCAGAGGGAGAATGG - Intronic
1146632947 17:34483852-34483874 CCAGAGGTCCAGAGAGAGAACGG - Intergenic
1147159725 17:38562959-38562981 CCAGCTGTGCACAATGAGAAGGG + Intronic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147598901 17:41733989-41734011 GCAGAGGAGGAGATGGAGAAGGG + Intronic
1147897460 17:43759929-43759951 CCTGAGGTGCAAGAAGAGAAAGG + Intergenic
1148136952 17:45299509-45299531 CCTCAGGCGGAGAAGGAGAATGG + Intronic
1148189337 17:45667729-45667751 ACAGAGGTAGAGAAGGAGGATGG - Intergenic
1148984822 17:51612205-51612227 CCAGAGTTGCACAGGTAGAAGGG + Intergenic
1149467744 17:56893125-56893147 ACACAGATGCAGCAGGAGAAGGG + Intronic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1151023902 17:70654805-70654827 ACAGATGTGCAGAGAGAGAAAGG - Intergenic
1151672989 17:75582568-75582590 CCAAAGGCCCAGATGGAGAATGG - Intergenic
1152250606 17:79210722-79210744 CCAGACGTGCAGATGGAGGGTGG - Intronic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152795879 17:82305953-82305975 CCAGAGGCTCTGAGGGAGAACGG - Intergenic
1154173180 18:12065605-12065627 CCAGATGTGCAGCAGGGGATGGG - Intergenic
1155154003 18:23143504-23143526 CCAGAGGGGCAGTTGGGGAAAGG - Intronic
1155336166 18:24767421-24767443 GCAAAGGTGTGGAAGGAGAACGG + Intergenic
1155517393 18:26637266-26637288 CCCGGGGTTCAGAAGGAGCATGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155758166 18:29528555-29528577 CTAGTGGTGGAGAGGGAGAAGGG + Intergenic
1155848543 18:30740280-30740302 TCAGAGGCTGAGAAGGAGAATGG + Intergenic
1156724104 18:40106953-40106975 CCAGAGGTGTAGAAGCTGACTGG + Intergenic
1157110559 18:44816416-44816438 GAAGGGGTGCAGGAGGAGAAGGG + Intronic
1157405524 18:47419459-47419481 CCAGAGGAAGAAAAGGAGAAGGG - Intergenic
1157470143 18:47982571-47982593 GAAGAGGGGGAGAAGGAGAAGGG + Intergenic
1157476282 18:48025518-48025540 ACATAGGTGAAGATGGAGAAGGG - Intergenic
1157782328 18:50450533-50450555 ACAGAGCTGCAAAAGGAAAAAGG - Intergenic
1158662670 18:59402720-59402742 CTAGAGGGGAAGACGGAGAAAGG + Intergenic
1159694344 18:71535968-71535990 CCAGAGGGGTAGAAAGGGAAGGG - Intergenic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160751724 19:737604-737626 CCAGAGGTGCTGAGGGAGCAAGG + Intronic
1161114287 19:2488251-2488273 CCAGAGCTGCATCTGGAGAAGGG + Intergenic
1161401862 19:4069411-4069433 CCAGAGATGGACAAGGAGCAAGG + Intergenic
1161921301 19:7268201-7268223 CGGCAGGTGCAGAAGGAGAAAGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1164892519 19:31836970-31836992 GCAGGGGTGCTCAAGGAGAAGGG - Intergenic
1165259444 19:34599317-34599339 ACAGATGGGGAGAAGGAGAAAGG - Intronic
1165935520 19:39386385-39386407 CCAGATGAGGAGCAGGAGAAGGG - Exonic
1166364390 19:42271061-42271083 CCAGAGGGGCAGAGGGAGGGTGG + Intronic
1167209981 19:48128099-48128121 TGAGAGCTGCAGAAGGAAAAGGG - Intronic
1167217170 19:48172165-48172187 CCAGAGATGCAGAGGGGGAGAGG + Intronic
1168111935 19:54197539-54197561 CCAGAGGTGGAGGAGGTAAAAGG - Intergenic
925300797 2:2810709-2810731 TCACAGGTGCAGCAGGAGCAAGG - Intergenic
925307735 2:2861997-2862019 CCAGAGTGGCAGAGGGAGCACGG + Intergenic
926885041 2:17589417-17589439 GCAGCTGTGCAGAAGGAGAGTGG + Intronic
927813169 2:26191681-26191703 CCAGAGCCGCAGATGCAGAATGG + Intronic
928347269 2:30511813-30511835 CCAGAGGTGCAGAGAGAGAAGGG + Intronic
930000962 2:46861228-46861250 ACAGAGATGGAGAGGGAGAAGGG - Intergenic
930341213 2:50117354-50117376 CCAGAGATGAATAAGGAGAATGG + Intronic
930622143 2:53654575-53654597 CCAAAGGTGGAGAGTGAGAAGGG + Intronic
931577873 2:63738467-63738489 CCAGAAGTGGAAAATGAGAAAGG + Intronic
931858380 2:66328049-66328071 CCAGAGCGGCAGAAGGAGACTGG + Intergenic
932000988 2:67884223-67884245 GCAGAGGAAGAGAAGGAGAAGGG - Intergenic
932515587 2:72344927-72344949 ACAGAGGTTCAGATGGAGATGGG - Intronic
932702883 2:74003004-74003026 CCGGAGGGGAAGAAGGCGAACGG - Intronic
933636567 2:84714441-84714463 CCAGAGGCTGGGAAGGAGAATGG + Intronic
933857283 2:86428215-86428237 GCTGAGGTGCAGAAAGAGAGAGG - Intergenic
935421076 2:102869479-102869501 CCAGAGAGGAAGAAGGGGAAAGG + Intergenic
936502047 2:113074279-113074301 CCAGTGGTGCATAAAGGGAATGG + Intronic
937145179 2:119638520-119638542 CCACAGCTGCAGAACAAGAATGG + Intronic
937216607 2:120317153-120317175 CCAGGTTTACAGAAGGAGAAAGG - Intergenic
937265651 2:120613268-120613290 ACAGGGGTGAAGAACGAGAAGGG - Intergenic
937454379 2:122028696-122028718 CCAGAAGAGCAGGAGGAGACGGG - Intergenic
938395484 2:130944368-130944390 TCAGAGTTCCAGAAGGAGAAGGG - Intronic
939996963 2:148928764-148928786 CCAGAGGTGGGGGAGGAAAAGGG - Intronic
940841865 2:158593106-158593128 CCAAAGGTGAAGAAATAGAAAGG - Intronic
941092207 2:161190783-161190805 CCAGAGGTTGAGAGGGAGGAAGG + Intronic
942109347 2:172664717-172664739 GCATAAGTGAAGAAGGAGAAAGG - Intergenic
942582406 2:177432829-177432851 CCAGTCCTGCAGAAGGGGAAGGG + Intronic
944294625 2:198048541-198048563 CCAGTCATGCAGAAGGTGAAGGG + Intronic
945220749 2:207481361-207481383 CCAGTGGTGCAGAAAAACAATGG - Intergenic
945917376 2:215718098-215718120 CCAAAGGAGCTGAAGGAGAGAGG + Intergenic
946346221 2:219112646-219112668 CCAGATATGAAGGAGGAGAAAGG + Intronic
946766661 2:223046879-223046901 CCAGAGCTGAAAAAAGAGAAGGG - Intergenic
947019900 2:225663502-225663524 CCTGAGGTGTAGCAGGTGAATGG - Intergenic
947035378 2:225847864-225847886 CAAGAGGAGCAGAATAAGAATGG - Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947931867 2:233971502-233971524 TCTGAGGTGCAGATGGGGAATGG + Intronic
947943013 2:234075465-234075487 CGTGAGGTCCAGGAGGAGAAGGG - Intronic
948244703 2:236470325-236470347 CCAAAGGTGAAGAAGGAGCAGGG + Intronic
948559557 2:238842647-238842669 CCAGAGGTCAGGAAGGGGAAGGG - Intergenic
948884981 2:240877904-240877926 CCAGAGGAGCCGGGGGAGAAAGG - Intronic
1170435362 20:16321694-16321716 TCAGATGTGCAGAAGGAAAATGG + Intronic
1170641929 20:18162112-18162134 CCAGAGAAGGAGAAGGAGATGGG - Exonic
1170854364 20:20037121-20037143 TCAGAGGTGGAGAACGGGAAGGG - Intronic
1171010849 20:21508732-21508754 AGAGAGGGGAAGAAGGAGAAGGG - Intergenic
1171126647 20:22607955-22607977 CCAGAGGTGCAGTTTCAGAAGGG + Intergenic
1172554894 20:35832265-35832287 ACAGAGGTGCAAAAGGGGAGAGG - Intronic
1173126205 20:40338420-40338442 CCACAGGTGGAGATGGAGAGAGG + Intergenic
1173289898 20:41705477-41705499 GAAGAGGTGGAGAAGGGGAAAGG - Intergenic
1174084109 20:47993124-47993146 CCACAGGTGCATTAGGAGGATGG - Intergenic
1176052187 20:63125639-63125661 CCAGAGGTGGCCAAGAAGAAGGG + Intergenic
1176120816 20:63453749-63453771 CCACAGGGGGAGAAGGGGAAGGG + Intronic
1176233539 20:64043449-64043471 CCAGGCGTGCAGAAGGCGCAGGG - Intronic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176847609 21:13888668-13888690 TCAGAGGCTCAGGAGGAGAAGGG - Intergenic
1176942819 21:14944471-14944493 CCAGAGATGGAGAAGGAGACTGG + Intergenic
1177015623 21:15783354-15783376 CAAGAAGTGCAGAAGGACACAGG - Intronic
1177328560 21:19627189-19627211 CCAGAGATGGAGAAAAAGAAAGG + Intergenic
1177441843 21:21136098-21136120 CCAGATGTAAAGAAAGAGAAAGG - Intronic
1177808512 21:25899929-25899951 CCAGAGTTAAAGAATGAGAAAGG - Intronic
1178277725 21:31254211-31254233 CCAGAGCTCCAGAAGAGGAAGGG + Intronic
1178603453 21:34014924-34014946 CCAGTGGTTCAGAAGGAGGGAGG + Intergenic
1179057875 21:37952696-37952718 CCAGCGGTGCAGGGGGAGAGTGG + Intronic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1179782523 21:43711139-43711161 CCAGAAGAGGAGAGGGAGAAAGG + Intergenic
1180228850 21:46414379-46414401 CCAGAGGAGAAGGAGGAGAAGGG - Intronic
1180699312 22:17773139-17773161 CAAGAGGGGCAGAAGGGGCAGGG + Intronic
1181019629 22:20092550-20092572 CCAGAGGGGCAGCAGGAGGCTGG - Intronic
1181265245 22:21627352-21627374 CCTGAGGTGCAGGAGCAGATGGG - Intergenic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1181411923 22:22730178-22730200 AGAAAGGTGCAGAAGGAGAGAGG - Intergenic
1181634095 22:24166422-24166444 CCAGAGGTGCAGAGGAGGGAAGG + Intronic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182713294 22:32335802-32335824 CCAGAGGTGCTGGGGGAGAGGGG - Intergenic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183809694 22:40244383-40244405 CCAGAGGTGCAGAAGGAGAAAGG + Intronic
1184010055 22:41740823-41740845 CCAGAGATGAAGAAGGAAAGGGG + Intronic
1184457324 22:44618569-44618591 CTCCAGGTGCAGAGGGAGAAGGG + Intergenic
1184556100 22:45233905-45233927 TCAGAGGTCCAGAGGGACAAGGG + Intronic
1184629990 22:45769571-45769593 GCAGAGGTACAGAGGAAGAAAGG + Intronic
1184819657 22:46900058-46900080 CCAGAGGGAGAGAAAGAGAAAGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
949175378 3:1055678-1055700 CCTGAGGTGAAAAAGGAAAAGGG + Intergenic
949381678 3:3453918-3453940 CCAGACTTCCAGAAGGACAAAGG + Intergenic
949424952 3:3906776-3906798 ACAGAGGCTAAGAAGGAGAAGGG + Intronic
949757771 3:7432915-7432937 CCAGAAGTGAATAATGAGAATGG + Intronic
951215660 3:20022395-20022417 CCAGGGGTTCAGGAGAAGAAGGG + Intergenic
951331539 3:21374985-21375007 CTAGAGGTAAAGAAGGAAAAAGG + Intergenic
951742688 3:25941795-25941817 AGAGAGGGGCAGAAAGAGAAAGG - Intergenic
951860294 3:27244616-27244638 GCAGGGTTGCAGAGGGAGAATGG - Intronic
952053250 3:29412352-29412374 AGAGAACTGCAGAAGGAGAAGGG + Intronic
952178571 3:30894086-30894108 TCAGAGCTGCAGATTGAGAACGG - Intronic
952351325 3:32541669-32541691 CCAGAGTTACAGAATGAGCATGG - Intronic
953902569 3:46851626-46851648 CCAGAGGTGGAGGTGGAGAATGG + Intergenic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
954756010 3:52840376-52840398 CAAGAGGAGCAGAGGTAGAAAGG + Exonic
955049481 3:55395672-55395694 CCAGATGTGGAGAAGGACACAGG + Intergenic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
957060572 3:75478147-75478169 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
958103512 3:89044770-89044792 CCTGAGGTGCAGCATAAGAAAGG - Intergenic
960243009 3:115367341-115367363 CCAGAGGCCCGGAAAGAGAAGGG + Intergenic
961292809 3:125861249-125861271 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961495165 3:127286177-127286199 CCAGAGAGGGAGAAAGAGAAAGG + Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961957677 3:130821005-130821027 CAAAAGGGGCAGATGGAGAAAGG + Intergenic
962149792 3:132880682-132880704 CCAAAGTTGCAGAGGCAGAAGGG + Intergenic
962254503 3:133861107-133861129 CCAGGCCTGCAGAAGGGGAAGGG + Intronic
962851842 3:139313988-139314010 CCAGAGGAGCCAAAGGAGACTGG - Intronic
962968906 3:140380822-140380844 CCAGAGGGGAAGAAGAAGACAGG - Intronic
964071980 3:152646292-152646314 GCAGAGGAGCATAAGGAGCAAGG + Intergenic
965732485 3:171787161-171787183 CCAGAGGTGGACAAGCAGAATGG - Intronic
966297875 3:178444938-178444960 CCAGAGCTTCAGAAGGCAAAGGG - Intronic
966863342 3:184242568-184242590 CCAGAGCTGCAGCAGGATGACGG + Exonic
967559790 3:190904660-190904682 CAAAAGGTGAAAAAGGAGAAAGG - Intergenic
967604593 3:191430605-191430627 CCAGAGCTGCAGGAGTATAAGGG + Intergenic
967954885 3:194870474-194870496 CCAGATGCCCAGAATGAGAAGGG - Intergenic
968064902 3:195753225-195753247 CCAGAGCTGCAGAGTGAGTAGGG + Exonic
968768495 4:2487987-2488009 CAAGAAGTACAGGAGGAGAAAGG - Intronic
969004470 4:4008218-4008240 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
969102521 4:4779961-4779983 CCAGAGGTCCAGAAAAGGAAAGG + Intergenic
969198148 4:5579512-5579534 CCAGTGGTCCATAGGGAGAAAGG + Intronic
969203166 4:5622125-5622147 CCACAGGAGCAGAGGGGGAAGGG - Intronic
969809427 4:9636489-9636511 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
970403930 4:15744072-15744094 ACAGAGGCCCAGAAGGTGAAGGG - Intergenic
970723862 4:19019739-19019761 CCAGAAGTGCGGAAGGATCATGG - Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
971465702 4:26957751-26957773 CTAGATGTGCAGAAGGGGAGGGG - Intronic
972070343 4:35011655-35011677 AGAGAGGTACAGAAGAAGAAAGG - Intergenic
975342589 4:73258615-73258637 CGACGGCTGCAGAAGGAGAAGGG - Exonic
977129685 4:93219894-93219916 CCACTGGTTCAGAAGGAGCAGGG + Intronic
978605354 4:110473656-110473678 CCAGATGAGCAGAGGTAGAAGGG - Intronic
979068488 4:116169587-116169609 CCATAGGAGAAGAAAGAGAAAGG - Intergenic
979352673 4:119663522-119663544 TCAGAGATTGAGAAGGAGAATGG + Intergenic
980520810 4:133931811-133931833 CCATGGGGGCAGAAGGAGAGGGG - Intergenic
982538404 4:156636895-156636917 CCAGAGGTGGAGAAAGGCAATGG - Intronic
983010177 4:162537335-162537357 CCAGAGATGGAGTAGGAGGAGGG + Intergenic
983431826 4:167660104-167660126 CCAGAGGTCTAGCAGGAAAAAGG - Intergenic
984049318 4:174844029-174844051 CCAGTGGTGCACGAGCAGAAGGG - Intronic
985494714 5:198018-198040 CACCAGGGGCAGAAGGAGAAAGG - Exonic
985985596 5:3513461-3513483 CGGGAGAGGCAGAAGGAGAAGGG + Intergenic
986516464 5:8569648-8569670 GCACAGGTGCTGAAGGATAAAGG + Intergenic
986561108 5:9061590-9061612 CCTGAGCTGCGGCAGGAGAAAGG + Intronic
986865074 5:11976679-11976701 CCAGACCTGCAGAAGGTGAGGGG + Intergenic
987190067 5:15468322-15468344 CCAGAAGTTCACAAGGGGAAAGG + Intergenic
987247050 5:16059745-16059767 CCAGAAGGGAAGAAGGAGAGTGG - Intergenic
987593167 5:19959664-19959686 ACAGATTTCCAGAAGGAGAAGGG + Intronic
987811416 5:22840948-22840970 ACAGAGCTGCAGAAGAACAAGGG + Intronic
988009169 5:25461572-25461594 CCAGAGGCCCAGGAGGAAAAAGG + Intergenic
988780970 5:34521652-34521674 ACAGAGGTGCACAGGGTGAAAGG + Intergenic
989110480 5:37902303-37902325 CCTGAGGTGCCAAAGGAGAGGGG + Intergenic
989451029 5:41586962-41586984 GGAGAAGTGCAGAGGGAGAAGGG + Intergenic
989465184 5:41746797-41746819 CCAGGACTGCAGGAGGAGAAGGG - Intronic
990066021 5:51715800-51715822 CCAGAGGCTGAGAAGGGGAAGGG - Intergenic
991332673 5:65509299-65509321 CCAGAGGTTGAGACTGAGAAGGG - Intergenic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
992079262 5:73218739-73218761 CCAGAGGGTGAGCAGGAGAAAGG - Intergenic
992516506 5:77499299-77499321 ACTGTGGTGCAGAAAGAGAAAGG + Intronic
992750538 5:79856924-79856946 CCAGAGGTGCAGGTGGGAAACGG + Intergenic
992813735 5:80415446-80415468 CAAGAGGTGCCTAAGGAGACAGG - Intronic
993715957 5:91276091-91276113 CCAGAGTTTCAGAAGGAACATGG + Intergenic
993817991 5:92576830-92576852 CCAGAGGCTGAGGAGGAGAATGG - Intergenic
994941328 5:106327500-106327522 CCAAAGTTGCAGAGGCAGAATGG - Intergenic
995336760 5:111008466-111008488 CTAGAAGTGAAGAAGAAGAACGG + Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
996035779 5:118757212-118757234 CCAGTGCAGCAGAAGGATAAGGG - Intergenic
996928041 5:128852394-128852416 CCAGAGGTGGGGAAGGATAGTGG + Intronic
998052217 5:139045418-139045440 CAAGAGTTGGAGAAGGAGTAAGG - Intronic
998198973 5:140103256-140103278 CCAGAGGTTGAGAAGGGGAGAGG - Intergenic
998747119 5:145273433-145273455 CCAGAGGTTGAGAGGAAGAAAGG + Intergenic
998767012 5:145499575-145499597 CCAGAGAAGCCGAAGGAGAGAGG + Intronic
999667120 5:153924559-153924581 CCAGAGGTGGGGAAGGATAGTGG + Intergenic
1001113302 5:168916977-168916999 CCAGCTGTTCAGAAGGAGAGAGG - Intronic
1002202654 5:177538946-177538968 CCAGAGTTGCCGAAAGAGCATGG - Exonic
1002651213 5:180696723-180696745 ACAGGGGTGCAGAGGGAGACAGG + Intergenic
1002709193 5:181184096-181184118 CCAGGGCTGCAGGAGGAGAGGGG - Intergenic
1002797559 6:487177-487199 CTAGAGGGGCAGCAGGGGAAAGG - Intronic
1002802158 6:533797-533819 CCAGTGCTGCAGAAGCAGAACGG - Intronic
1003514174 6:6804547-6804569 ACAGAGATGCAAAAGAAGAAGGG - Intergenic
1004126505 6:12879219-12879241 ACAGTGGTGCAGACGGGGAAAGG + Intronic
1004737690 6:18424200-18424222 CCAGAGATACAGAAGAAGAGAGG + Intronic
1005503455 6:26450185-26450207 CAAGAGTTGGAGGAGGAGAAAGG - Intronic
1005609105 6:27506450-27506472 GCAGGGGTGCAGGATGAGAAGGG + Intergenic
1006796156 6:36733716-36733738 CCAGAGGCGCACAAGAAGACAGG + Intergenic
1007246729 6:40468673-40468695 ATAGAGGTGCTGAAGGAGCATGG + Intronic
1007364183 6:41378884-41378906 CCAGAGGCTCAGAAGGGGAAGGG + Intergenic
1007662183 6:43493609-43493631 TCAGAGATGCAGAAGAGGAAAGG - Intronic
1007787722 6:44290830-44290852 CCCCAGGAGAAGAAGGAGAAGGG - Intronic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1007930046 6:45682521-45682543 CCAGAAAGGAAGAAGGAGAAGGG - Intergenic
1008011945 6:46477171-46477193 CCAGAGTTGGAGAGAGAGAAGGG - Intronic
1008350713 6:50486870-50486892 CCAGAGGTTTAGAATGAGGAAGG + Intergenic
1010296270 6:74200387-74200409 CCAGAGGCTGAGAAGGATAAAGG - Intergenic
1011357732 6:86489837-86489859 CCAATGGTACACAAGGAGAAAGG + Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1013006805 6:106081483-106081505 CCAGAGGTCAGGAAGCAGAAAGG - Intergenic
1014823783 6:126024373-126024395 CCAGAAGTGCAGATGCACAAAGG - Intronic
1016642856 6:146370241-146370263 ACAGAGGTGAAGAAAGAAAAGGG - Intronic
1017074862 6:150608331-150608353 CCTGAGGAACAGAAGGAGACTGG + Intronic
1017230382 6:152067385-152067407 CCTGAGGTGCTGAATGTGAATGG - Intronic
1018060938 6:160089174-160089196 CAGGAGGTGCAGATGGTGAATGG + Exonic
1018997406 6:168720380-168720402 CCAAAGGTGAAGCAGGAGCAGGG - Intergenic
1019811895 7:3171042-3171064 TCAGAGGGACAGAAGGAGCAAGG + Intronic
1019938416 7:4271082-4271104 CCATAGGTGCAGAACCAGGAGGG + Intergenic
1020138281 7:5598649-5598671 AAAGAGGGGCAAAAGGAGAAGGG - Intronic
1020324605 7:6964717-6964739 AGAGAGGTGGAGAAAGAGAAAGG - Intergenic
1020727256 7:11831715-11831737 CCAGATGTGAAGATGGGGAAAGG + Intronic
1021234635 7:18127445-18127467 CCAGAAGTACAGAGGGAGCAGGG - Intronic
1021280732 7:18714653-18714675 CAAGAGATGAAGAATGAGAAGGG - Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1022860571 7:34362667-34362689 CCAGGGCTGCAGCAGGAGAGAGG + Intergenic
1023198291 7:37665766-37665788 CCAGCAGGGCAGAAGGAAAAAGG - Intergenic
1024167058 7:46745889-46745911 CCAGAGGTGCTGTAGGATCAGGG - Intronic
1025200410 7:56958104-56958126 GCAGAGGGGCAGGAGGGGAAAGG - Intergenic
1025671533 7:63618828-63618850 GCAGAGGGGCAGGAGGGGAAAGG + Intergenic
1025911518 7:65832505-65832527 CCAGTGGAGCAGAAGGAAAGAGG + Intergenic
1026481688 7:70785080-70785102 CCGGAGGTGCAGCGGGAGCATGG - Intronic
1026879720 7:73900795-73900817 CCTGAGGAGCAGGAGAAGAAAGG - Intergenic
1027203712 7:76080435-76080457 CTAGTGGAGCAGAAGGAGAGAGG - Intergenic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028526003 7:91787388-91787410 CCAGAGGTCAAGCAGCAGAAAGG + Intronic
1028580571 7:92405218-92405240 ACAAAGGCGCAAAAGGAGAAAGG + Intergenic
1030093995 7:105881605-105881627 CCTGAGGTTCAGAAGGATCAAGG - Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031985029 7:128158637-128158659 CCAGAGGAGGAGATGGAGGATGG - Intergenic
1032383391 7:131505776-131505798 CCCGAGTTGCAGAAGAGGAAAGG - Intronic
1032471988 7:132185255-132185277 ACAGAGGTGCAGAAGCATTAAGG + Intronic
1032516001 7:132506754-132506776 CCAGAGGGAGAGCAGGAGAAGGG - Intronic
1032592268 7:133202707-133202729 CCATAGATGCAGAAGGAACAGGG + Intergenic
1033459417 7:141531909-141531931 CCAGAGGTTCAGGGGGAGAGAGG - Intergenic
1033890458 7:146006492-146006514 GAAGAGGAGCAGGAGGAGAAAGG - Intergenic
1034278745 7:149837307-149837329 GCAGAGGGGCAGAAGGGCAAAGG + Intergenic
1035123577 7:156590618-156590640 CCAAATCTGCAGCAGGAGAAGGG + Intergenic
1035977054 8:4324374-4324396 CCAGAGGTGGGGCAGGAGCAAGG + Intronic
1036371461 8:8166224-8166246 AGAGAGGTGGAGAAAGAGAAAGG + Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1041812088 8:61922761-61922783 CCATAGATTCATAAGGAGAATGG + Intergenic
1042041958 8:64601411-64601433 CCAGAGGTACTGAGGGATAAAGG - Intronic
1043022569 8:75022481-75022503 CCAGAGGCTGAGCAGGAGAATGG + Intronic
1044368387 8:91377540-91377562 CCATAGGTGCAGAATTAGTATGG + Intronic
1044919660 8:97155584-97155606 CCAAAGGTGGAGGTGGAGAAAGG - Intergenic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045318276 8:101061923-101061945 CCAGAGTTCCAGGAGGTGAATGG + Intergenic
1046800222 8:118418376-118418398 CCAGAGGTGATAAAGAAGAAGGG + Intronic
1046905327 8:119566215-119566237 CCAGAGGGGCAGAATGGAAATGG + Intronic
1047446893 8:124927746-124927768 CCAGAGGAGCAGCCTGAGAAGGG + Intergenic
1048261103 8:132945736-132945758 CCAGAGGGGGAGAAGGAGATGGG + Intronic
1048955401 8:139531924-139531946 ACTAAGGTGGAGAAGGAGAAAGG + Intergenic
1049285588 8:141773378-141773400 CCACAGGTGCAGAGGGAGAAGGG + Intergenic
1050010823 9:1184411-1184433 TCTGAGGTGCAGAGAGAGAAGGG - Intergenic
1050023574 9:1310116-1310138 CCTGAGGGGCAGAAAGAGACTGG - Intergenic
1051003820 9:12317649-12317671 CCAGTGGTCCAGAAGCAGCATGG + Intergenic
1051742347 9:20263968-20263990 TCAGAGGTGCAGAGCAAGAAAGG - Intergenic
1053238920 9:36480427-36480449 TCCAAGGTGCAGAAGCAGAATGG + Intronic
1053416996 9:37953112-37953134 CCAGAGGCCCAGAAGGAGAGTGG + Intronic
1053529174 9:38861427-38861449 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054201399 9:62085856-62085878 TGAGAGTTCCAGAAGGAGAAGGG + Intergenic
1054636960 9:67502504-67502526 TGAGAGTTCCAGAAGGAGAAGGG - Intergenic
1054797791 9:69318650-69318672 CCAGAGCAGGAGAAAGAGAAGGG + Intergenic
1055961249 9:81822329-81822351 CCAAAGGTGGAGGGGGAGAAGGG - Intergenic
1056543723 9:87595760-87595782 AAAGAGATGCAGAAAGAGAAGGG - Intronic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057893184 9:98884986-98885008 CCAGAGGGGTAGGAGGAGCATGG - Intergenic
1058058973 9:100474901-100474923 CCAGAGGCGCACAAGGATTATGG + Intronic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1061497155 9:130981630-130981652 CCTGGGGTGCAGCAGGGGAAGGG - Intergenic
1062479697 9:136745596-136745618 CCATAGGTGCAGAGGGCGAGGGG - Intronic
1203773176 EBV:59578-59600 TCTGAGGAGGAGAAGGAGAATGG + Intergenic
1185513660 X:681852-681874 CAAGAGAGGTAGAAGGAGAAAGG + Intergenic
1185785835 X:2890264-2890286 CAAGTGGTGCAGGAGGAGAAGGG - Intergenic
1186240716 X:7562574-7562596 CGAAATGTGCAAAAGGAGAATGG + Intergenic
1186376122 X:9003497-9003519 GCAGAGAAGCAGAAGGAGACAGG + Intergenic
1187102408 X:16207618-16207640 GAAGAGGTGGAGAAGGTGAAAGG + Intergenic
1187709716 X:22040991-22041013 CAAGAGATGGAGAGGGAGAATGG + Intronic
1187836849 X:23439775-23439797 CAAGAGGTGCAGAGAGAGATAGG + Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1189698735 X:43694261-43694283 CCCGAGGTGGAGTAGGGGAAGGG - Intronic
1189797074 X:44655257-44655279 CCAGAGGGGAAGATGGAGACAGG + Intergenic
1189845587 X:45133465-45133487 CCAGAGGTGGAGAAGGGTAGTGG - Intergenic
1189884825 X:45531673-45531695 GAAGAGGTGGAGGAGGAGAAAGG - Intergenic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190482258 X:50889400-50889422 CCAGAGGTGCAGCTGCAGCATGG + Intergenic
1190517343 X:51237289-51237311 TTAGAGTTCCAGAAGGAGAAGGG + Intergenic
1190703266 X:53004140-53004162 CCAGCGGTGCAGAAAGAGATGGG - Intergenic
1193894254 X:87092379-87092401 CCAGAGGTGAAGATTGAGAGAGG - Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196195634 X:112836004-112836026 CAAGAAGTGCAGCAGCAGAATGG - Intronic
1196234930 X:113268381-113268403 CCAGTGGTTCAGGAAGAGAAAGG - Intergenic
1197098346 X:122621950-122621972 CCAGAAGTGTTGAAGGGGAAGGG + Intergenic
1197239796 X:124111142-124111164 CAAGAGGTGGAATAGGAGAAAGG + Intronic
1197393657 X:125898733-125898755 CCAGAGGTCCAAAGTGAGAAGGG + Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1199349969 X:146788650-146788672 CCAAAGGTGAAGAAGAAGCAAGG - Intergenic
1199686783 X:150272187-150272209 CCAGACATGGAGAAGCAGAATGG + Intergenic
1199712306 X:150477987-150478009 TCAGTGGTGCAGAAGAAGGACGG - Intronic
1199904203 X:152207722-152207744 AGAGTGGTGCAGAAGGTGAAGGG - Intronic
1200088723 X:153624548-153624570 CCAAAGGGGGTGAAGGAGAAGGG - Intergenic
1200338289 X:155375320-155375342 CCAGAGGAACTGAAGAAGAAGGG - Intergenic
1200348180 X:155465372-155465394 CCAGAGGAACTGAAGAAGAAGGG + Intergenic
1200872750 Y:8121178-8121200 CCAGTGGGGAACAAGGAGAATGG + Intergenic
1201288020 Y:12395545-12395567 CAAATGGTGCAGGAGGAGAAGGG + Intergenic
1201460516 Y:14217644-14217666 CAAAATGTGCAAAAGGAGAATGG + Intergenic
1201772866 Y:17634432-17634454 CGAGAGGTGAGGCAGGAGAATGG - Intergenic
1201828689 Y:18271554-18271576 CGAGAGGTGAGGCAGGAGAATGG + Intergenic
1201857715 Y:18563909-18563931 GCAGAGGTGCAGAGGAAGGAGGG + Intronic
1201875606 Y:18756472-18756494 GCAGAGGTGCAGAGGAAGGAGGG - Intronic