ID: 1183816735

View in Genome Browser
Species Human (GRCh38)
Location 22:40308118-40308140
Sequence AGGGTATCTTGGGGGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183816735_1183816743 13 Left 1183816735 22:40308118-40308140 CCTTTCCTCCCCCAAGATACCCT 0: 1
1: 0
2: 7
3: 37
4: 343
Right 1183816743 22:40308154-40308176 TTGCTGCTGTTGCGCTACATTGG 0: 1
1: 0
2: 0
3: 13
4: 202
1183816735_1183816744 17 Left 1183816735 22:40308118-40308140 CCTTTCCTCCCCCAAGATACCCT 0: 1
1: 0
2: 7
3: 37
4: 343
Right 1183816744 22:40308158-40308180 TGCTGTTGCGCTACATTGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183816735 Original CRISPR AGGGTATCTTGGGGGAGGAA AGG (reversed) Intronic
900493291 1:2963730-2963752 GTGGTATATTGGGGGAAGAAGGG + Intergenic
902453304 1:16513298-16513320 AGGGCTTCTTGGGGGTGGGAAGG + Intergenic
902473356 1:16665972-16665994 AGGGCTTCTTGGGGGTGGGAAGG + Intergenic
902485447 1:16741470-16741492 AGGGCTTCTTGGGGGTGGGAAGG - Intronic
902776211 1:18676510-18676532 AGGGGAAGTTGGGGGAGGAGAGG + Intronic
902780513 1:18701879-18701901 AGGGGGCCTTGGGAGAGGAAAGG + Intronic
903115418 1:21175880-21175902 AGGGTACCTTAGGGGAGGAGGGG + Intronic
904466722 1:30712451-30712473 AGGGCATGTTGGGGGCGGGAGGG + Exonic
904494808 1:30880558-30880580 AGGGTGTGCAGGGGGAGGAACGG + Intronic
904603510 1:31686259-31686281 AGGGTAACTTCGGGGAGGCAGGG - Exonic
904817956 1:33219906-33219928 AGGGTATCTAGGGGGAGTTGGGG - Intergenic
904929456 1:34074825-34074847 AGGGTGTCCTGGGCAAGGAAGGG + Intronic
905441025 1:37996691-37996713 AGGGTATAATGGGGAAGGAAGGG - Intergenic
905931019 1:41787857-41787879 AGGGAATTTTAGGTGAGGAATGG + Intronic
908680232 1:66652629-66652651 AGGCTAATTTGGGGGTGGAAGGG - Intronic
910677781 1:89832094-89832116 TGGGTATCTTGGTGCAGGACAGG + Intronic
912897414 1:113607305-113607327 AGAGTGCCTTGAGGGAGGAATGG + Intronic
913251267 1:116913446-116913468 AGGAAATAATGGGGGAGGAAAGG + Intronic
915343371 1:155188129-155188151 AGGGGAGCATGGGGAAGGAAAGG + Intronic
915615380 1:157033840-157033862 AAGGTTTCCTGGTGGAGGAAAGG - Intronic
915678029 1:157549899-157549921 GGGGTATGTTGGGGGCAGAAGGG + Intronic
916196086 1:162224711-162224733 AGAGTAACTTAGGGCAGGAAAGG + Intronic
916383937 1:164245865-164245887 AGAGTAACTTGGGAGAGGAGGGG + Intergenic
917794396 1:178522135-178522157 AGGGTGTCTTGGGTGATGCAGGG + Intronic
920079738 1:203364209-203364231 AGGGTCTCTGGAGGGAGGACAGG - Intergenic
920963775 1:210685745-210685767 AGGGCCTCTTGGAGGAGGTAGGG - Intronic
921790716 1:219287319-219287341 AGGGTAGCTTGGGGTAGCAATGG - Intergenic
923201046 1:231711867-231711889 TGGGTATCTTTGGGGAGGGATGG - Intronic
923526974 1:234780180-234780202 AGGTTATTTGGGGGGAAGAAAGG - Intergenic
924083784 1:240427028-240427050 AGGGTATCTTGGGCCTGGCACGG - Intronic
924477846 1:244397050-244397072 GTGGTATCTTGTGGAAGGAAAGG + Intergenic
924894003 1:248316571-248316593 AGAGCACCTGGGGGGAGGAAAGG - Intergenic
1063997122 10:11630078-11630100 AGGGCCTGTTGGGGGAGGGATGG + Intergenic
1064261288 10:13788376-13788398 GTGGTTTCTTTGGGGAGGAACGG - Intronic
1066745297 10:38601360-38601382 AGAGTATCTTGGGGGAGGCAGGG + Intergenic
1067154686 10:43768760-43768782 AGGGTAGGATGGGGAAGGAATGG - Intergenic
1067972678 10:50991038-50991060 AGGGGGTCTCAGGGGAGGAAGGG + Intergenic
1069543275 10:69311615-69311637 ATTGTATCCTGGAGGAGGAAGGG - Intronic
1070313695 10:75292127-75292149 AGGGGACCATGGGGGAGGAGAGG + Intergenic
1070536454 10:77381779-77381801 AGAGTATCTGTGGGGAAGAAGGG - Intronic
1070666942 10:78351623-78351645 TGTGTATCTTGGAGGAGGAAAGG + Intergenic
1071145169 10:82561196-82561218 AATGCCTCTTGGGGGAGGAAGGG + Intronic
1071566158 10:86672420-86672442 AGGGTCTCTGGGGAGAGGAAGGG + Intronic
1074123123 10:110508035-110508057 AAGGGATGTTGGAGGAGGAAAGG + Intronic
1075476369 10:122738267-122738289 TGTATATGTTGGGGGAGGAAAGG - Intergenic
1078987870 11:16612729-16612751 AGGGTGACGTGGGGGAGAAATGG - Intronic
1079925530 11:26487803-26487825 AGGGTATCTGGTGGAAGAAACGG + Intronic
1080953964 11:37071097-37071119 GGGGGGTCTTGGGGGAAGAAGGG - Intergenic
1081596681 11:44464108-44464130 GGGACATCTTGGTGGAGGAATGG - Intergenic
1082803973 11:57435239-57435261 AGGGAATCTGGAGGGTGGAAGGG - Intergenic
1082990581 11:59204560-59204582 AGGGTATCATGATGCAGGAAGGG + Intronic
1083677581 11:64335154-64335176 AGGGAATCTGTGGGGAGGAGGGG - Intergenic
1083945270 11:65919710-65919732 AGGGGGTGCTGGGGGAGGAAGGG - Intronic
1083990793 11:66244595-66244617 AGGAGAGCTTGGGGGAGGTATGG - Exonic
1084605861 11:70171231-70171253 AAGGCATCTTGGGAGGGGAAGGG - Intronic
1084962725 11:72725826-72725848 AAGGCTTCTTGGAGGAGGAAGGG - Intronic
1085400814 11:76234494-76234516 AGGGTGTGTGGGGGGTGGAAAGG + Intergenic
1086286898 11:85261559-85261581 ATTGGATCTTGCGGGAGGAAGGG + Intronic
1088592366 11:111414780-111414802 TGGGGATCTTGGGAGAAGAAAGG - Intronic
1089067826 11:115675321-115675343 CGGGTAACTTGGTGGTGGAATGG - Intergenic
1090653308 11:128824829-128824851 AGGGAATGTTGGGGGACGCAGGG + Intergenic
1090770053 11:129912078-129912100 AGGGTACCTGGGCGGAGGACGGG + Exonic
1091399520 12:173705-173727 AGGGGAGCTTGCGGGTGGAACGG + Intronic
1092160291 12:6312045-6312067 AGGGTATAGTGGGGGAGGAGAGG - Intronic
1092301763 12:7257341-7257363 AGGGTGGGTTGGGGGATGAAAGG + Intergenic
1092863263 12:12737870-12737892 TCGTTATCTAGGGGGAGGAAGGG + Intronic
1093964349 12:25309535-25309557 AGGTTTCCTTGGGGGAGGATGGG - Intergenic
1095968140 12:47883092-47883114 AGGGTGTCAGGAGGGAGGAAGGG + Intronic
1096223577 12:49848771-49848793 AACGTATCTTGGGAGAGAAATGG - Intergenic
1097185828 12:57195848-57195870 CGGGTACTCTGGGGGAGGAATGG - Exonic
1097263638 12:57733806-57733828 AGGGGATCTCCAGGGAGGAAAGG - Intronic
1098971699 12:76863876-76863898 AGGTGCTTTTGGGGGAGGAAAGG - Intronic
1099568533 12:84283478-84283500 AGTCTAACTTGGGGGAAGAATGG + Intergenic
1099568617 12:84284570-84284592 AGTGTATATTTGGGGAGCAAGGG + Intergenic
1099743197 12:86668458-86668480 AAGGTAACTTGGGAGAGGGATGG + Intronic
1101773338 12:107771831-107771853 AGGGTGGCATTGGGGAGGAAGGG - Intergenic
1102054010 12:109882607-109882629 GGAGTATATTGGGGCAGGAAGGG + Intergenic
1102321732 12:111941875-111941897 ATAGCATCTTGGGGGTGGAAGGG + Intronic
1102484922 12:113249060-113249082 AGAGAATCTTGGGGCAGGAGGGG - Intronic
1102698377 12:114817698-114817720 AGAGCAGCGTGGGGGAGGAAAGG - Intergenic
1102980351 12:117236392-117236414 ACATTATTTTGGGGGAGGAAAGG + Intronic
1103505559 12:121440647-121440669 AGGGGATCTGGGAGGAGGCAGGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104625942 12:130354749-130354771 AGGTTTTCTGGGGGGAGGGAAGG - Intronic
1105295408 13:19085075-19085097 AAGGAGTCTTGGAGGAGGAATGG - Intergenic
1107058139 13:36128945-36128967 AGTGTGTCTTGGGGGTGGAGTGG + Intronic
1108385661 13:49897063-49897085 AGAGTAACCTGGGGGAGAAATGG + Intergenic
1109041980 13:57350488-57350510 AGGTTATCTTGGGAGTAGAAAGG - Intergenic
1111624574 13:90768225-90768247 AGAAAATCTTGGGGGAGGTAGGG + Intergenic
1111848162 13:93538020-93538042 ATGGTATCTTGCAGGATGAAAGG + Intronic
1112442149 13:99432251-99432273 AGGCTAACTTGGGGGATGAGCGG + Intergenic
1112761594 13:102698658-102698680 AGGGGATCTTGGAGGATGAGGGG - Intergenic
1114872114 14:26671386-26671408 AGGATATCTTTGGAGAGAAATGG - Intergenic
1118765734 14:68908236-68908258 AAAGGATCTTGAGGGAGGAAAGG - Intronic
1121325742 14:93018669-93018691 TGGGGCTCTTGGGTGAGGAAGGG + Intronic
1121410685 14:93746426-93746448 CAGGTATCTGGGGGAAGGAATGG + Intronic
1121697744 14:95927605-95927627 AGGGGATCATGGGGGAGAGATGG - Intergenic
1121825849 14:97008756-97008778 AGGGCATCTTGGGGGTGCAGAGG - Intergenic
1122045461 14:99020089-99020111 AGGGAATCAGAGGGGAGGAAGGG + Intergenic
1122340261 14:101023434-101023456 ACGCTGTCTTCGGGGAGGAACGG + Intergenic
1122878452 14:104679352-104679374 TGGGCATCCTGGGGGAGGGAGGG + Intergenic
1122926998 14:104908642-104908664 ATGTTACCTTAGGGGAGGAATGG - Intergenic
1123115446 14:105892279-105892301 AGGGCAGCTTCGGGGAGGGAAGG - Intergenic
1123119696 14:105910997-105911019 AGGGCAGCTTTGGGGAGGGAAGG - Intergenic
1123564123 15:21524941-21524963 ATGGTATCATGGTGGAAGAATGG + Intergenic
1123600377 15:21962225-21962247 ATGGTATCATGGTGGAAGAATGG + Intergenic
1125387590 15:39154760-39154782 AGAGTAGCTTGGGTCAGGAAAGG - Intergenic
1126965926 15:54053777-54053799 AGGGTAGTTGGGGGTAGGAAAGG - Intronic
1127404386 15:58625975-58625997 AGGGTAGCAGGGGGGAGGAAGGG + Intronic
1128370886 15:67038397-67038419 AGTCTATCCTGGGGAAGGAAAGG - Intergenic
1128870430 15:71151233-71151255 AGGGGGACTTGGGGCAGGAAAGG - Intronic
1131113057 15:89777104-89777126 ACTGTATCTTGGGGCAGTAAGGG - Exonic
1131654653 15:94443552-94443574 TGGGTATCTGGGGCGAGGGATGG + Intronic
1132185448 15:99798793-99798815 AGGGGACCCTGGGGGAGGTAGGG + Intergenic
1132258436 15:100399480-100399502 AGCGTTTTTTGGGGGAGGAGTGG + Intergenic
1132477493 16:148492-148514 AGGTTACCTTTGGGGAGGATTGG + Intergenic
1132709221 16:1259037-1259059 TGGGTGTCACGGGGGAGGAAGGG + Intergenic
1134267594 16:12705237-12705259 AAGGTATCCTGGGGAAGGATGGG - Intronic
1134649691 16:15898725-15898747 AATGTATCTTGGGGGGTGAAAGG + Intergenic
1134810272 16:17161281-17161303 ATGACATCTTGGGGGAGGGAGGG + Intronic
1135185833 16:20315052-20315074 AGGGTAACTTGGTGGAGGTTAGG - Intronic
1135244890 16:20847026-20847048 AGTGTATATTGGGGAAGGGAGGG + Intronic
1135299847 16:21316477-21316499 GGGGTAGCTTGGGGTAGGTAAGG + Intergenic
1135905281 16:26506472-26506494 AAGGTATCTTGAGGGCAGAAGGG + Intergenic
1136380103 16:29889539-29889561 AGGGCACCTTGGTGGAAGAAAGG - Intronic
1136737770 16:32478289-32478311 AGAGTATCTTGGGGGAGGCAGGG - Intergenic
1138744463 16:59347473-59347495 TGTGAATCTTGGGAGAGGAATGG + Intergenic
1140121015 16:72082955-72082977 AGGAGATCTTCGGGAAGGAAGGG - Intronic
1140817084 16:78631261-78631283 GGAGAATCTTGGGTGAGGAAGGG - Intronic
1141643921 16:85357357-85357379 AGGCCATCGTCGGGGAGGAATGG + Intergenic
1141696853 16:85624266-85624288 AGGGCCTCTGGAGGGAGGAAGGG + Intronic
1142218333 16:88840876-88840898 AGGGTGTCTTGGGTGGGAAACGG - Intronic
1203015303 16_KI270728v1_random:351288-351310 AGAGTATCTTGGGGGAGGCAGGG + Intergenic
1203033638 16_KI270728v1_random:624446-624468 AGAGTATCTTGGGGGAGGCAGGG + Intergenic
1142954647 17:3513383-3513405 TGGATATCCTGGGGGAGGAGGGG - Exonic
1143432625 17:6898361-6898383 AGGAGAGCTTGGGGGAGGAATGG - Intronic
1143846610 17:9776836-9776858 AGGGCATCTTTGTGGAGGAAGGG + Intronic
1144445748 17:15326488-15326510 AGGGAAACTTGGGGAAGGAAAGG + Intronic
1144584772 17:16481611-16481633 AGGCCATCATGGGGGAGGCAGGG - Intronic
1145023865 17:19453230-19453252 AGGGGATCCTGGGTGAGGATGGG - Intergenic
1145251539 17:21299370-21299392 AGGGTTTCTGTTGGGAGGAACGG - Intronic
1146212638 17:30954259-30954281 AGGGTATGGTGGGGTTGGAAGGG + Intronic
1146516482 17:33493721-33493743 ATGCTATCTTGGGGGAAGGATGG - Intronic
1146902489 17:36597786-36597808 AGGGTATTTGGGGGAAGAAATGG + Intronic
1147182885 17:38697919-38697941 AGTGTTTGGTGGGGGAGGAAGGG - Intergenic
1147250460 17:39150244-39150266 AGAGTATGTTGGGGGTGGGAGGG - Intronic
1147390636 17:40107066-40107088 GCGGTATCTTGGGGGAGGGGGGG + Intergenic
1147923743 17:43934152-43934174 AGGGTATGGGGAGGGAGGAAAGG - Intergenic
1149301896 17:55312979-55313001 AAGGTATCTTTGGGGAGAAACGG + Intronic
1149560468 17:57604704-57604726 AGGGGATTCTGGGGAAGGAAGGG + Intronic
1149981213 17:61312864-61312886 AGGCCATCTTGTGGGAGAAAGGG - Intronic
1150584005 17:66501271-66501293 AGGGAATCTTGGCAGAGAAAAGG + Intronic
1151386733 17:73759620-73759642 ATGGTATCTTGGCGGGGGAAGGG + Intergenic
1151767769 17:76140937-76140959 AGGGGATCATTGGGAAGGAAGGG + Intronic
1152410135 17:80118921-80118943 AGGGGGTCTTTGGGGAGGAGTGG + Intergenic
1153831849 18:8930701-8930723 GGGGTCTCCTGGGGTAGGAACGG + Intergenic
1156344843 18:36247490-36247512 AGGGGTTCTTGGGGAAGGGAAGG - Intronic
1157257659 18:46153073-46153095 AGGGAGTATTGGGGGAGGGAAGG - Intergenic
1158506048 18:58046034-58046056 AAGGTATTTTGGGGTGGGAAGGG + Intronic
1158839912 18:61374113-61374135 TGTGTATATTGGGGCAGGAAGGG + Intronic
1158970258 18:62659754-62659776 GTGGCATCTTGGGGGTGGAATGG + Intergenic
1160500989 18:79400932-79400954 AGGGTGACTGTGGGGAGGAAGGG - Intronic
1160920614 19:1518522-1518544 AGGGCATCTTGGGGCAGGGGCGG + Intergenic
1161107239 19:2450343-2450365 ATGGGGTCTTGGGGCAGGAAAGG + Intronic
1161763104 19:6188747-6188769 AGGGGATCTTTGGGGGTGAAGGG + Intronic
1162020760 19:7867379-7867401 AGGGTTCATTGGGGGAGGAAGGG + Intergenic
1162420377 19:10562728-10562750 AGGTTATCTTGGAGAAGGCAGGG - Exonic
1163045854 19:14641372-14641394 AGTGTACCTTGGGGCAGAAAGGG + Intronic
1165062489 19:33211641-33211663 TGGGGATGTTGGGGCAGGAAAGG + Intronic
1165927011 19:39333057-39333079 CAGGTATCCTGGGGGAAGAAAGG - Exonic
1166015770 19:39978261-39978283 AGGGAAGGTTGGGGTAGGAAGGG + Intronic
1166340573 19:42134490-42134512 AGGGGATCTTGAAGGAGGATGGG + Intronic
1166676905 19:44746441-44746463 AGGGTCTGTTGGAGGAGGTAAGG - Intergenic
1166761187 19:45225162-45225184 AGGGTATATTGGGGGAGGGAAGG + Intronic
1166862144 19:45816771-45816793 AGGGTACCTGGTGGGGGGAAGGG + Intronic
1167267042 19:48488415-48488437 GGGGTCTCTTGGGGGCAGAAGGG - Intronic
1167446212 19:49539104-49539126 AGGGTTTCCTGGAGGAGAAAGGG - Exonic
1167703404 19:51064790-51064812 AGGGTATTTTGGGAGGTGAAGGG + Intronic
1168395342 19:56042753-56042775 TGGGGATTTTGGGGGAAGAATGG - Intronic
1202705544 1_KI270713v1_random:21036-21058 AGGGCTTCTTGGGGGTGGGAAGG + Intergenic
925779537 2:7369719-7369741 AGGGTATCTGAGTGGAGTAAAGG + Intergenic
926751606 2:16202746-16202768 TGGCTATCTTGGGGGAGTAGGGG + Intergenic
927229948 2:20812079-20812101 AGGGAATTTAGTGGGAGGAAAGG + Intronic
927452750 2:23223038-23223060 AGGCTGACTTGGGGGAGGCAGGG + Intergenic
929967262 2:46544416-46544438 AGTGAATCTTGGAGGAGGAGGGG + Intronic
931431469 2:62212159-62212181 AGGGGACCTTGTAGGAGGAAGGG + Intronic
932312657 2:70756169-70756191 GCTGTATGTTGGGGGAGGAAAGG - Intronic
932594020 2:73083163-73083185 AGTGTGGCTTGGGGTAGGAAGGG + Intronic
933808271 2:86015745-86015767 AGGGTTTTTTGGGGGTGGATGGG + Intergenic
934188892 2:89767402-89767424 AGATTATCTTGGGGGAGGCAGGG - Intergenic
934307699 2:91840551-91840573 AGAGTATCTTGGGGGAGGCAGGG + Intergenic
934521181 2:95021142-95021164 AGGGAAGCTTGTGGGAGGAAGGG - Intergenic
936633985 2:114234677-114234699 AGGGGTTCTTGGGGAAGGGAAGG - Intergenic
936982491 2:118277243-118277265 AGGCTAGCCTCGGGGAGGAATGG - Intergenic
938644122 2:133314125-133314147 AGGATAGCTTTGGGGAGTAATGG - Intronic
938809843 2:134843131-134843153 GAGGTGTGTTGGGGGAGGAATGG - Intronic
939500832 2:142981683-142981705 ACTGTATTTTGAGGGAGGAAGGG - Intronic
941665207 2:168237863-168237885 GGGGTTTCCTGGGGAAGGAATGG - Intronic
941870949 2:170385105-170385127 AGGGTGTATGGGGGGAGGAAGGG + Intronic
942050374 2:172134533-172134555 TGGGTGTCTTGGGGCAGGTAGGG + Intergenic
942229362 2:173845503-173845525 AGGGTGTCTTGGAGAAAGAAAGG - Intergenic
944357100 2:198803532-198803554 AGGGTACATTGGGTGTGGAAAGG + Intergenic
944889468 2:204102374-204102396 AGACTATTTTAGGGGAGGAAGGG + Intergenic
944898268 2:204188068-204188090 AGTGTTTCTTGGGTGAGGAGGGG + Intergenic
946358749 2:219206563-219206585 CGGATATCTTGGGGGATGGAAGG - Intronic
946561778 2:220922002-220922024 ATGGGATCTTGGTGGATGAACGG + Intergenic
947445219 2:230157915-230157937 GGGATATTTTGGGGGAAGAAAGG + Intergenic
947526647 2:230880822-230880844 AGGTAATCTTGGAGGAGGAAAGG + Intergenic
948351971 2:237348192-237348214 AGAGTATTTTAGGGAAGGAAGGG + Intronic
948734354 2:239990590-239990612 AGTGGATCTTGGGGCAGGAACGG + Intronic
949026215 2:241767635-241767657 AGGGGCTGTTGGGGGAGGAGTGG + Intronic
949028787 2:241778520-241778542 CAGGTATCTTTGGGGAGGAGGGG + Intronic
1170478100 20:16736718-16736740 AGGGTAGGTTTGGAGAGGAAAGG + Intronic
1171013449 20:21521223-21521245 AGTGGCTCTTGGGGGTGGAAAGG - Intergenic
1172181222 20:33004699-33004721 TGGGAAGCTTGGGGCAGGAAGGG - Intergenic
1172834770 20:37866094-37866116 AGGGTATTTGGAGGCAGGAAAGG + Intronic
1175337685 20:58206799-58206821 AGGGTTTCTTGGGAGAGGGCTGG + Intergenic
1179305732 21:40152550-40152572 AGGGCATCTGGGAGGATGAAAGG - Intronic
1180534779 22:16387633-16387655 AGAGTGTCCTGGGGGAGGCAGGG + Intergenic
1181393673 22:22602678-22602700 AGGGCCTCCTGAGGGAGGAATGG + Intergenic
1181916349 22:26283806-26283828 AGAATATTATGGGGGAGGAAAGG + Intronic
1182082593 22:27539751-27539773 AGAGTCCCTTGGGGGTGGAATGG + Intergenic
1182410475 22:30180986-30181008 AGGGTAGGTTAGGGGAGGAGAGG - Intergenic
1182454918 22:30444098-30444120 AGGTTATTTTCGGGGAGGGAAGG + Intergenic
1182459684 22:30475003-30475025 AGGGTGTCTTGGGGCCAGAAGGG + Intergenic
1182702914 22:32255125-32255147 GGGGTATCTTAAGGGGGGAAGGG - Intronic
1182768156 22:32773807-32773829 AGGGTACTATGGGGGAGGAAAGG + Intronic
1183068715 22:35381360-35381382 AGGGTAGTTGGAGGGAGGAACGG + Intronic
1183289468 22:36990776-36990798 CGTGTCTCGTGGGGGAGGAATGG + Intergenic
1183816735 22:40308118-40308140 AGGGTATCTTGGGGGAGGAAAGG - Intronic
1185171699 22:49298102-49298124 AGGGTGTCTGGGGAGAGGGAAGG + Intergenic
949371051 3:3335141-3335163 AAGGTATCTTGGAGGGAGAAGGG + Intergenic
950013078 3:9737183-9737205 AAGGCATTTTGGGGGTGGAAGGG - Intronic
951075604 3:18387783-18387805 AAGGTATATTGGGGGAAGGAAGG + Intronic
952312041 3:32199147-32199169 AGGGTTTGGTGGGGAAGGAAAGG - Intergenic
952692146 3:36221775-36221797 AGGGTAACATGGGGCAGGGATGG - Intergenic
952961895 3:38597569-38597591 AGGACATCTTGGAGGAGGGAGGG - Intronic
953313433 3:41903057-41903079 ATGGTGTCTTGAGTGAGGAAGGG + Intronic
954156418 3:48687335-48687357 AGGGCTTCTGGGAGGAGGAAGGG - Intergenic
954936515 3:54331925-54331947 AGGGTAGATTGAGGGAGGGAGGG - Intronic
955485460 3:59430303-59430325 GGGGAGTCTTGGGGGTGGAAGGG + Intergenic
956019955 3:64923616-64923638 TGGGTAACTTTGGGAAGGAAGGG + Intergenic
957507714 3:81145756-81145778 AGGCAGTGTTGGGGGAGGAAGGG + Intergenic
959746206 3:109778671-109778693 AGGTTTCCTTGGGGAAGGAAGGG + Intergenic
960442461 3:117705937-117705959 ATGGTATCTTAGAGGAGGTAAGG + Intergenic
961656238 3:128443696-128443718 AGGGTATGTTGGGGGACGGTTGG - Intergenic
962614243 3:137108993-137109015 AGGGGTTCGTGGGGGAGAAAGGG - Intergenic
963316767 3:143767225-143767247 AGGGTGTCTTTGGGCAGGACCGG + Intronic
963778231 3:149461808-149461830 GGGGTGAGTTGGGGGAGGAAGGG - Intergenic
964977396 3:162637201-162637223 AGGTCATCTTGGGGAAGGATGGG + Intergenic
966026292 3:175286967-175286989 AGGGTATGGTGGGGGTGGAGGGG + Intronic
967136816 3:186519550-186519572 AGCTTAGCTTGGGGGAGCAAAGG + Intergenic
967772400 3:193348565-193348587 AGGGTTTCTTGGCTTAGGAAAGG + Intronic
967938309 3:194746978-194747000 TGGGTATCTGGGGGCAGGGAGGG + Intergenic
968539138 4:1154195-1154217 TGGGTATGTTGGGGGAGGCTGGG + Intergenic
968803437 4:2757338-2757360 TGGGAATTTTGGGGAAGGAAAGG - Intergenic
968955250 4:3715772-3715794 AGGGTTTATTTGGGGAGGGAAGG + Intergenic
969879901 4:10164203-10164225 AGGGTAGCTTGGGTCAGGCAAGG + Intergenic
971478798 4:27096109-27096131 AGGGGAGCTTGCGGAAGGAAAGG - Intergenic
973959495 4:56095630-56095652 AGAGTAAGTTGGGGGAGGAGTGG + Intergenic
976505264 4:85838798-85838820 AAGTTAGCTTGGGGGAGGGAGGG - Intronic
977713190 4:100150592-100150614 AAGGAATCTTGAGAGAGGAAAGG - Intergenic
978595452 4:110372843-110372865 AAGGTATCTGGGAGAAGGAAAGG + Intronic
978619293 4:110622787-110622809 AGGGGTTCTTGGGGGAGGGAGGG - Exonic
979246574 4:118513407-118513429 TTGGTATCCTGGGGGAGTAAGGG + Intergenic
979269787 4:118746215-118746237 AGGGGAGGTTGGGGGAGGGAGGG + Intronic
979766814 4:124473167-124473189 AAGGTATCCTGGGGGAAGGATGG - Intergenic
984203083 4:176751774-176751796 TGGTTAACTTGGTGGAGGAAGGG + Intronic
986547098 5:8909696-8909718 AGGATATTTTGGGGAAAGAAAGG + Intergenic
986683130 5:10251246-10251268 ACGTTATCTTTGGGGAAGAAGGG + Intronic
987330476 5:16852791-16852813 AGGGAATTTGGGGGCAGGAAAGG - Intronic
989263523 5:39446268-39446290 AGGGTATCCCAGGTGAGGAAAGG - Intronic
990760626 5:59125601-59125623 GGGATATCTTGGGGGACAAAAGG + Intronic
990931339 5:61095365-61095387 AGAGTTCCTTGGGGGAGGGAAGG - Intronic
991634456 5:68690190-68690212 TGGGCACCTTGGGGGTGGAATGG - Intergenic
992174985 5:74141150-74141172 AGGGTATCTAATGGGAGGGAAGG + Intergenic
992691118 5:79240698-79240720 AGATTATATTGGGGGAGGGAGGG + Intronic
993045197 5:82858522-82858544 AGGGTATTGATGGGGAGGAAGGG + Intergenic
994239257 5:97401285-97401307 AGAGTAACTTGGGGGAAAAAAGG - Intergenic
994874830 5:105406227-105406249 AGGGTTCCTTGGGGGAGAAATGG - Intergenic
995733612 5:115273453-115273475 AGGGCATGTTGGAGGAGGAAAGG - Intronic
996369314 5:122736373-122736395 AGGGAATGATGGGGGAGGTAAGG + Intergenic
996965215 5:129299918-129299940 AGGGTCTGTTGGGGGGTGAAGGG - Intergenic
998088825 5:139349185-139349207 TGGGTATATTGGAGAAGGAAAGG + Intronic
998392082 5:141793646-141793668 GGGGGATCTTGGGGGAGAAGGGG - Intergenic
998416005 5:141946499-141946521 GGAGTATCCAGGGGGAGGAAGGG - Intronic
999235016 5:150085442-150085464 AAGGGACCTTGGGGGAGGATGGG - Intronic
999774711 5:154803115-154803137 AAGGTAACTGGGGTGAGGAATGG + Intronic
1000326383 5:160175663-160175685 AGGGTCGATTGGGGGAGGAAGGG - Intergenic
1001421426 5:171590076-171590098 TGGGGATCTTTGGGTAGGAATGG + Intergenic
1001839166 5:174858998-174859020 AGGGTATGTTGGGGGGTGAGGGG - Intergenic
1002175406 5:177398724-177398746 ATGGTATCTTGGAGGAAGGAAGG - Exonic
1002441582 5:179267131-179267153 AGGGGATCCTGGGGGAAGAGTGG - Intronic
1002720702 5:181259966-181259988 AGGGAATGTGGGGGGATGAAGGG - Intronic
1003513982 6:6803504-6803526 AGGGCATCTTGGGCAAGGCAAGG - Intergenic
1005197351 6:23303148-23303170 TGGGTATCTTTGGGAAGGAGAGG + Intergenic
1005307189 6:24525192-24525214 AGATTATATTTGGGGAGGAAGGG + Intronic
1005985686 6:30873142-30873164 AGGATAGTTTGGGGGAAGAAGGG - Intergenic
1007196617 6:40066908-40066930 TGGGTACCTGGGGGGAGGCAGGG - Intergenic
1007395498 6:41575542-41575564 AGGGGGTGTAGGGGGAGGAAGGG + Intronic
1007865782 6:44968661-44968683 AGGATAGGTTGGGAGAGGAAAGG - Intronic
1007944113 6:45810131-45810153 AGGGTATATTGTGGTAGGATGGG - Intergenic
1008909493 6:56717802-56717824 AGGATAGCTTGGGGGAAGAGAGG - Intronic
1008938521 6:57019618-57019640 AGGGACTCTTGGGGGAGGATGGG - Intronic
1009403022 6:63278387-63278409 AGGGTAGCTGGGGGAAGGAAGGG - Intronic
1009461576 6:63920283-63920305 AGGAGATCTTAGGGGAGGAATGG - Intronic
1010393761 6:75367139-75367161 AGTGTATTTCGGGGGAGGAAAGG - Intronic
1010928604 6:81773291-81773313 AGGAAATGTTGAGGGAGGAAAGG - Intergenic
1011523998 6:88242973-88242995 AAGGAATGTTGGGGGAGGTATGG + Intergenic
1014479712 6:121920861-121920883 ATGGAATCCTGGGGTAGGAAAGG - Intergenic
1016731553 6:147433074-147433096 AGGGTGGGTTGGGAGAGGAAGGG - Intergenic
1017460780 6:154647582-154647604 AGGGGAACTTGTGGGAGTAATGG + Intergenic
1018628916 6:165805501-165805523 AGGGGCTCTTGGTGGAGAAAGGG - Intronic
1020168099 7:5823653-5823675 TGGGTCTCTAGGGGGAAGAAGGG + Intergenic
1021276998 7:18663828-18663850 AGGGGAGCTTGTGGGAAGAAGGG - Intronic
1024353131 7:48387882-48387904 TGGGTTTCTTGGTGGAGAAAAGG + Exonic
1024559420 7:50630779-50630801 AGAGTTAGTTGGGGGAGGAATGG + Intronic
1025923979 7:65941584-65941606 TGGTTATTCTGGGGGAGGAAGGG + Intronic
1026438883 7:70425406-70425428 TGTGTATCCTGGGGAAGGAAAGG - Intronic
1026577839 7:71588888-71588910 AGGGTAATTTGGGGGAGGGAGGG - Intronic
1027249470 7:76389990-76390012 AGGGCTTCCTGGAGGAGGAAGGG + Exonic
1027519549 7:79188279-79188301 AGGGTCTGTTGGGGGAGGCGGGG - Intronic
1028576242 7:92355073-92355095 AGGGTATCCTGTGGTGGGAAGGG - Intronic
1029248102 7:99217174-99217196 AGGTTAACTTGGTGGAGGAGTGG - Intergenic
1029356796 7:100058029-100058051 AGCCTTACTTGGGGGAGGAAAGG - Intronic
1029479618 7:100804661-100804683 AGGAGATCTTGGGAGAGGAACGG + Intronic
1030644878 7:112048932-112048954 AAGATATTTTGGGGGAGGTAGGG - Intronic
1031679196 7:124650285-124650307 AAGATATATTGGGGGAGGAAAGG - Intergenic
1032134948 7:129267757-129267779 AGGGAATCTTGTGGGAGAGATGG + Intronic
1032965229 7:137089059-137089081 AGGGTATCTTGAAGGTCGAAAGG - Intergenic
1033667779 7:143459174-143459196 AGGATATCTGGATGGAGGAAGGG - Intergenic
1034702258 7:153106723-153106745 AGTCTATCATGGGGGAGGGAGGG + Intergenic
1035059416 7:156058110-156058132 AGGGCATATGTGGGGAGGAAGGG - Intergenic
1035072841 7:156157554-156157576 AGGGTGTCCTGGGGGAGGTCTGG + Intergenic
1035331323 7:158098995-158099017 GGGATGTGTTGGGGGAGGAAGGG - Intronic
1035331348 7:158099060-158099082 CCGGGATGTTGGGGGAGGAAGGG - Intronic
1035331462 7:158099333-158099355 CCGGGATGTTGGGGGAGGAAGGG - Intronic
1035331500 7:158099426-158099448 CCGGGATGTTGGGGGAGGAAGGG - Intronic
1035331538 7:158099519-158099541 CCGGGATGTTGGGGGAGGAAGGG - Intronic
1035331576 7:158099615-158099637 CCGGGATGTTGGGGGAGGAAGGG - Intronic
1036003322 8:4633097-4633119 AGGGGAGCCTGGGGCAGGAAAGG + Intronic
1037070432 8:14639884-14639906 AGAGTATCTTGCAGGAGGTAGGG - Intronic
1038869529 8:31479269-31479291 TGGGGATGGTGGGGGAGGAAGGG + Intergenic
1039778500 8:40760429-40760451 GGGGTATGTTTGGGGAGGGATGG - Intronic
1044428791 8:92084669-92084691 ATTCTATCTTTGGGGAGGAAGGG + Intronic
1044472155 8:92582621-92582643 AGGTTATCTGGGGAGAGGAAAGG + Intergenic
1044857993 8:96494956-96494978 AGGGGATACTGGGGGAGGCACGG + Intronic
1045655032 8:104377731-104377753 TGGCTACCTTGGGGAAGGAAGGG + Intronic
1046855024 8:119021520-119021542 AGGCTTTCTGGGGAGAGGAATGG + Intronic
1047778286 8:128091458-128091480 AGGACATGTTGGGGGAGGAGCGG - Intergenic
1048492919 8:134911527-134911549 AGAGTATCTTGAGGGAGGGAAGG - Intergenic
1048550880 8:135432824-135432846 AGGGTATCCTGGATGAGGCAGGG + Intergenic
1048698398 8:137055516-137055538 AGGGGATGTGGGGGCAGGAAAGG - Intergenic
1050189501 9:3010083-3010105 AGGGTTTACTGGGGGAAGAAAGG - Intergenic
1051307631 9:15731216-15731238 AGGGTGTGTTGGGGGAGGAAAGG - Intronic
1052346159 9:27411909-27411931 AGGGGAAATTGTGGGAGGAAGGG + Intronic
1052587464 9:30447959-30447981 AGAGTATCTTGGGGCAGGGAAGG - Intergenic
1055612271 9:78034899-78034921 AGGATCTCCTGGGGAAGGAAAGG + Intergenic
1055761841 9:79617227-79617249 AGGTTATCTTTCAGGAGGAAGGG + Intronic
1056625359 9:88248700-88248722 AGAGTAACTTGGGGAAGGCAGGG + Intergenic
1056692723 9:88822101-88822123 AGTGTCTCTTGGTGGAGGAAGGG + Intergenic
1056728993 9:89147792-89147814 AGGCTATCATCAGGGAGGAAGGG - Intronic
1056773156 9:89494291-89494313 AGTGTGTGTTGGGGGAGGAGAGG - Intronic
1057200996 9:93139970-93139992 CTGGGATCTTGGGAGAGGAAGGG - Intergenic
1057822326 9:98342239-98342261 ATGGCATATTGGGGGTGGAAAGG + Intronic
1057996731 9:99825806-99825828 AGGGTATCTTGCGCGCTGAATGG - Exonic
1058041168 9:100303538-100303560 AGTGTGTTTTGAGGGAGGAAAGG - Intronic
1058916544 9:109572156-109572178 AGGGCATCTTAGGCCAGGAACGG + Intergenic
1059322502 9:113480619-113480641 ACGGTATCCTGAAGGAGGAATGG + Intronic
1061739681 9:132692159-132692181 AGGGTGTCTGGGGGAAGGAAAGG - Exonic
1062407273 9:136403040-136403062 AGGGTTTCCAGGGGGAAGAATGG + Intronic
1062500804 9:136851223-136851245 AGGGCATCTTGGAGGAGGTCTGG + Intronic
1185612810 X:1402503-1402525 AAGCTGTATTGGGGGAGGAAGGG - Intergenic
1186998879 X:15154546-15154568 TGGGTTTCTTTGGGGAGTAATGG + Intergenic
1187392179 X:18893399-18893421 AGGGGATCTTGGGGGACAGAAGG + Exonic
1188156664 X:26749424-26749446 AGAGTATCTTGGGGGATCATGGG - Intergenic
1188844980 X:35061275-35061297 AGGGCAACTGGAGGGAGGAAAGG + Intergenic
1190118225 X:47639394-47639416 AGGGTGTCAGGGGGGAGGAGGGG + Intronic
1190269177 X:48849246-48849268 AGGGTCTCCGGGGAGAGGAAAGG - Intergenic
1190580933 X:51892977-51892999 TGTGTGTGTTGGGGGAGGAAAGG - Intronic
1194849448 X:98853596-98853618 AGGTCTCCTTGGGGGAGGAAGGG + Intergenic
1195691607 X:107630406-107630428 AGGCTATATTGGGAGAGGAGAGG + Intronic
1196194068 X:112822171-112822193 TGGGAATCTTAGGGAAGGAACGG - Intronic
1196707049 X:118726008-118726030 AGGGTACCTTTTGGGAGGGAAGG - Intergenic
1198437465 X:136631021-136631043 AGGGCATCCTGAGTGAGGAAAGG - Intergenic
1198533122 X:137564230-137564252 AGGGTTTCTTTGGGGGGGTAGGG - Intergenic
1198554411 X:137777433-137777455 AAGGTATCTTGGGCCAGGCATGG - Intergenic
1200104989 X:153707118-153707140 AGGGTTTCTGGGGGGAGGTGAGG - Intronic