ID: 1183816941

View in Genome Browser
Species Human (GRCh38)
Location 22:40310035-40310057
Sequence TGCACTTTGAATAAAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 436}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183816941_1183816942 -5 Left 1183816941 22:40310035-40310057 CCTAAAATTTTATTCAAAGTGCA 0: 1
1: 0
2: 4
3: 38
4: 436
Right 1183816942 22:40310053-40310075 GTGCATGTTCTGTTAGTTCAAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183816941 Original CRISPR TGCACTTTGAATAAAATTTT AGG (reversed) Intronic
901577564 1:10212580-10212602 TGAACTATGTAAAAAATTTTGGG + Intronic
908151194 1:61304712-61304734 TGTACTATAAACAAAATTTTGGG - Intronic
908441563 1:64160174-64160196 ATCACTTTTAATAAAATTTTAGG + Intronic
908805400 1:67925469-67925491 TGCAATTTGAATGAACTTTGTGG - Intergenic
909214230 1:72865763-72865785 AGCATTTTTAAAAAAATTTTTGG + Intergenic
910127920 1:83864506-83864528 TGCACTTTGGATAAAAATTTAGG - Intergenic
910243313 1:85111910-85111932 TCCTCTATGAATAAACTTTTGGG - Intronic
910577584 1:88783631-88783653 TGTACAATGAATAACATTTTAGG - Intronic
911352317 1:96768453-96768475 TCCATTTTGTATAAAACTTTAGG - Intronic
912232350 1:107809604-107809626 TGCATTTTGAATATATTTTCTGG - Intronic
915650671 1:157308056-157308078 TTCAATTTGTATAAAATTTAAGG + Intergenic
915880014 1:159659636-159659658 GGCACTTAGAATAAAGTTTAGGG + Intergenic
917033696 1:170722795-170722817 TGAACTTTGAAAAAAATATATGG + Intronic
917529051 1:175816655-175816677 TGTACATTGAATAAAATTGTTGG + Intergenic
917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG + Intronic
918006900 1:180549613-180549635 AGCCCTTTGACTAAAAGTTTTGG - Intergenic
918182069 1:182092717-182092739 TTCACTTTGACGAAAATGTTGGG - Intergenic
918325542 1:183406753-183406775 TGCAGTTTGAAAAAGGTTTTAGG - Intronic
918855560 1:189751987-189752009 TGCAGTTTGAATATAGCTTTAGG + Intergenic
918970682 1:191413916-191413938 GGCATTTTGAATATAGTTTTGGG - Intergenic
919364110 1:196635090-196635112 TTAAATTTGAATAAAATATTAGG - Intergenic
919435436 1:197553914-197553936 TGCACTTCGAAAAAGATCTTCGG - Intronic
919549842 1:198971404-198971426 TGCACTTAAAATAAAATCTATGG + Intergenic
919557033 1:199070392-199070414 TGAACCTTGAATAAATATTTAGG - Intergenic
919605974 1:199684965-199684987 TCCACATTGCATAAAATTCTAGG - Intergenic
921127664 1:212191652-212191674 TCCATTTTGAATTAATTTTTGGG - Intergenic
921551658 1:216544024-216544046 TGCACTTGGAAATAAACTTTGGG + Intronic
923061431 1:230478429-230478451 TGCATTCTGAAAAATATTTTTGG + Intergenic
924515061 1:244759170-244759192 TGCACTTTTAAAAAAAATTCTGG + Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
924753631 1:246921479-246921501 TGCATTCTGAATAAATTTTGGGG - Intronic
1064639016 10:17396772-17396794 TGCACTTTGAATGAAAGGTAAGG - Intronic
1064950677 10:20846254-20846276 TGCAATTTGAACAAAATATTTGG - Intronic
1065556944 10:26925447-26925469 TCCATTTTGACTTAAATTTTGGG - Intergenic
1065651374 10:27895587-27895609 TGCAGTTTTAATTAAAGTTTAGG - Intronic
1065757188 10:28941873-28941895 TGAAATTTGAATAAACTCTTCGG - Intergenic
1066073257 10:31844057-31844079 TTCATTTTGAATTTAATTTTTGG - Intronic
1066282534 10:33931710-33931732 TGCATTTTGAATGAAATCCTTGG + Intergenic
1066569719 10:36757549-36757571 TGCTCCTTGAAAAACATTTTAGG + Intergenic
1067455641 10:46417658-46417680 TCCATTTGGGATAAAATTTTAGG + Intergenic
1067631562 10:47966981-47967003 TCCATTTGGGATAAAATTTTAGG - Intergenic
1069141440 10:64831455-64831477 TTCCCTTTGAAGAACATTTTTGG + Intergenic
1069236550 10:66082550-66082572 TGAAATTTGAATAAAATCTGTGG + Intronic
1069672332 10:70218223-70218245 TGCCCTTTTAATAAAAATTGTGG - Intronic
1070357313 10:75652862-75652884 AGCACTTGGAAAAAAAATTTGGG + Intronic
1071032301 10:81198932-81198954 ACCACTTTGAAGAAAATATTTGG + Intergenic
1071665768 10:87556352-87556374 TGAACATTGAAAAAAATCTTTGG + Intergenic
1071977807 10:90972805-90972827 TGATCTTTGAAAAAAATATTTGG + Intergenic
1071998452 10:91170117-91170139 TCCATTTTGAATTAATTTTTGGG - Intronic
1072011837 10:91308888-91308910 TGCAATTTGTACATAATTTTTGG + Intergenic
1072302429 10:94074149-94074171 TACATTATGAAAAAAATTTTAGG - Intronic
1072431253 10:95372964-95372986 TGAAATTTGCACAAAATTTTAGG - Intronic
1073515589 10:104072807-104072829 TGAATTTTGAAAAAAAATTTGGG + Intronic
1073581479 10:104670303-104670325 TGCTCTTAGAAGAAAATTTATGG - Intronic
1074193067 10:111154834-111154856 TGCCCTTTGGACAAAGTTTTGGG + Intergenic
1074315903 10:112361516-112361538 GCCACTTTCCATAAAATTTTAGG + Intergenic
1074430713 10:113391927-113391949 TAAACATTGAATAAACTTTTAGG + Intergenic
1074486162 10:113883151-113883173 TGCAATTTGATAAGAATTTTAGG + Intronic
1075896837 10:126003600-126003622 TGCACTTAGAAAATAATTTCTGG + Intronic
1076455973 10:130596003-130596025 TACAGTTAAAATAAAATTTTAGG - Intergenic
1077645040 11:3916206-3916228 TCCACTTTGAGTTAACTTTTGGG + Intronic
1077976725 11:7254357-7254379 TGCACTTTGGATGTAATCTTTGG - Intronic
1078702927 11:13706248-13706270 TTCACTTAGAATAAACTTTAAGG + Intronic
1078786669 11:14500823-14500845 TGGCCTTTGAATACAATTTTGGG - Intergenic
1078950381 11:16125265-16125287 TGAAATTTCAATGAAATTTTAGG + Intronic
1080332837 11:31160027-31160049 TTTACTTTCCATAAAATTTTAGG + Intronic
1081152492 11:39648909-39648931 TTCCCTTTAAATAAATTTTTTGG - Intergenic
1081164787 11:39794189-39794211 TGCACGCTGAACAAAATGTTGGG + Intergenic
1081388467 11:42501021-42501043 TGCACTTTGGAGAAAATAATAGG + Intergenic
1085439978 11:76551796-76551818 TAGACTTTGCATACAATTTTAGG + Exonic
1086321912 11:85658480-85658502 TGCCCTCTGAACAAAAATTTTGG - Intergenic
1087416523 11:97863092-97863114 TACATCTTGTATAAAATTTTAGG - Intergenic
1087953663 11:104256991-104257013 TGGAGTTTGGATAAAATTATAGG + Intergenic
1088587746 11:111374867-111374889 TGTACTATGCATATAATTTTTGG - Intronic
1088601348 11:111479244-111479266 TTCCCTTTGTATAGAATTTTGGG - Intronic
1089006975 11:115100374-115100396 TGCAGTTTTAATAAACTCTTTGG - Intergenic
1090146298 11:124326770-124326792 TTAACTTTAAATAAAATCTTTGG + Intergenic
1091004895 11:131943781-131943803 TGCATTTTGAAGAATATTCTTGG - Intronic
1092131908 12:6118795-6118817 TCCACTTTAAATAAAATCTGGGG + Intronic
1092514365 12:9193288-9193310 TGCACTTTGAAGAAAAGCTAAGG - Intronic
1092567173 12:9679420-9679442 TTCACTTTGAAGAATTTTTTTGG + Intronic
1092628680 12:10355533-10355555 GGCACTTTTAAAAAAAATTTTGG + Intergenic
1092800738 12:12163605-12163627 TTTACTTTAAACAAAATTTTAGG - Intronic
1093656712 12:21703086-21703108 ACCACTTTGAAAAAAAATTTAGG - Intronic
1093782566 12:23153986-23154008 TGAACTTTTAAAAAAATTCTAGG + Intergenic
1094392488 12:29966749-29966771 TTCAATTTAAATACAATTTTTGG + Intergenic
1094554849 12:31488486-31488508 TTCACTTTGAGTACAACTTTTGG - Intronic
1095574433 12:43719052-43719074 TACACTTTCAATAAATTTTAAGG - Intergenic
1097497123 12:60354149-60354171 TGCAATTTGTATATCATTTTTGG - Intergenic
1097957777 12:65504216-65504238 TGAACAATGAGTAAAATTTTTGG - Intergenic
1098001376 12:65947428-65947450 AGGACTTTGAAGAAATTTTTTGG - Intronic
1099128646 12:78798786-78798808 TCCACTTAAAAAAAAATTTTTGG - Intergenic
1099372672 12:81856553-81856575 TGGACTTTGTATAAAATGATTGG + Intergenic
1099405849 12:82261342-82261364 TGGGCTTAGAATAAATTTTTAGG + Intronic
1100024474 12:90111064-90111086 TTCACTTTGAATACATTTTAGGG - Intergenic
1100079450 12:90830126-90830148 TGAACTTTGAACAAAGTTTATGG - Intergenic
1100742679 12:97611757-97611779 TGCATTCTGAATACAAATTTCGG + Intergenic
1101370042 12:104119333-104119355 TGCCCTTTTAATAAAATATAAGG - Exonic
1102917452 12:116764966-116764988 GGCACCTTGACTTAAATTTTAGG + Intronic
1106405978 13:29473594-29473616 TGCAGTTTTAATAATATTTTAGG + Intronic
1107201930 13:37731611-37731633 TGCTATGTGAATAATATTTTTGG + Intronic
1107364742 13:39658118-39658140 TCTACTTTGAAGAATATTTTTGG + Intronic
1107615841 13:42167231-42167253 GGCACTTTCAATACATTTTTAGG + Intronic
1108888009 13:55213586-55213608 TGAAATTACAATAAAATTTTGGG - Intergenic
1108964789 13:56284515-56284537 TTCATTTTGAAATAAATTTTAGG + Intergenic
1109048436 13:57443914-57443936 TGCACTATCAATAAAATTTTGGG + Intergenic
1109111301 13:58322077-58322099 TGCACTTTTAACAAATCTTTAGG + Intergenic
1109381942 13:61573990-61574012 TGCATATTGTATAACATTTTTGG - Intergenic
1109786685 13:67184807-67184829 TGCACTATTTATAGAATTTTTGG - Intronic
1109966940 13:69712639-69712661 TTCACTTTTATTTAAATTTTAGG + Intronic
1110034644 13:70667684-70667706 TCTACTGTGAATAAAAGTTTAGG - Intergenic
1110347216 13:74462522-74462544 TACACATTGTCTAAAATTTTTGG + Intergenic
1110351562 13:74514252-74514274 TGCACTTTTTATGAATTTTTTGG + Intergenic
1110581255 13:77131130-77131152 TGCATTTTGAAAATAATCTTAGG - Intronic
1110915258 13:81013111-81013133 TGACCTTTGTATTAAATTTTGGG + Intergenic
1111108773 13:83679920-83679942 TGCAATGTGAACAAAATTTCAGG + Intergenic
1111859913 13:93690085-93690107 TGCACTTTGAATTAACCTTTTGG + Intronic
1113033568 13:106022790-106022812 AGCACTTTGATTAATATTTTTGG + Intergenic
1113260544 13:108557122-108557144 TGCAGTTTCACAAAAATTTTAGG + Intergenic
1114225075 14:20730692-20730714 TGCACTTTGAAGATAAGTTCTGG + Intergenic
1114359221 14:21951658-21951680 TTCACATGCAATAAAATTTTTGG + Intergenic
1114874858 14:26703377-26703399 TCTACTTTGAATAAACTTCTAGG + Intergenic
1115184569 14:30670814-30670836 TGTACTTTGAATAAATTTCTAGG - Intronic
1115375026 14:32665282-32665304 GGCACTTTGATTAGAATTTCTGG - Intronic
1115401028 14:32960703-32960725 TGCACTATGAATAAAATTCATGG - Intronic
1115961911 14:38843907-38843929 TAAAATTTGAATAAAACTTTAGG + Intergenic
1116109284 14:40555828-40555850 TGAACTTTAAAAAAAATTTCAGG + Intergenic
1116114236 14:40627981-40628003 TTCACTTTGACTGACATTTTTGG + Intergenic
1116145641 14:41064798-41064820 TGCACTTGTAAAAATATTTTTGG - Intergenic
1116916973 14:50534416-50534438 GGCTCATTAAATAAAATTTTTGG - Intronic
1117051528 14:51865198-51865220 TGCACATTAAATAAAATTAGGGG - Intronic
1117429253 14:55636559-55636581 TAAACTTTGTATATAATTTTGGG + Intronic
1119018771 14:71087234-71087256 GGCATTTTGAAAAAAAATTTGGG - Intronic
1119076188 14:71641800-71641822 TACATTTTAAAGAAAATTTTTGG - Intronic
1119905827 14:78301129-78301151 TCCACATTAAATAAAATTTCAGG - Intronic
1120269927 14:82298520-82298542 TGCACATTAACTAAAAGTTTTGG + Intergenic
1120525892 14:85576610-85576632 TGCATTTGGAATTAGATTTTCGG - Intronic
1121374811 14:93398789-93398811 TGCTCTTTGAATAATATGTAGGG + Intronic
1122749902 14:103925380-103925402 TGCACTTTGAATAAATCTGCTGG - Intronic
1123264512 15:17699159-17699181 AGCACTCTGAAAAAAATCTTTGG + Intergenic
1123288256 15:18116328-18116350 AGCACTCTGAAAAAAATCTTTGG + Intergenic
1125206938 15:37163963-37163985 TACAAGTTGAACAAAATTTTTGG - Intergenic
1125849818 15:42892404-42892426 TGGACCTTTAATAAAATGTTTGG + Intronic
1126118931 15:45233882-45233904 TCCATTTTAAATAAAATTTCTGG + Intergenic
1126263834 15:46729121-46729143 TGCACTTTGAAAAAAAATGTAGG - Intergenic
1126868199 15:52959096-52959118 TGCAATGTGATTAAAATTTATGG - Intergenic
1127045333 15:55019294-55019316 AACACTTTGATTAAAAGTTTGGG - Intergenic
1127111307 15:55674166-55674188 TGCAGTTTTATTAAAATGTTTGG - Intronic
1127168689 15:56275534-56275556 AGCAATTTGTTTAAAATTTTTGG + Intronic
1127448802 15:59095725-59095747 TGCAGATTTAACAAAATTTTAGG + Exonic
1127793900 15:62422310-62422332 TGCACTTTAAACAACATCTTAGG - Intronic
1128029810 15:64470026-64470048 TCCACTTTGAATTAACTTCTTGG + Intronic
1128134495 15:65252823-65252845 TGCACTTTAAATAAAATGCAAGG + Intronic
1128422864 15:67511108-67511130 TTTTGTTTGAATAAAATTTTAGG + Intergenic
1129079086 15:73023781-73023803 TTCATTTTGGATAAATTTTTGGG + Intergenic
1129283530 15:74505230-74505252 GGTACTTTTAAAAAAATTTTTGG + Intergenic
1129476599 15:75789461-75789483 TGCACTTTGAAGAAAGACTTAGG - Intergenic
1129872247 15:78947945-78947967 TGCAGTTTAAATATAATTATAGG + Intronic
1132788598 16:1672196-1672218 TGCACCTTTAATAAAATCCTGGG + Intronic
1133585692 16:7192493-7192515 TTCACTTTGAATAAATATTGAGG + Intronic
1137639168 16:50013431-50013453 TGCACTTAAAATAAAATCTGAGG - Intergenic
1137803249 16:51280173-51280195 TGAAGTTTCAAAAAAATTTTTGG + Intergenic
1139227659 16:65248824-65248846 TGCTCTTTCATTAAAATTGTGGG - Intergenic
1140204988 16:72926457-72926479 TCCACTTTGAAAAACATATTCGG + Intronic
1142330391 16:89448724-89448746 TGGACTTTGAAAATGATTTTAGG - Intronic
1142928712 17:3264060-3264082 TGCATTTGAAATAAAATTTTAGG + Intergenic
1144234466 17:13244306-13244328 TGCAGTTAGAATAAATTTGTAGG - Intergenic
1144277859 17:13692241-13692263 TACCTTTAGAATAAAATTTTTGG + Intergenic
1146113017 17:30108822-30108844 TCCAGTTTTAATAAAATTTTGGG + Intergenic
1146221003 17:31020456-31020478 TGGACTTTTAAAAAAATGTTTGG + Intergenic
1146496719 17:33329254-33329276 TTCACTTTGAAGGATATTTTAGG + Intronic
1146777097 17:35629554-35629576 TGCACTTTGAATTTAATTATCGG + Intronic
1147549760 17:41432196-41432218 TACCCTCTTAATAAAATTTTAGG - Intergenic
1149948032 17:60952618-60952640 TGAACTTAAAATAAAAGTTTAGG - Intronic
1150609697 17:66724067-66724089 TGCATTTTAAACAAAATCTTTGG - Intronic
1150948753 17:69777815-69777837 TGAAATTTGAATAAAATCTTCGG - Intergenic
1152311341 17:79551964-79551986 TGCATTTTAAACAAAATTTTTGG - Intergenic
1153105991 18:1527678-1527700 TGCATTTTGCAAATAATTTTAGG + Intergenic
1153383203 18:4461367-4461389 TGATCTCTAAATAAAATTTTAGG + Intergenic
1153467449 18:5404710-5404732 GCCACTTTGAATGAAAGTTTAGG - Intronic
1153525830 18:5993815-5993837 TGCCATTTGAATAAAACTATTGG - Intronic
1154162478 18:11990494-11990516 TGCACTTTGGCTAAAGTTTGAGG + Intronic
1154402811 18:14057637-14057659 TTCAATTTGAATAAAAGATTAGG - Intronic
1155117953 18:22788254-22788276 TGCAATTTCAATCATATTTTTGG - Intergenic
1155816818 18:30322084-30322106 TGCACTGCATATAAAATTTTAGG - Intergenic
1156135262 18:34030128-34030150 TCCACTTTGATTATATTTTTGGG + Intronic
1156150059 18:34230693-34230715 TGCACTTTAAATAAGATATAAGG - Intergenic
1156578388 18:38346598-38346620 TTTACTTTTAAAAAAATTTTAGG - Intergenic
1156649277 18:39205255-39205277 TGCACTTTTCATAAAATGTTTGG + Intergenic
1158132657 18:54170066-54170088 TGCACTGTCAGTTAAATTTTAGG - Intronic
1158901494 18:61966102-61966124 TTCACTTAGCATAACATTTTGGG + Intergenic
1159006869 18:63021016-63021038 TGCATTTAAAATAAAATTGTAGG - Intergenic
1159405875 18:68002141-68002163 TGCAATTTGAATACATTTTAGGG + Intergenic
1159530391 18:69648438-69648460 TGGGCTTTGAAAAATATTTTAGG - Intronic
1159726145 18:71962176-71962198 AGCACTTTTAATGAAATTCTAGG - Intergenic
1163897181 19:20069433-20069455 TGCAGTTATAATAAAAATTTTGG - Intergenic
1163907954 19:20163486-20163508 TGCAGTTATAATAAAAATTTTGG - Intergenic
1163935579 19:20440150-20440172 TGCAGTTATAATAAAAATTTTGG + Intergenic
1166655150 19:44605769-44605791 TGAAGTTGGAATAAAACTTTTGG - Intergenic
925529147 2:4840392-4840414 AACACTTTGAATAATATTTGTGG + Intergenic
926263709 2:11293749-11293771 GGCACTTGGAACAAAATTTGAGG - Intronic
926383966 2:12317721-12317743 TGCCCTGTCAATAAAATCTTGGG - Intergenic
926498718 2:13625155-13625177 TGCAATTTTAATTAAATTCTAGG + Intergenic
926837751 2:17043219-17043241 TGAAATTTTAATAAAATTTCTGG + Intergenic
927079884 2:19617030-19617052 ATCTTTTTGAATAAAATTTTAGG - Intergenic
927105740 2:19822494-19822516 TGCAATTTGAAGAAAATTGCAGG - Intergenic
927429973 2:23019311-23019333 TGCAGTTTGGAAAAAAATTTAGG + Intergenic
928558492 2:32451481-32451503 TGCACTTGTAATAAAAATGTCGG + Intronic
928870268 2:35967615-35967637 TACACTTTGAATGTTATTTTGGG - Intergenic
928949856 2:36804869-36804891 TCCGCTTTGAAGAAAGTTTTAGG - Intronic
928978705 2:37116460-37116482 TGGACTTTTAATACAATCTTAGG + Intronic
929630604 2:43457672-43457694 TGAATTTTAAATAACATTTTTGG - Intronic
932996293 2:76857990-76858012 TGCACTTTGATAAAAATTTTAGG - Intronic
933016516 2:77135042-77135064 TTGACTCTGAATAAAATTATAGG + Intronic
933043947 2:77509395-77509417 TGCAAGGTGAATAAAATGTTCGG + Intronic
935348495 2:102132070-102132092 TTCACTGTGTATAAAATTCTTGG - Intronic
935824281 2:106928562-106928584 TTCACATTGACAAAAATTTTGGG + Intergenic
938737103 2:134196048-134196070 TACACCTTGAATAATATGTTGGG - Intronic
939420088 2:141955881-141955903 TGGATTATGTATAAAATTTTAGG - Intronic
939899921 2:147839504-147839526 TTCACTTTGAATAAAATCCAAGG + Intergenic
940342228 2:152593405-152593427 TGTAATTTGGATAAAACTTTAGG + Intronic
941247323 2:163115765-163115787 TTCCCTTTGAATAACAATTTAGG + Intergenic
942067672 2:172286858-172286880 TGCACTATGCAGAAGATTTTTGG + Intergenic
943370372 2:187008853-187008875 TGCATTTTAAATAAAATTAAGGG + Intergenic
943909172 2:193541498-193541520 TTCACTTTGTATATAAATTTTGG + Intergenic
944857070 2:203778345-203778367 CTCACCTGGAATAAAATTTTGGG - Intergenic
945363558 2:208923059-208923081 TGTAATTTCAATAAAATTTCAGG - Intergenic
945629067 2:212248963-212248985 TGGACTATGCATATAATTTTGGG + Intronic
945671805 2:212811082-212811104 TACATTTTGAATAAAATTACAGG - Intergenic
945698311 2:213137026-213137048 TGCTGTTTGCATAAAGTTTTGGG - Intronic
945867165 2:215189342-215189364 AACACTGTGAATAAATTTTTTGG + Intergenic
946512803 2:220377788-220377810 TGACCTTTTAAAAAAATTTTTGG - Intergenic
947050886 2:226041745-226041767 TGCACTGTGCATATAAATTTAGG - Intergenic
947092376 2:226526693-226526715 TGCATATTGTATAATATTTTGGG - Intergenic
947662921 2:231883285-231883307 TTCACTCTTAATAAAATTCTAGG + Intergenic
947833812 2:233160934-233160956 TGCATTTTTAATAAAACATTTGG - Intronic
948354526 2:237367384-237367406 TTCACTGTGAATAAATTATTAGG - Intronic
1169596596 20:7206872-7206894 TGCACGATAAATAAAATTTGTGG + Intergenic
1169984473 20:11428033-11428055 GGGAGTTTGAATAAAATTATGGG - Intergenic
1171347052 20:24473497-24473519 TGCTCTTTGAACACAAGTTTAGG - Intronic
1173406771 20:42773160-42773182 GTCACTTTTAATAAAATATTTGG - Intronic
1174715776 20:52757012-52757034 TACCTTTTGAATAAAAATTTTGG + Intergenic
1175042342 20:56065864-56065886 TCCACTTTGAATTATTTTTTGGG - Intergenic
1176889066 21:14292422-14292444 TGCACTCTGATTTAAATTGTAGG + Intergenic
1177032139 21:15993829-15993851 TGCAATTTGAAAATACTTTTTGG + Intergenic
1177533184 21:22389881-22389903 TGCACTGGTAAAAAAATTTTTGG - Intergenic
1178009523 21:28267470-28267492 ATCACTTTGAAAAAAAATTTTGG + Intergenic
1178430177 21:32512040-32512062 TACCCTTTAAATAAAATTTTAGG + Intronic
1179717363 21:43296659-43296681 TGGCCTTTGCATAAACTTTTTGG + Intergenic
1180639327 22:17285691-17285713 TGCAATTTGAGAAAAATTTATGG + Intergenic
1182089256 22:27583076-27583098 TTTCCTTTGAATAAAATCTTAGG - Intergenic
1183065127 22:35357431-35357453 TGCCCTTTGAAATATATTTTCGG - Intergenic
1183297837 22:37042564-37042586 TTCGCTTTGAAAATAATTTTAGG - Intergenic
1183816941 22:40310035-40310057 TGCACTTTGAATAAAATTTTAGG - Intronic
1184636819 22:45839251-45839273 TGCACTTTGGATACTAATTTTGG + Intronic
949470292 3:4388548-4388570 TGTACTTTTAATATAATTATTGG + Intronic
949810993 3:8005900-8005922 TTCTCTTTAAATGAAATTTTTGG - Intergenic
950092821 3:10308722-10308744 TAGACTTTAAAGAAAATTTTGGG - Intronic
950513565 3:13448487-13448509 TGCATTTTCAAATAAATTTTAGG - Intergenic
952031906 3:29153072-29153094 TGAAATTTGAAAAACATTTTTGG + Intergenic
953428309 3:42814807-42814829 AGTACTTTGAATGAAATTTCAGG + Intronic
957507640 3:81144671-81144693 TGCATTTTGAAAAAAGTTTCAGG - Intergenic
957794723 3:84988536-84988558 TTCACTTTGAGTAAATTCTTAGG + Intronic
957816096 3:85299308-85299330 TGTAATTAGAATATAATTTTTGG - Intronic
957845224 3:85723342-85723364 TGCATTTTTAAGATAATTTTCGG + Intronic
957876199 3:86149499-86149521 TGTATTTTGACTAAGATTTTTGG + Intergenic
958180639 3:90055836-90055858 TACAATATAAATAAAATTTTTGG + Intergenic
958774433 3:98464648-98464670 TTCACATTTATTAAAATTTTGGG - Intergenic
959286678 3:104422223-104422245 TCCAATTTGAATAATAATTTAGG - Intergenic
959563965 3:107815473-107815495 TGCACTATGGTTAGAATTTTAGG - Intergenic
959828163 3:110826482-110826504 AGCAATTTGATTATAATTTTTGG + Intergenic
960023372 3:112980888-112980910 TAAAATTTGAATAAAATTTCAGG - Intergenic
961158588 3:124702353-124702375 TGTACTTTGAAGAAAATTTTGGG - Intronic
961211225 3:125127541-125127563 TGTACTTTCAAAAAAATTTCAGG - Intronic
962310064 3:134319497-134319519 TTCACTTTAATTACAATTTTTGG - Intergenic
963582528 3:147144252-147144274 TCTATTTTTAATAAAATTTTAGG - Intergenic
963731502 3:148978275-148978297 TCCATTTTGAATTAATTTTTGGG + Intergenic
964377395 3:156062506-156062528 AGGACTTAGAATACAATTTTTGG - Intronic
965020517 3:163223070-163223092 TGAACTTTGACTAAAATCATTGG - Intergenic
965049821 3:163631911-163631933 TGAACTAAGAATAAATTTTTAGG - Intergenic
965107779 3:164380154-164380176 TGCACATTAAATAAATTTGTAGG - Intergenic
966490682 3:180525329-180525351 TGTACATGGTATAAAATTTTAGG - Intergenic
967105262 3:186250474-186250496 TGAACTTAAAATAAAAGTTTAGG + Intronic
968077326 3:195823635-195823657 TGTACTTTGCATAAAGTATTAGG + Intergenic
968343555 3:197980693-197980715 TTCACTTTGACTAAAAACTTGGG - Intronic
968628842 4:1639916-1639938 TGCACTTTTAATAAAATCGTAGG - Exonic
969104704 4:4796800-4796822 TTCATTTTGCATACAATTTTAGG - Intergenic
970219189 4:13792330-13792352 TCAAATTTGAATAAAATTTCAGG + Intergenic
970675524 4:18444645-18444667 TGCATTTTGAATTAAATAATAGG - Intergenic
970939012 4:21609223-21609245 TAAATTTTGAATAAAATTATGGG + Intronic
971077140 4:23163134-23163156 TGAACTTTGAATAGAATCTTTGG + Intergenic
971867146 4:32188005-32188027 TGCACTTTAAATAAAAGTAGGGG - Intergenic
971958877 4:33458406-33458428 TGCCATTTGCTTAAAATTTTTGG + Intergenic
972102412 4:35438199-35438221 CACACTTTGAATTAAAATTTTGG - Intergenic
972550453 4:40128042-40128064 TTCACTTTGAATTTTATTTTTGG + Intronic
972848273 4:43016458-43016480 GGCAAATTTAATAAAATTTTTGG - Intronic
972927212 4:44024844-44024866 TGCATTTTTAATAAATTTTCAGG + Intergenic
973013096 4:45102056-45102078 GGCATTTTGAATAAAATAATAGG + Intergenic
973594820 4:52477131-52477153 TACACTTTAAATAAACTATTTGG + Intergenic
974741802 4:66016122-66016144 TGAACTTTGAATTTAATGTTAGG - Intergenic
975643106 4:76520049-76520071 TCCACTCTGGATAATATTTTGGG - Intronic
975766873 4:77677724-77677746 TGCACTTTGAATAATGCTGTGGG + Intergenic
975799019 4:78039323-78039345 TACACTTTTAAAAATATTTTGGG - Intergenic
976182661 4:82413564-82413586 TGCTTTTTAAATAAAATATTGGG - Intergenic
976558147 4:86473389-86473411 TCTATTTTGAATGAAATTTTTGG - Intronic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
977757645 4:100692132-100692154 TGCATTTTAAAAAATATTTTAGG - Intronic
977921834 4:102653400-102653422 TGCACGGTGATTAAAAGTTTGGG - Intronic
977990941 4:103441778-103441800 TGAACTTAGAGCAAAATTTTAGG + Intergenic
978802488 4:112768749-112768771 TGGAATTCAAATAAAATTTTTGG - Intergenic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979221408 4:118230269-118230291 TGCACTTCTAATAAATTTTCTGG - Intronic
979841542 4:125448405-125448427 TGGAATTTAAATAAAATATTTGG - Intronic
980402568 4:132310763-132310785 TTCACATTGAATAAAAACTTTGG + Intergenic
981851480 4:149235217-149235239 TGCAATTTGTATCAAATTCTAGG - Intergenic
982229356 4:153194498-153194520 TTCCCTTTACATAAAATTTTAGG + Intronic
982978224 4:162094373-162094395 TTCTCTTGGAATATAATTTTAGG - Intronic
983448552 4:167882055-167882077 TGCATTTGGAATCAAATTTTAGG - Intergenic
983724725 4:170906521-170906543 TGCACTTTACATACAACTTTGGG + Intergenic
984160266 4:176244206-176244228 TTGAGTCTGAATAAAATTTTAGG - Intronic
984314676 4:178112687-178112709 AGAAATTTGAAGAAAATTTTGGG - Intergenic
984555764 4:181212113-181212135 AGCTCTTTGAATAAAATTGTGGG + Intergenic
985584745 5:724742-724764 TGAAATTTTAATAAAATATTGGG - Intronic
985598248 5:809056-809078 TGAAATTTTAATAAAATATTGGG - Intronic
986430720 5:7678624-7678646 TACACTTTGAATTCTATTTTTGG - Intronic
987673612 5:21046105-21046127 TCCATTTTGAAAAACATTTTGGG + Intergenic
988096484 5:26618150-26618172 AGCACTTTAAATAAAACATTAGG + Intergenic
989689847 5:44128568-44128590 TGCACTTATATTAAAATTCTAGG - Intergenic
989990893 5:50764481-50764503 TGCAGTTAAAATAAAATGTTTGG - Intronic
990540690 5:56770124-56770146 TGCACTTTGAAACAAATATTCGG - Intergenic
990942493 5:61216853-61216875 TGTAATTTGATTAAAATTTTTGG + Intergenic
991257060 5:64626120-64626142 TTCACTTAGCATAATATTTTTGG - Intergenic
992071750 5:73155092-73155114 TCTACTTTGAATCAAATTATTGG + Intergenic
992480675 5:77149352-77149374 TGCATTTTGATACAAATTTTAGG + Intergenic
992959399 5:81943486-81943508 TGCTCTTCCAATAAAATTTTTGG + Intergenic
993216497 5:85029753-85029775 TGTATTTTTAAAAAAATTTTTGG - Intergenic
993671538 5:90766519-90766541 TACACTTTGAAAAAAAATTAAGG + Intronic
993821788 5:92628395-92628417 TTCACTGTGTCTAAAATTTTAGG + Intergenic
993896707 5:93543919-93543941 TACACTTTTAACAAACTTTTTGG - Intergenic
994069158 5:95579121-95579143 TGAATTTTGATTAAAATTTGAGG + Intronic
994583429 5:101676552-101676574 AGCAATTTGAATAATATGTTTGG - Intergenic
994638000 5:102366600-102366622 TGCACCTTGAGAAAAACTTTAGG - Intergenic
995013895 5:107288706-107288728 TGTACTTAGAATACAATTTAAGG + Intergenic
995031299 5:107484591-107484613 TGCTCTTAGAGTAAAATCTTGGG - Intronic
995040461 5:107582039-107582061 TGTACTTAGAATAAGACTTTAGG - Intronic
995419039 5:111941960-111941982 TGGACTCTGAATTAGATTTTTGG + Intronic
995577492 5:113555943-113555965 AGGACTTTGAATTAAACTTTTGG + Intronic
996281423 5:121733841-121733863 TGCAATTTGAAAAAGACTTTTGG - Intergenic
996628667 5:125601402-125601424 TCTCCTATGAATAAAATTTTTGG + Intergenic
996808842 5:127490496-127490518 TTCCCTTTCAATTAAATTTTAGG - Intergenic
996828116 5:127708705-127708727 TGCACTTCAAATAAGATTTTTGG + Intergenic
996959561 5:129230547-129230569 AGCAGTTTGAATATAATTTGGGG + Intergenic
996998595 5:129729700-129729722 AGCACCTTTTATAAAATTTTGGG - Intronic
997135788 5:131323976-131323998 TGCTTTTTCAAGAAAATTTTAGG + Intronic
998339145 5:141401032-141401054 AGTATTTTTAATAAAATTTTAGG - Intronic
999408609 5:151329366-151329388 TGCATTTTGAATATTATTTTAGG - Intronic
999472939 5:151872267-151872289 GGCATTTTGAATAATATTATAGG - Intronic
999655608 5:153807729-153807751 TGCAAATTGAATAAAATCTCAGG + Intronic
999896989 5:156045234-156045256 TGAACTTTCAACAAAAGTTTTGG + Intronic
999898238 5:156058393-156058415 TGCACATTAAATAAAGTTTAAGG - Intronic
1000259539 5:159574129-159574151 TTCATTTTGAATTATATTTTTGG + Intergenic
1000709408 5:164552746-164552768 TTCACTATGAAAAATATTTTGGG - Intergenic
1004344584 6:14836874-14836896 TGAATTTTGGATATAATTTTGGG + Intergenic
1004411574 6:15386095-15386117 TGTACTTTTACTAATATTTTTGG + Intronic
1004537926 6:16520699-16520721 TGCTCTGAGAATAAACTTTTTGG + Intronic
1004847263 6:19658700-19658722 TTCACTTTAAATTAAATTATTGG + Intergenic
1005117102 6:22351107-22351129 TCCACTCAGAATAAAATATTGGG + Intergenic
1005518400 6:26576232-26576254 TGCCATTTGAAGAAAAATTTGGG + Intergenic
1007650228 6:43414997-43415019 TTCACTTAGAATAATGTTTTTGG - Intergenic
1008557054 6:52683137-52683159 TGTTCTTTGAATAGAAATTTAGG + Intronic
1008835289 6:55820098-55820120 TTCACTTTTAAAAACATTTTTGG - Intronic
1009307124 6:62103846-62103868 TTCACTTTTAATAGAATTATAGG - Intronic
1009793581 6:68436285-68436307 TGCTCTTTGGATAATTTTTTTGG + Intergenic
1009830617 6:68927456-68927478 TTCACTTTTAATAAAAATTTAGG - Intronic
1009919048 6:70033918-70033940 TCCACTTTGGATTAAATTTGTGG - Intronic
1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG + Intergenic
1010531619 6:76975058-76975080 TTCACTTAGAATAAGATTTTCGG + Intergenic
1010649510 6:78434961-78434983 TGCACTTAGACTAAAATGTATGG - Intergenic
1010705849 6:79109843-79109865 TTCACTGTGCATAAATTTTTTGG - Intergenic
1010868366 6:81007591-81007613 TGGACTTTAAATAAGACTTTTGG - Intergenic
1011889825 6:92143948-92143970 TGCATATTTAATATAATTTTAGG + Intergenic
1013606500 6:111754075-111754097 TGCAATGATAATAAAATTTTAGG + Intronic
1013848833 6:114488821-114488843 TGCACTTTGAATAGAATTACTGG - Intergenic
1014017956 6:116555882-116555904 TGCACTTAGAAAGATATTTTTGG - Intronic
1016178662 6:141114755-141114777 TAGACTTTGAACAAAATATTAGG + Intergenic
1016563294 6:145422523-145422545 TGCAGTTTGAATAACATTTCTGG - Intergenic
1016899961 6:149091728-149091750 AACACTTTAAATAAAATTTCAGG + Intergenic
1017307312 6:152933995-152934017 GGCACTGTGTATAAAACTTTAGG + Intergenic
1017582085 6:155877462-155877484 TGCTATTTTTATAAAATTTTCGG + Intergenic
1017618609 6:156272158-156272180 TGAGCATTGAATGAAATTTTAGG - Intergenic
1021058877 7:16084879-16084901 TCTACTTTGAATAATTTTTTAGG - Intergenic
1021268357 7:18553542-18553564 TGCACTTTTCATAACATATTAGG + Intronic
1021481558 7:21123408-21123430 TGCACTTTTAAAACAAATTTAGG - Intergenic
1023549017 7:41349106-41349128 TGCAATTATAATAAAATCTTGGG - Intergenic
1023769961 7:43547838-43547860 TAAACTTTGAATAACATTGTGGG - Intronic
1025159937 7:56647942-56647964 TGCTCTTCGAAATAAATTTTGGG + Intergenic
1025706395 7:63868934-63868956 TCCACTTTTATTAAAATGTTTGG + Intergenic
1026662734 7:72316633-72316655 TGCACTTAAAAGAATATTTTAGG + Intronic
1027741768 7:82016957-82016979 AACACTTGGAATAAAATTTCAGG - Intronic
1027745408 7:82067844-82067866 TACAATTTCTATAAAATTTTAGG - Intronic
1028263280 7:88690145-88690167 TTCACTGTGAATAAATTTCTAGG - Intergenic
1028382047 7:90211221-90211243 TGTCCTTGGAATAAAATGTTCGG - Intronic
1028928718 7:96389246-96389268 TGCTCTTTGTATAAAATGCTTGG + Intergenic
1029164370 7:98576665-98576687 TGGAATTAGTATAAAATTTTGGG + Intergenic
1030573338 7:111254498-111254520 AGCACTTTGAGTACAATATTAGG - Intronic
1031158892 7:118142730-118142752 GTCACTTTTAATAAAACTTTGGG + Intergenic
1031416297 7:121500499-121500521 TGCATATTTAATAACATTTTTGG + Intergenic
1032408312 7:131673963-131673985 TGCTCTTTAAATTTAATTTTGGG + Intergenic
1032944978 7:136840034-136840056 TTCACTATGCATAAAATTTGGGG - Intergenic
1036092756 8:5686320-5686342 TGCACTTTCATTAAAATTAGGGG - Intergenic
1037095521 8:14981769-14981791 TGCACTATGATTAAAATATTTGG - Intronic
1038337549 8:26657572-26657594 TGCACTTTTAAAAAAATAATTGG + Exonic
1038868355 8:31464606-31464628 TTCACGTTAAATAAAATTTAAGG + Intergenic
1038988445 8:32839086-32839108 TGCACTTTTAAAAAGATTTTAGG + Intergenic
1039765150 8:40620527-40620549 TTCCCTTTGAACAAAATATTTGG - Intronic
1040405123 8:47093752-47093774 TCCACCTTGAATTAATTTTTGGG - Intergenic
1040706924 8:50139565-50139587 TGGACTTTTAATAAAATAGTTGG - Intronic
1040984720 8:53280982-53281004 AGCAGTATGAATAATATTTTTGG - Intergenic
1041463226 8:58133925-58133947 TGCACTTGAAATATATTTTTGGG - Intronic
1042849991 8:73207375-73207397 TGTACTTTTAAAAAACTTTTTGG - Intergenic
1042969571 8:74393452-74393474 TGCACATTAAACAAAAATTTGGG - Intronic
1043025597 8:75064038-75064060 TCAACTTTGGATAAAATTTCTGG + Intergenic
1044251787 8:90011440-90011462 TGCATTTTCAAAACAATTTTAGG + Intronic
1045009899 8:97949926-97949948 TTCCATTTGTATAAAATTTTTGG + Intronic
1045614495 8:103892808-103892830 TTCACTTTCAATTAAAATTTGGG - Intronic
1046100469 8:109608419-109608441 AGCACTTTGAGAAAAATTCTTGG + Intronic
1047386557 8:124415545-124415567 TGGACTTTGCCTAAAATTTCAGG - Intergenic
1049131785 8:140851548-140851570 TTTACTTTTAATAAAATTTGGGG - Intronic
1049949711 9:632242-632264 TGCAATTTTAGTAATATTTTTGG - Intronic
1050716638 9:8535401-8535423 TTCCCTTTGAACAAGATTTTAGG + Intronic
1050982670 9:12039873-12039895 TGACCATTCAATAAAATTTTGGG - Intergenic
1050996507 9:12226453-12226475 GGCACTTTGAAAAACATCTTAGG + Intergenic
1052527247 9:29634022-29634044 TTCAATTTGAATAACATTTTTGG + Intergenic
1053616964 9:39777584-39777606 TGATTTTTGAATAAACTTTTGGG - Intergenic
1053875144 9:42536937-42536959 TGATTTTTGAATAAACTTTTGGG - Intergenic
1053897490 9:42757691-42757713 TGATTTTTGAATAAACTTTTGGG + Intergenic
1054236553 9:62564791-62564813 TGATTTTTGAATAAACTTTTGGG + Intergenic
1054267204 9:62929853-62929875 TGATTTTTGAATAAACTTTTGGG + Intergenic
1054550692 9:66599298-66599320 TGATTTTTGAATAAACTTTTGGG + Intergenic
1055130325 9:72767406-72767428 TGCAGTTTTAATATAATTTCAGG + Intronic
1055369224 9:75579076-75579098 TGCACTTTGAAAATAATCTTAGG + Intergenic
1055836988 9:80455457-80455479 AGCAATTTGAATAAATATTTTGG + Intergenic
1057536281 9:95910672-95910694 TTCACTTTGAATATAATTATTGG + Intronic
1058219694 9:102282641-102282663 TGCACATAGAATTAAATTGTAGG - Intergenic
1059045176 9:110859053-110859075 TACTCTTTATATAAAATTTTGGG - Intergenic
1059786483 9:117591757-117591779 TGCACTTCAAGTAAAATTCTGGG + Intergenic
1060158659 9:121339068-121339090 TGCACTTTCACTAATATTTTTGG - Exonic
1060679553 9:125549515-125549537 TGATCTTTAAAAAAAATTTTTGG - Intronic
1060693344 9:125684728-125684750 TGGATTTTGAATAATATGTTAGG - Intronic
1061140048 9:128760502-128760524 TGCACTTAAAAGAAAACTTTTGG - Intronic
1061602438 9:131680088-131680110 TGCACTGTTAATCAAAATTTGGG - Intronic
1186425515 X:9462292-9462314 TGCCTTTTAATTAAAATTTTGGG + Intergenic
1188968752 X:36586611-36586633 TTCTTTTTAAATAAAATTTTAGG + Intergenic
1189134030 X:38531279-38531301 TGTAATTTGCATAAAAGTTTAGG - Intronic
1189533489 X:41911558-41911580 TGCTGTTGTAATAAAATTTTGGG + Intronic
1190933880 X:54975927-54975949 TCCACTTTGAATTATTTTTTGGG - Intronic
1193047014 X:77064282-77064304 TACACTTTTAGTAGAATTTTAGG + Intergenic
1195234471 X:102883095-102883117 TTCACATGGAATAAAATATTGGG + Intergenic
1195843613 X:109202433-109202455 GGCCATTTGTATAAAATTTTTGG + Intergenic
1196266837 X:113659150-113659172 TTCTCTTTGAATAATAATTTGGG + Intergenic
1196320035 X:114275575-114275597 AGCTCTTTGCATAAAAATTTAGG - Intergenic
1196619271 X:117804240-117804262 TGGCCTTGGAATAAAATTTACGG + Intergenic
1196864423 X:120058075-120058097 TTCACTTTAAAAAAAATCTTCGG + Intergenic
1196878677 X:120178256-120178278 TTCACTTTAAAAAAAATCTTCGG - Intergenic
1197006512 X:121508251-121508273 TACACTTTAAATACAATTTTTGG + Intergenic
1197030756 X:121811400-121811422 TCCATTTTGAATTAACTTTTGGG + Intergenic
1197716832 X:129715205-129715227 AGCACTTTCCTTAAAATTTTCGG - Intergenic
1197980733 X:132216614-132216636 AGCACTTTGAAAAAATTATTTGG - Intronic
1198263977 X:134992479-134992501 TGCATTTAGAATGAAATTTGGGG + Intergenic
1198280226 X:135134253-135134275 TGCACTTTGATTAATAGTTGGGG - Intergenic
1198290732 X:135238261-135238283 TGCACTTTGATTAATAGTTGGGG + Intergenic
1198775074 X:140171005-140171027 TACACTTTGAATGAATTTTATGG - Intergenic
1199547903 X:149027280-149027302 TTAGCTTGGAATAAAATTTTAGG - Intergenic
1200917016 Y:8580183-8580205 TGCACTTTGCATTAATATTTTGG + Intergenic
1200926282 Y:8657796-8657818 TGCACTTTGCAGAAGATTTCTGG + Intergenic
1200972115 Y:9163809-9163831 TGAATGTTGAAGAAAATTTTTGG + Intergenic
1201060790 Y:10044465-10044487 TTCCCTTTGAATCAAATTATGGG - Intergenic
1201427379 Y:13867367-13867389 TGCACTGAGAAGAAAAGTTTAGG + Intergenic
1201507287 Y:14716474-14716496 TTCATTTTGAGTAAATTTTTGGG - Intronic