ID: 1183819814

View in Genome Browser
Species Human (GRCh38)
Location 22:40337111-40337133
Sequence TCCAATCTGGTCTCCTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183819814_1183819819 9 Left 1183819814 22:40337111-40337133 CCAAAATAGGAGACCAGATTGGA No data
Right 1183819819 22:40337143-40337165 TATACCAAGGCCGGGCGCAGTGG No data
1183819814_1183819816 -4 Left 1183819814 22:40337111-40337133 CCAAAATAGGAGACCAGATTGGA No data
Right 1183819816 22:40337130-40337152 TGGATTCAAAAGTTATACCAAGG No data
1183819814_1183819818 1 Left 1183819814 22:40337111-40337133 CCAAAATAGGAGACCAGATTGGA No data
Right 1183819818 22:40337135-40337157 TCAAAAGTTATACCAAGGCCGGG No data
1183819814_1183819817 0 Left 1183819814 22:40337111-40337133 CCAAAATAGGAGACCAGATTGGA No data
Right 1183819817 22:40337134-40337156 TTCAAAAGTTATACCAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183819814 Original CRISPR TCCAATCTGGTCTCCTATTT TGG (reversed) Intergenic
No off target data available for this crispr