ID: 1183820671

View in Genome Browser
Species Human (GRCh38)
Location 22:40343675-40343697
Sequence GAGTTTGCCATCAATGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183820667_1183820671 9 Left 1183820667 22:40343643-40343665 CCAGGAACACAGACATGATCTCT No data
Right 1183820671 22:40343675-40343697 GAGTTTGCCATCAATGAGCAAGG No data
1183820665_1183820671 28 Left 1183820665 22:40343624-40343646 CCAGGTTTGGGGCTCAGTGCCAG No data
Right 1183820671 22:40343675-40343697 GAGTTTGCCATCAATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183820671 Original CRISPR GAGTTTGCCATCAATGAGCA AGG Intergenic
No off target data available for this crispr