ID: 1183821066

View in Genome Browser
Species Human (GRCh38)
Location 22:40346455-40346477
Sequence GGGGCGGGACTTCCTTCACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183821066_1183821082 25 Left 1183821066 22:40346455-40346477 CCGCGTGAAGGAAGTCCCGCCCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1183821082 22:40346503-40346525 TTTCCGCTTCCGCTCTTCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 107
1183821066_1183821075 2 Left 1183821066 22:40346455-40346477 CCGCGTGAAGGAAGTCCCGCCCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1183821075 22:40346480-40346502 CCCGTCCTGCCCTGGCCTCCAGG 0: 1
1: 0
2: 9
3: 59
4: 575
1183821066_1183821069 -6 Left 1183821066 22:40346455-40346477 CCGCGTGAAGGAAGTCCCGCCCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1183821069 22:40346472-40346494 CGCCCCGCCCCGTCCTGCCCTGG 0: 1
1: 2
2: 28
3: 119
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183821066 Original CRISPR GGGGCGGGACTTCCTTCACG CGG (reversed) Intergenic
900419804 1:2551016-2551038 GGGGCCTGGCTCCCTTCACGTGG + Intergenic
900425169 1:2575022-2575044 GGGGCCTGGCTCCCTTCACGTGG - Intergenic
903062533 1:20679800-20679822 AGGGCTGGACTTCTTTCAGGAGG - Intronic
903331140 1:22597776-22597798 GAGGCGGGACTTCCTGAGCGAGG + Exonic
903681848 1:25102719-25102741 GAGGGAGGACTTCCTTCAGGTGG - Intergenic
904896219 1:33820381-33820403 GGGGCTGGCCTTCCTGCAGGTGG - Intronic
913059061 1:115188074-115188096 GTGGATGGACTTCCTTCATGAGG + Intergenic
915238526 1:154502707-154502729 GGCGAGGGGCTTCCTTCCCGGGG - Intronic
916305152 1:163321940-163321962 GGGGCGGGACTTCCAGTAGGAGG + Exonic
917694861 1:177511986-177512008 TGGTCAGGACTTCATTCACGAGG + Intergenic
922220835 1:223557416-223557438 GGGGCAGGACCACCTTCATGGGG - Intronic
922334983 1:224611821-224611843 GAGGCGGTAATTCCTTCACAAGG - Intronic
1067039796 10:42943202-42943224 GAGGTGGGACTTCCTTCTGGAGG + Intergenic
1069610835 10:69771450-69771472 GGGGCGGGACTGGCCTCATGGGG + Intergenic
1069919189 10:71806032-71806054 GGGGCGGGGCTTTCTTCTGGGGG + Intronic
1072749662 10:97968656-97968678 GGGGCGGCACTGCCTTCCTGGGG - Intronic
1077305430 11:1866779-1866801 GGGGCTGCACTTCCTTCTCTTGG - Exonic
1078619168 11:12891956-12891978 GGGGCTGGACCTCCTGGACGTGG + Intronic
1082188104 11:49208641-49208663 GGGGCCGGATTTCCTTCTCCTGG - Exonic
1085528459 11:77177458-77177480 GGGGCTGCTCTTCCTTCACTGGG - Intronic
1091636706 12:2202679-2202701 GGAAGGGGACTTGCTTCACGTGG + Intronic
1094849128 12:34374470-34374492 GGGGAGGCAATTTCTTCACGGGG + Intergenic
1097237459 12:57549956-57549978 GGGGCGGGGCTCCCTCCACTGGG - Intergenic
1101391391 12:104303672-104303694 GGGGCGGGGCTGTCTTCCCGCGG + Intronic
1102874754 12:116440991-116441013 GGGGTGGGGCTTCCTTCCCTGGG - Intergenic
1104064297 12:125294063-125294085 GGCTTGGGACTTCCTTCACCTGG - Intronic
1111396904 13:87676687-87676709 GGGGCTGGACCTCCTGCACCTGG + Exonic
1114223584 14:20718433-20718455 GGGGCGGCACTTTCTTGACTTGG + Intergenic
1115604128 14:34983160-34983182 GGGCCGGGAATTCCTTAGCGAGG - Exonic
1122689817 14:103526863-103526885 GGGGAGGGACTGCAGTCACGTGG + Intergenic
1132559990 16:589271-589293 GGGGCGGGACTTCCGCCCGGCGG - Intergenic
1136666979 16:31820496-31820518 GGTGCATGACTTCCTTCCCGTGG - Intergenic
1137672640 16:50288191-50288213 GGGGCGCTACTTCCTCAACGAGG + Exonic
1141206428 16:81936386-81936408 GGGACGGGACTACCTTCAGTCGG - Intronic
1143058064 17:4177269-4177291 GGGCCGGAATTTCCTTCATGTGG - Exonic
1143446815 17:7014746-7014768 AGGGCGGGACTTCCTGCGCGGGG + Exonic
1146632995 17:34484041-34484063 GGGTCAGGCCTTCCTTCACAAGG + Intergenic
1151660388 17:75515520-75515542 GGGGCGGGATTTCCTGCGGGAGG - Exonic
1160122090 18:76139922-76139944 GGGGTGGGACTTCCCTCCTGAGG + Intergenic
1160754069 19:748548-748570 GGGGCAGGACTGGCTTCCCGGGG + Intergenic
1161169949 19:2807686-2807708 GGGGCTGGCCTTCCACCACGAGG + Exonic
1163343763 19:16727023-16727045 GGGGTGGGACTTTCGTCAAGCGG + Intronic
1164822813 19:31263569-31263591 GGGGAGGGACTTCCTGCATGGGG + Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1168544666 19:57240586-57240608 GGGGCGGGACTTCCGGCATTTGG + Intergenic
932161507 2:69464604-69464626 GGGGCAGGATTTCCCTCAAGTGG + Intronic
932765316 2:74465396-74465418 GGGGCGGGACTTCCGGCGGGAGG - Exonic
932882499 2:75516933-75516955 GGCCCTGGACTTCCTTAACGGGG + Intronic
936267276 2:111020220-111020242 TGGGTGGGGCTTCCTTCATGTGG + Intronic
938341324 2:130538496-130538518 TGGGCTGGAGTTCCCTCACGTGG - Intergenic
938348507 2:130582213-130582235 TGGGCTGGAGTTCCCTCACGTGG + Intronic
941008349 2:160270260-160270282 GGGGCTGGAATTCCTTCGCCCGG + Intronic
941883250 2:170502816-170502838 GAGGAGGGACTTCTTTCAAGAGG - Intronic
946291363 2:218747883-218747905 GGGGAGGGTCTTCCTGCATGCGG + Intronic
948268438 2:236656220-236656242 GGGCTGGGGCTTCCTTCATGGGG + Intergenic
1175962086 20:62642417-62642439 GGGGCGGGGTTTCCTGCGCGGGG - Intronic
1176110770 20:63409793-63409815 GGGGCGGGACTTCCTGCCACTGG + Intronic
1176110784 20:63409838-63409860 GGGGCGGGACTTCCTGCCACTGG + Intronic
1176110798 20:63409883-63409905 GGGGCGGGACTTCCTGCCACTGG + Intronic
1176110812 20:63409928-63409950 GGGGCGGGACTTCCTGCCACTGG + Intronic
1183821066 22:40346455-40346477 GGGGCGGGACTTCCTTCACGCGG - Intergenic
1185315880 22:50178944-50178966 GGTACGGGATTTCCTTCTCGGGG - Exonic
949821778 3:8123672-8123694 GGGGCAGGATTTCCTCCACTTGG - Intergenic
950476345 3:13217360-13217382 GTGGCGGGGCTTCCTCCACTTGG + Intergenic
960055491 3:113273884-113273906 GGGGCAGTGCTTCCTTCAGGAGG - Intronic
964720229 3:159763299-159763321 GGGGAGGGAGGTCCTTCACAGGG + Intronic
966914999 3:184579787-184579809 GCGGCGGGACTTCCTAAGCGAGG + Exonic
967825749 3:193876083-193876105 GAGGCGAGAGTTCCTTCAAGGGG - Intergenic
969498473 4:7539682-7539704 GGGGCGGGGCCTCCATAACGGGG - Intronic
969604320 4:8194832-8194854 TGGGCAGGACTTGCTTCCCGGGG + Intronic
998644538 5:144047949-144047971 GGGTAGGGAGTTGCTTCACGTGG + Intergenic
1021985970 7:26098858-26098880 TGCGTGGGACTTCCTTCACTGGG + Intergenic
1023890441 7:44388327-44388349 GGGGCCGGAGTTGCTTCACTGGG - Intronic
1032334028 7:131007864-131007886 GGGGCCGTTCTTCCTTCAAGAGG - Intergenic
1038485319 8:27930996-27931018 GGGAGGGGCCTTCCTTCAGGTGG + Intronic
1040024363 8:42768394-42768416 GGGGCAGGGATTCCTTCATGGGG - Exonic
1048077181 8:131084327-131084349 GGGGCAGGCCTTCCTTAAGGTGG + Intergenic
1053273490 9:36766207-36766229 GAGGCGGGGCTTCCTCCGCGGGG - Intergenic
1060239066 9:121887745-121887767 GGGGAGGCACTTTCTTCATGGGG - Intronic
1062399743 9:136367170-136367192 GAGGCTGGCCTTCCTTCACCTGG - Intronic
1062406723 9:136400207-136400229 GAGGCGGGACTTCCGGCGCGCGG - Intergenic
1062456974 9:136644570-136644592 TGGGCGGGGCTCCCTGCACGTGG - Intergenic
1185603774 X:1355488-1355510 AGGGCTGGACTTCCTTCCAGGGG + Intronic
1186516028 X:10166661-10166683 GAGGCGGTACTTCATACACGGGG + Intronic
1200156982 X:153982077-153982099 GGGGCAGGCCTTCGTGCACGTGG + Exonic