ID: 1183823947

View in Genome Browser
Species Human (GRCh38)
Location 22:40370557-40370579
Sequence TGGGCGGCCGCGGGTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823947_1183823954 6 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823947_1183823959 26 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823947_1183823960 27 Left 1183823947 22:40370557-40370579 CCAGCATGACCCGCGGCCGCCCA 0: 1
1: 0
2: 2
3: 8
4: 100
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823947 Original CRISPR TGGGCGGCCGCGGGTCATGC TGG (reversed) Intronic