ID: 1183823948

View in Genome Browser
Species Human (GRCh38)
Location 22:40370566-40370588
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 254}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183823948_1183823960 18 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823960 22:40370607-40370629 GGCGCCGCTGAGCGCTGACTGGG 0: 1
1: 0
2: 1
3: 7
4: 56
1183823948_1183823959 17 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823959 22:40370606-40370628 AGGCGCCGCTGAGCGCTGACTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1183823948_1183823954 -3 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823954 22:40370586-40370608 GCCCCGCCACGCGTGCGCTTAGG 0: 1
1: 0
2: 0
3: 6
4: 57
1183823948_1183823963 28 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823963 22:40370617-40370639 AGCGCTGACTGGGTGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1183823948_1183823964 29 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823964 22:40370618-40370640 GCGCTGACTGGGTGCGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 85
1183823948_1183823962 27 Left 1183823948 22:40370566-40370588 CCCGCGGCCGCCCATGCCACGCC 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1183823962 22:40370616-40370638 GAGCGCTGACTGGGTGCGAGTGG 0: 1
1: 0
2: 1
3: 2
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183823948 Original CRISPR GGCGTGGCATGGGCGGCCGC GGG (reversed) Intronic